target_name_canonical,target_type,aptamer_name,kd_reported,kd_log10_molar,measurement_class,assay_method,assay_temperature_k,source_pmid,verbatim_quote
PDGF-BB,protein,36aApt,0.036 pM,-13.444,non_intrinsic,ELISA,298.0,28825469,36aApt | 0.036 ± 0.012 | - 18.33
PDGF-BB,protein,38aApt,0.094 pM,-13.027,non_intrinsic,ELISA,298.0,28825469,38aApt | 0.094 ± 0.008 | - 17.76
IL-8,protein,8A-35,1.72e-12 M,-11.764,intrinsic,SPR,298.0,24129312,| 8A-35       | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80         | 3.11 x 10 1  |
human α-Thrombin,protein,A1,2.0 pM,-11.699,intrinsic,,,31129134,"Also for aptamer A1 we measured with MST KD values in the pico- and nanomolar range (2 pM and 52 nM). The lowest KD value is determined with MST (shown as bar) for aptamer A1, which is 2 pM."
SARS-CoV-2 spike protein (wild type),protein,DSA1N5,3e-12 M,-11.523,avidity_multivalent,dot_blot,,36926840,"DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B)."
nucleolin,protein,Cy5-AT11-B0,3.3e-12 M,-11.481,intrinsic,,,31301466,yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8
SW480 cells,cell/EV,Apt-nanovesicle,3.66 pM,-11.437,non_intrinsic,,,32049531,The dissociation constant ( K d ) value of Apt-nanovesicle against SW480 cells was found to be 3.66 ± 0.34 pM (Figure 2B)
SARS-CoV-2 spike protein (wild type),protein,DSA1N5,3.9e-12 M,-11.409,avidity_multivalent,dot_blot,,36926840,"DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B)."
SARS-CoV-2 pseudotyped lentivirus (omicron variant),protein,DSA1N5,4.8e-12 M,-11.319,avidity_multivalent,dot_blot,,36926840,"This study demonstrates that DSA1N5 has high affinity for recognizing OMPV with a K d value of 4.8 pM, which is in the same order of magnitude as that measured for the WTPV (2.1 pM) in deionized water (DI water)"
SARS-CoV-2 pseudotyped lentivirus (omicron variant),protein,DSA1N5,5.1e-12 M,-11.292,avidity_multivalent,dot_blot,,36926840,DSA1N5 preserves its binding affinity in 50% wastewater ( K d = 2.1 -4.1 pM for WTPV and 5.1 for OMPV in wastewater).
nucleolin,protein,Cy5-AT11,5.2e-12 M,-11.284,intrinsic,,,31301466,yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8
PDGF-BB,protein,FullApt,5.33 pM,-11.273,non_intrinsic,ELISA,298.0,28825469,FullApt | 5.33 ± 2.36 | - 15.37
PDGF-BB,protein,40Apt,5.92 pM,-11.228,non_intrinsic,ELISA,298.0,28825469,40Apt | 5.92 ± 1.13 | - 15.31
PDGF-BB,protein,38bApt,7.03 pM,-11.153,non_intrinsic,ELISA,298.0,28825469,38bApt | 7.03 ± 1.28 | - 15.21
nucleolin,protein,Cy5-AT11,9.1e-12 M,-11.041,intrinsic,,,31301466,K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4
nucleolin,protein,Cy5-AT11-B0,9.5e-12 M,-11.022,intrinsic,,,31301466,K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4
thrombin,protein,HD1-12A-DAB,13.1 pM,-10.883,non_intrinsic,filter_binding,,41053535,HD1-12A-DAB EXACT inhibitor bound to thrombin and prothrombin with K D s of 13.1 pm
P-selectin,protein,PF377,14.0 pM,-10.854,intrinsic,filter_binding,310.15,9743465,PF377 | 14
P-selectin,protein,PF377sl,14.0 pM,-10.854,intrinsic,filter_binding,296.15,9743465,PF377sl | 14
P-selectin,protein,PF377,16.0 pM,-10.796,intrinsic,filter_binding,310.15,9743465,PF377 | 16
P-selectin,protein,PF377,18.0 pM,-10.745,intrinsic,filter_binding,277.15,9743465,PF377 | 18
thrombin,protein,Supra-TBA15/29-GO,1.9e-11 M,-10.721,avidity_multivalent,,,31157200,"Supra-TBA15 / 29-GO prepared with GO (40 μ g mL -1 ) at 60 ◦ C exhibited much higher binding affinity toward thrombin ( K d = 1.9 × 10 -11 M, Figure S10 , Supporting Information)."
Malate Synthase,protein,MS10-Trunc,19.0 pM,-10.721,intrinsic,,,31704587,MS10-Trunc aptamer exhibited high af fi nity for MS (equilibrium dissociation constant [KD]  19 pM)
PDGF-C,protein,α-PC,20.0 pM,-10.699,intrinsic,SPR,,42138517,SPR analysis demonstrated that the α -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM
SW480 cells,cell/EV,Fixed Apt-nanovesicle,28.06 pM,-10.552,non_intrinsic,,,32049531,the K d value of fi xed Apt-nanovesicles to SW480 cells was increased to 28.06 ± 3.31 pM (Figure 2D)
P-selectin,protein,PF377sl,29.0 pM,-10.538,intrinsic,filter_binding,310.15,9743465,PF377sl | 29
VEGF165,protein,3R02 Bivalent,3e-11 M,-10.523,avidity_multivalent,,,23237717,The K d value of 30 pM for 3R02 Bivalent was calculated by measuring SPR.
bevacizumab,protein,A14#1,44.0 pM,-10.357,intrinsic,,,35114463,affinity of A14#1 to bevacizumab markedly increased at pH 4.7 ( K D = 44 pM)
P-selectin,protein,PF377sl,46.0 pM,-10.337,intrinsic,filter_binding,310.15,9743465,PF377sl | 46
thrombin,protein,MP-TBA15/TBA29-T15,5.2e-11 M,-10.284,avidity_multivalent,saturation_binding,,22300379,"MP-TBA15/TBA29-T15 -Au NPs provided high flexibility and an appropriate orientation and distance between TBA and TBA units for bivalent binding, allowing stronger interactions with thrombin ( K d = 5.2 × 10 -11 M; Supporting Information, Figure S3)"
P-selectin,protein,PF373sl,56.0 pM,-10.252,intrinsic,filter_binding,310.15,9743465,PF373sl | 56
sLe X -BSA,glycan/conjugate,Clone 5,5.7e-11 M,-10.244,intrinsic,SPR,298.15,11178986,sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11
von Willebrand factor A1-domain,protein,Rn-DsDsDs-53mh,61.3 pM,-10.213,intrinsic,SPR,310.15,27966933,RnDsDsDs-53mh ( K D = 61.3 pM)
Myoglobin,protein,anti-Mb aptamer,65.0 pM,-10.187,intrinsic,,,25957831,"The corresponding af fi nity, K D, values calculated from the ratio between dissociation ( k d) and association ( k a ) was found to be  65 pM."
von Willebrand factor A1-domain,protein,Rn-DsDsDs-44,74.9 pM,-10.126,intrinsic,SPR,310.15,27966933,Rn-DsDsDs-44 ( K D = 74.9 pM) exhibited the highest a ffi nity
CCRF-CEM cells,cell/EV,CDN-sgc8,0.08 nM,-10.097,non_intrinsic,fluorescence,,35670775,Kd=0.08±0.01 nM
sLe X -BSA,glycan/conjugate,Clone 5,8.5e-11 M,-10.071,intrinsic,SPR,298.15,11178986,Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11
PDGF-BB,protein,PDGF-B aptamer,0.1 nM,-10.0,intrinsic,filter_binding,,9916931,the binding affinity of the aptamer used in the experiments described below ( K d ≈ 0.1 nM)
ofloxacin,protein,Q2,0.11 nM,-9.959,intrinsic,,,26547431,Their K D values were calculated at K D 1⁄4 0.11 nM ( 7 0.06) for aptamer Q2
MutS,protein,2-06,1.23e-10 M,-9.91,intrinsic,,,25668425,The best fi t was obtained at K d = 123 pM and [T]0 = 213 pM
MPO,protein,MPO-16,166.0 pM,-9.78,non_intrinsic,flow_cytometry,,37277648,MPO16 revealed the highest binding affinity ( K d = 166 pM)
P-selectin,protein,PF398sl,178.0 pM,-9.75,intrinsic,filter_binding,310.15,9743465,PF398sl | 178
von Willebrand factor A1-domain,protein,Rn-DsDs-51mh2,182.0 pM,-9.74,intrinsic,SPR,310.15,27966933,Rn-DsDs-51mh2 ( K D = 182 pM)
HBcAg,protein,A-9,2.0000000000000003e-10 M,-9.699,intrinsic,affinity_real_time_qPCR,,32250595,This aptamer showed strong binding to HBcAg ( K d : 0.2 nM)
ofloxacin,protein,Q8,0.2 nM,-9.699,intrinsic,,,26547431,K D 1⁄4 0.20 nM ( 7 0.09) for aptamer Q8
OH-BDE47,protein,BDE-A-8,0.2 nM,-9.699,intrinsic,,,27566357,"The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition."
MPO,protein,MPO-02,227.0 pM,-9.644,non_intrinsic,flow_cytometry,,37277648,MPO-02 ... 227
P-selectin,protein,PF377sl,250.0 pM,-9.602,non_intrinsic,flow_cytometry,296.15,9743465,PF377sl | 250
thrombin,protein,29-mer thrombin-specific aptamer,298.0 pM,-9.526,intrinsic,,,32570818,The n-curve analysis provided a Kd of 298 pM ( + 111 / 81 pM)
VEGF165,protein,3R02,3e-10 M,-9.523,intrinsic,,,23237717,The K d value for 3R02 was 300 pM
20 Methyl Spirolide G,protein,SPX 7,3e-10 M,-9.523,intrinsic,,,34144421,"The present study, among the aptamers selected, the aptamer with highest affinity had a dissociation constant of 0.3 nM for SPX G"
chimeric-tPA,protein,Chi-tPA 1,0.32 nM,-9.495,intrinsic,,,26876003,selected aptamer having KD values of 0.320 nM
von Willebrand factor A1-domain,protein,ARC1172-41,326.0 pM,-9.487,intrinsic,SPR,310.15,27966933,ARC1172-41 ( K D = 326 pM)
FLRPp (O serotype),protein,FMD_1,3.46e-10 M,-9.461,intrinsic,SPR,,42010751,dissociation constants ( KD ) of 3.46 × 10 -10 M
Human thrombin,protein,Lin08-08,0.4 nM,-9.398,non_intrinsic,SPR,,37621412,Lin(08-08) | 1.63 10^6 | 6.94 10^-4 | 0.4
Human thrombin,protein,Pse08-08,0.4 nM,-9.398,non_intrinsic,SPR,,37621412,Pse(08-08) | 1.19 10^6 | 5.10 10^-4 | 0.4
HBeAg,protein,EAg3-Py,4.0000000000000007e-10 M,-9.398,intrinsic,affinity_real_time_qPCR,,32250595,The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3
CCRF-CEM cells,cell/EV,mono-CDN-sgc8,0.48 nM,-9.319,non_intrinsic,fluorescence,,35670775,Kd= 0.48 ± 0.04 nM
PDGF-BB,protein,PDGF-specific aptamer,5e-10 M,-9.301,intrinsic,microcantilever,310.15,24723743,"K d , as shown in Fig. 10, decreased from approximately 12 × 10 -10 M to 5 × 10 -10 M as the temperature changed from 19 to 37 ◦ C."
human α-thrombin,protein,Apt29,0.5 nM,-9.301,non_intrinsic,,,28763192,"a 29nucleotide aptamer (5 ′ -AGT CCG TGG TAG GGC AGG TTG GGG TGA CT-3 ′ , denoted as Apt29 here) binds to the heparin-binding site of human α -thrombin with a dissociation constant ( K d) around 0.5 nM."
thrombin,protein,TBA29,0.5 nM,-9.301,non_intrinsic,,,31614078,The 29-nt TBA29 aptamer has a bimodular duplex-antiparallel G4 structure and binds to thrombin with a binding a ffi nity of 0.5 nM. 30
BDNF,protein,NV_B12,5e-10 M,-9.301,intrinsic,ALISA,,38149631,"The equilibrium dissociation constant ( K d) for the NV_B12/BDNF interaction was obtained by fitting the equation, Y = B max × X /( K d + X )... The K d value determined to be 0.5 nM (95% CI: 0.4 -0.6 nM)"
Thrombin,protein,TBA29,5e-10 M,-9.301,intrinsic,,,26643617,and TBA29 (~5 × 10 -10 M)
PlanarAu,protein,1N,5.600000000000001e-10 M,-9.252,intrinsic,QCM,,30189130,aptamer 1N showing the highest affinity (0.56 nM)
AGEs-HSA,protein,#9s,0.57 nM,-9.244,intrinsic,,,24012635,"Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively."
sLe X -BSA,glycan/conjugate,Selected pool,5.8e-10 M,-9.237,intrinsic,SPR,,11178986,Selected pool | 2.4 3 10 5 | 1.4 3 10 2 3 | 1.7 3 10 9 | 5.8 3 10 2 10
human α-thrombin,protein,5'-TMR-Apt15-T24,0.6 nM,-9.222,non_intrinsic,CE-LIF,298.15,28763192,0.6 nM for 5 ′ -TMR-Apt15-T24
human α-thrombin,protein,5'-TMR-Apt15-T25,0.6 nM,-9.222,non_intrinsic,CE-LIF,298.15,28763192,0.6 nM for 5 ′ -TMR-Apt15-T25
EGFR,protein,Anti-EGF receptor aptamer,0.62 nM,-9.208,non_intrinsic,,,41877526,"Anti-EGF receptor aptamers ( K d : 0.62 nM, DNA aptamers)"
AGEs-HSA,protein,#4s,0.63 nM,-9.201,intrinsic,,,24012635,"Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively."
thrombin,protein,HD1-22,6.5e-10 M,-9.187,non_intrinsic,SPR,,18826387,HD1-22 | Thrombin | K D ( M) | 6.5 · 10 ) 10
MutS,protein,2-06,6.5e-10 M,-9.187,intrinsic,,,25668425,The experimental points from the second step resulted in the best fi t with the theoretical dependence of R versus [L] 0 at K d = 650 pM
human α-thrombin,protein,5'-TMR-Apt15-T30,0.7 nM,-9.155,non_intrinsic,CE-LIF,298.15,28763192,0.7 nM for 5 ′ -TMR-Apt15-T30
human α-thrombin,protein,5'-TMR-Apt15-T35,0.7 nM,-9.155,non_intrinsic,CE-LIF,298.15,28763192,0.7 nM for 5 ′ -TMR-Apt15-T35
tetracycline,protein,TC aptamer,770.0 pM,-9.114,intrinsic,,,25517161,dissociation constant Kd of 770 pM ([Mg 2 þ ] 1⁄4 10 mM)
sLe X -BSA,glycan/conjugate,Clone 2,8e-10 M,-9.097,intrinsic,SPR,,11178986,Clone 2 | 9.8 3 10 5 | 7.3 3 10 2 5 | 1.2 3 10 9 | 8.0 3 10 2 10
PSMA,protein,C3,8.000000000000001e-10 M,-9.097,intrinsic,EMSA,,41126016,an exemplar shows very high affinity for PSMA ( K d ∼ 0.8 nM).
Immunoglobulin E,protein,IgE37-T10-FAM,0.8 nM,-9.097,intrinsic,,,32498825,The FA assay using T10-labeled aptamer with a dissociation constant ( K d) about 0.8 nM
CCRF-CEM cells,cell/EV,individual sgc8,0.82 nM,-9.086,non_intrinsic,fluorescence,,35670775,Kd=0.82 ± 0.12 nM
Tasset - thrombin complex,protein,Bock,0.87 nM,-9.06,intrinsic,BSI,283.15,22032342,Bock - [Tasset complex] | not available | 0.87 ( 0.18 nM
MPO,protein,MPO-14,897.0 pM,-9.047,non_intrinsic,flow_cytometry,,37277648,MPO-14 ... K d : 897 pM
MPO,protein,MPO-03,912.0 pM,-9.04,non_intrinsic,flow_cytometry,,37277648,MPO-03 ... 912
alpha-thrombin,protein,RNAR9D-14T,1.0 nM,-9.0,intrinsic,filter_binding,310.15,22385910,Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) and α-thrombin (apparent Kd =1 nM)
P-selectin,protein,PF422sl,1000.0 pM,-9.0,intrinsic,filter_binding,310.15,9743465,PF422sl | 1 X 103
neomycin,protein,Aptamer A,1e-09 M,-9.0,intrinsic,,,36453647,The binding affinity of neomycin to Aptamer A shows a strong K d  of 1 nM with an enthalpy and entropy value of -100 kJ/mol & -163.1 J/mol. K
Sc3+,protein,Sc-1,1e-09 M,-9.0,intrinsic,fluorescence,,39743479,true K d for the binding of Sc-1 to Sc 3+ to be 1.0 nM
PSMA,protein,C3 (without fluorescein),1e-09 M,-9.0,intrinsic,EMSA,,41126016,"EMSA data show that Cy5-labeled C3 without fluorescein binds PSMA just as strongly as the parent construct, with an apparent K d of ∼ 1 nM (Figure S9)."
von Willebrand factor A1-domain,protein,Pr-DsDsDs-40,1.03 nM,-8.987,intrinsic,SPR,310.15,27966933,Pr-DsDsDs-40 ( K D = 1.03 nM)
Heparin-binding protein,protein,Apt-13,1.04 nM,-8.983,intrinsic,,,38675537,"The KD values of the three aptamers were 3.42, 1.44, and 1.04 nM, respectively"
beta-conglutin,protein,11-mer,1.05e-09 M,-8.979,intrinsic,MST,298.15,33498970,KD values determined (Figure 6b) are very similar (11-mer: 1.05 nM
AP65,protein,AP65_A1,1.057e-09 M,-8.976,intrinsic,ELAA,298.15,29972299,A K D value of 1.057 nM was obtained using the sigmoidal dose-response curve model
MPO,protein,MPO-01,1148.0 pM,-8.94,non_intrinsic,flow_cytometry,,37277648,"MPO-01 ... 1,148"
PDGF-BB,protein,PDGF-specific aptamer,1.2e-09 M,-8.921,intrinsic,microcantilever,292.15,24723743,"K d , as shown in Fig. 10, decreased from approximately 12 × 10 -10 M to 5 × 10 -10 M as the temperature changed from 19 to 37 ◦ C."
HBeAg,protein,A-9S,1.2e-09 M,-8.921,intrinsic,affinity_real_time_qPCR,,32250595,The measured dissociation constant ( K d) is improved by 19 times  from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.
PvTRAg,protein,Apt_16,1.2e-09 M,-8.921,intrinsic,,,40042916,"The K D of Apt_14 and Apt_16 was found to be comparable, 1.9 and 1.2 nM, respectively"
ATP,protein,Huizenga-Szostak ATP aptamer,1.3e-09 M,-8.886,intrinsic,fluorescence,,25170558,binding a ffi nity can be tuned over 4 orders of magnitude (1.3 nM -203 μ M)
prothrombin,protein,RNAR9D-14T,1.4 nM,-8.854,intrinsic,SPR,298.15,22385910,"Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM"
PD-L1,protein,8-60,1.4 nM,-8.854,intrinsic,,,34711320,"8 e 60, a representative aptamer with high af fi nity (KD 1⁄4 1.4 nM determined by SPR)"
Heparin-binding protein,protein,Apt-02,1.44 nM,-8.842,intrinsic,,,38675537,"The KD values of the three aptamers were 3.42, 1.44, and 1.04 nM, respectively"
alkaline phosphatase,protein,ALP binding aptamer,1.49e-09 M,-8.827,avidity_multivalent,PISA,,30827094,"Similarly, from the response -dose curve (Figure 3B), the K d value for the aptamer -MIP hybrid-coated array was estimated to be 1.49 × 10 -9 M"
thrombin,protein,T.7,1.5 nM,-8.824,intrinsic,SPR,,37798416,T.7 exhibited the strongest binding signal with a 1.5 nM K d
alkaline phosphatase,protein,ALP binding aptamer,1.5000000000000002e-09 M,-8.824,avidity_multivalent,PISA,,30827094,giving cross-reactivity of 3.2 -5.6% and a dissociation constant of 1.5 nM
OH-BDE47,protein,BDE-A-12,1.53 nM,-8.815,intrinsic,,,27566357,"The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition."
IgE,protein,S2,1.5500000000000002e-09 M,-8.81,intrinsic,NECEEM,,36144553,"Based on the results of these experiments, the K D values of S1 and S2 were estimated to be 0.83 and 1.55 nM, respectively"
human α-thrombin,protein,LOOPER modified thrombin aptamer,1.6000000000000003e-09 M,-8.796,intrinsic,SPR,,28938065,"Using single-cycle kinetics surface plasmon resonance (SPR), the LOOPER aptamer exhibited a Kd of 1.6 nM"
hOX40,protein,9C7,1.7 nM,-8.77,intrinsic,filter_binding,310.15,23113766,9C7 | 11 | 1.7
HBeAg,protein,EAg3,1.7000000000000001e-09 M,-8.77,intrinsic,affinity_real_time_qPCR,,32250595,"The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3, as compared to the K d value of 1.7 nM with the unmodi fi ed EAg3 aptamer."
beta-conglutin,protein,TT-11-mer,1.88e-09 M,-8.726,intrinsic,MST,298.15,33498970,KD values determined (Figure 6b) are very similar (... TT-11 mer: 1.88 nM
Bock - thrombin complex,protein,Tasset,1.9 nM,-8.721,intrinsic,BSI,283.15,22032342,Tasset - [Bock complex] | not available | 1.9 ( 0.2 nM
CD8a,protein,A3,1.9 nM,-8.721,non_intrinsic,flow_cytometry,,31209354,"the A1, A3 and A8 aptamers have apparent K D values of 18.3 ± 4.6, 1.9 ± 0.8 and 2.4 ± 0.9  nM, respectively"
CD8,protein,CD8 aptamer,1.9 nM,-8.721,non_intrinsic,flow_cytometry,,32786336,"The aptamer with the highest apparent affinity (1.9 nM) and association rate, measured by flow cytometry and biolayer interferometry, respectively, was chosen for further use in cell isolation."
VWF A1-domain,protein,ARC1779,2.0 nM,-8.699,intrinsic,filter_binding,298.15,19422452,This resulted in a final aptamer (ARC1779) that is a 40-nucleotide modified DNA/RNA oligonucleotide with a K D of 2 nM for the A1-domain.
von Willebrand factor,protein,42-nt DNA aptamer,2.0 nM,-8.699,intrinsic,ELISA,,31493779,a biotinylated DNA aptamer was able to bind an antibody-captured VWF in a concentration-dependent manner with a dissociation constant ( KD ) of 2.0 nM  0.3.
von Willebrand factor A1 domain,protein,ARC1779,2.0 nM,-8.699,non_intrinsic,,,21108551,ARC1779 binds with high affinity (Kd ~ 2 nM) to the vWF A1 domain
VWF A1 domain,protein,ARC1779,2.0 nM,-8.699,non_intrinsic,,,31315441,ARC1779 has a high binding affinity to VWF A1 domain (K D ≈ 2 nM)
CD8,protein,A3t,2.0 nM,-8.699,non_intrinsic,,,36149728,"A3t, a CD8 receptor-binding aptamer, which binds CD8-expressing cells with an equilibrium dissociation constant K D of 2 nM."
CD8,protein,rvCD8apt,2.0 nM,-8.699,non_intrinsic,,,36149728,apparent K D = 2 nM for CD8 + cells
CD44-HABD,protein,Motif 4 (ADDA adduct),2e-09 M,-8.699,intrinsic,,,23057694,motifs 2 and 4(ADDA adduct) have ~2 nM affinity to CD44-HABD
THY1,protein,XA-B217,2.0 nM,-8.699,intrinsic,,,33242496,"The equilibrium dissociation constants, Kd, were derived from these curves and are determined as ... XA-B217=2 nM"
Progesterone,protein,PG13T2,2.1 nM,-8.678,intrinsic,,,28237255,The dissociation constant of the PG13T2-P4 complex calculated using non-linear regression fi tting of the obtained curve was found to be 2.1 nM.
IL-23,protein,A23P15,2.139 nM,-8.67,intrinsic,,,38810331,"the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively"
sLe X -BSA,glycan/conjugate,Clone 15,2.3e-09 M,-8.638,intrinsic,SPR,,11178986,Clone 15 | 3.5 3 10 5 | 8.1 3 10 2 4 | 4.3 3 10 8 | 2.3 3 10 2 9
alpha-fetoprotein,protein,AFP-specific ssDNA aptamer,2.37 nM,-8.625,intrinsic,,,22410487,The K d of the AFP-specific ssDNA was calculated to be 2.37 nM
thrombin,protein,HD22,2.4e-09 M,-8.62,intrinsic,SPR,,18826387,HD22 | Thrombin | K D ( M) | 2.4 · 10 ) 9
CD8a,protein,A8,2.4 nM,-8.62,non_intrinsic,flow_cytometry,,31209354,"the A1, A3 and A8 aptamers have apparent K D values of 18.3 ± 4.6, 1.9 ± 0.8 and 2.4 ± 0.9  nM, respectively"
melatonin,protein,MLT-A-2,2.4 nM,-8.62,intrinsic,,,36925277,K d = 2.4 ± 2.8 nM for MLT-A-2
melatonin,protein,MLT-A-2F,2.4 nM,-8.62,intrinsic,,,36925277,MLT-A-2F K d = 2.4 ± 2.8 nM
MPO,protein,MPO-05,2584.0 pM,-8.588,non_intrinsic,flow_cytometry,,37277648,"MPO-05 ... 2,584"
beta-conglutin,protein,11-mer-TT,2.59e-09 M,-8.587,intrinsic,MST,298.15,33498970,KD values determined (Figure 6b) are very similar (... and 11-mer-TT: 2.59 nM)
Human thrombin,protein,Pse08-29,2.6 nM,-8.585,non_intrinsic,SPR,,37621412,Pse(08 - 29) | 1.33 10^6 | 3.47 10^-3 | 2.6
Prostate Specific Antigen,protein,Apta,2.6 nM,-8.585,intrinsic,,,25569871,"The change in current is used to determine the PSA -aptamer dissociation constant KD , of ca. 2.6 nM."
Human Cardiac Troponin I,protein,TnIApt 23,2.69 nM,-8.57,intrinsic,,,26003883,Finally TnIApt 23 showed beast affinity in nanomolar range (2.69 nM) toward the target protein.
beta-conglutin,protein,TT-11-mer-TT,2.71e-09 M,-8.567,intrinsic,MST,298.15,33498970,KD values determined (Figure 6b) are very similar (... TT-11-mer-TT: 2.71 nM
Neuron specific enolase,protein,P-5C8G,2.76 nM,-8.559,intrinsic,,,38091739,"The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively."
thrombin,protein,TBA,2.86e-09 M,-8.544,intrinsic,SPR,,16053288,thrombin | 2.2 10 5 | 6.3 10 - 4 | 3.4 10 8 | 2.86 10 - 9
IL-23,protein,A23P6,2.88 nM,-8.541,intrinsic,,,38810331,"the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively"
hCD4,protein,U26,2.93 nM,-8.533,intrinsic,qPCR,298.15,32567629,U26 exhibited the highest binding affinity ( K d = 2.93 ± 1.03 nM) to hCD4-conjugated beads.
S-adenosylmethionine,protein,Bs SAM-I riboswitch,3.0000000000000004e-09 M,-8.523,intrinsic,,,23343213,"Both μ MSA values agree well with results from the in-line probing assays performed using identical buffer conditions: ... 3 nM K d , respectively"
S-adenosylmethionine,protein,Pi SAM-I riboswitch,3.0000000000000004e-09 M,-8.523,intrinsic,,,23343213,which is on the order of the 3 nM value measured using a conventional inline probing assay
dT70,protein,DCC-SSB,3.0000000000000004e-09 M,-8.523,intrinsic,,,34085169,"At a low concentration ( ∼ 2.5 nM), the titration with dT70 gave an approximate assessment of affinity ( K d ∼ 3 nM)."
SARS-CoV-2 RBD,protein,CoV2-RBD-1,3.1000000000000005e-09 M,-8.509,intrinsic,flow_cytometry,,32551560,the dissociation constant values ( K d) of the CoV2-RBD-1 aptamer ... were 3.1 nM
MPO,protein,MPO-18,3192.0 pM,-8.496,non_intrinsic,flow_cytometry,,37277648,"MPO-18 ... K d : 3,192 pM"
human α-thrombin,protein,Apt15-T25-3'-TMR,3.2 nM,-8.495,non_intrinsic,CE-LIF,298.15,28763192,The apparent K d of Apt15-T25 -3 ′ -TMR was estimated to be about 3.2 nM.
K562,protein,PAM,3.2 nM,-8.495,non_intrinsic,,,32307868,the K d value (3.2 nM) of PAM in binding the K562 cell is one order of magnitude lower than that of the aptamer alone (41 nM).
sLe X,glycan/conjugate,Clone 5,3.3e-09 M,-8.481,intrinsic,SPR,,11178986,sLe X | 1.7 3 10 5 | 5.5 3 10 2 4 | 3.0 3 10 8 | 3.3 3 10 2 9
transferrin receptor 1,protein,JBA8.26,3.3 nM,-8.481,non_intrinsic,flow_cytometry,,35875870,JBA8.26 bound TfR1 hi H9 T-lymphoma cells with an apparent K D of 3.3 ± 0.6 nM
human α-Thrombin,protein,B1,3.4 nM,-8.469,intrinsic,,,31129134,"for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)"
prothrombin,protein,HD1,3.5e-09 M,-8.456,non_intrinsic,SPR,,18826387,HD1 | Prothrombin+ phospholipids | K D ( M) | 3.5 · 10 ) 9
Immunoglobulin E,protein,Unlabeled anti-IgE aptamer,3.5 nM,-8.456,intrinsic,,,32498825,close to the K d of the unlabeled aptamer (3.5 nM)
gonyautoxin 1/4,protein,tGO18-T-d,3.6 nM,-8.444,intrinsic,,,33294137,"Corresponding Kd values of GO18-T-d and tGO18-T-d, determined by the average of 8 independent measurements, were 75.63 nM and 3.60 nM, respectively."
Surface Antigen 1,protein,SOK14,3.736 nM,-8.428,intrinsic,,,40288708,"SOK14 (3.736 nM, R 2 = 0.7367)"
human α-thrombin,protein,Tasset,3.84 nM,-8.416,intrinsic,BSI,283.15,22032342,Tasset - thrombin | 0.5 - 1.0 nM 14 | 3.84 ( 0.68 nM
sLe X -BSA,glycan/conjugate,Clone 18,3.9e-09 M,-8.409,intrinsic,SPR,,11178986,Clone 18 | 5.1 3 10 5 | 2.0 3 10 2 3 | 2.5 3 10 8 | 3.9 3 10 2 9
Carcinoembryonic antigen,protein,GAC-P,3.93 nM,-8.406,intrinsic,,,35517255,"The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively."
human α-thrombin,protein,LOOPER modified thrombin aptamer,4e-09 M,-8.398,intrinsic,,,28938065,Preliminary binding analysis by label-free microscale thermophoresis showed a promising dissociation constant K d = 4 nM for thrombin
Surface Antigen 1,protein,SOK18,4.034 nM,-8.394,intrinsic,,,40288708,"SOK18 (4.034 nM, R 2 = 0.8422)"
Surface Antigen 1,protein,SOK3,4.185 nM,-8.378,intrinsic,,,40288708,"SOK3 (4.185 nM, R 2 = 0.8153)"
Mouse thrombin,protein,Pse08-08,4.2 nM,-8.377,non_intrinsic,SPR,,37621412,Pse(08-08) | 7.35 10^5 | 3.06 10^-3 | 4.2
CD19,protein,WB15/15.CD19.1_3S,4.3 nM,-8.367,non_intrinsic,flow_cytometry,310.15,41079126,WB15/15.CD19.1_3S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 3.96 | N.P. | 4.3 ± 2.4
MPO,protein,MPO-04,4376.0 pM,-8.359,non_intrinsic,flow_cytometry,,37277648,"MPO-04 ... 4,376"
melamine,protein,Apt M,4.4000000000000005e-09 M,-8.357,intrinsic,,,37343019,dissociation constant K d = 4.4 nM
RAGE,protein,RAGE-aptamer (clone #2),4.44 nM,-8.353,intrinsic,QCM,,28385802,#2RAGE-aptamer | tcTgTTcAggTTggTAcggTggAAggTgTgATTcAcgAgg | 4.44±0.56
Thyroglobulin,protein,Seq.T-2,4.51 nM,-8.346,intrinsic,,,33303143,"kon = 3.2 × 10 5  M 1 s 1 , koff = 1.44 × 10 3 s 1 , Kd = 4.51 nM"
Carcinoembryonic antigen,protein,P-ATG,4.62 nM,-8.335,intrinsic,,,35517255,"The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively."
Hemagglutinin (HA) protein of AIV H5N1 (A/Vietnam/1203/04),protein,Aptamer sequence (2),4.65 nM,-8.333,intrinsic,,,23523887,"the KD (dissociation constants) was 4.65 nM, indicating strong binding between the HA protein and the selected aptamer."
VEGF165,protein,VEap121,4.700000000000001e-09 M,-8.328,intrinsic,SPR,293.15,23237717,As the calculated K d value of VEap121 was 4.7 nM
Oxytetracycline,protein,OTC3,4.7 nM,-8.328,intrinsic,,,24011458,The lowest K d value (4.7 nM) was obtained with the aptamer OTC3.
SARS-CoV-2 spike RBD,protein,Aptx2-L,4.900000000000001e-09 M,-8.31,avidity_multivalent,flow_cytometry,298.15,41498844,The Aptx2-L variant showed superior affinity with a dissociation constant ( K d) of 4.9 nM
HFIXa,protein,Seq 11,4.93 nM,-8.307,intrinsic,ITC,298.15,38776649,Seq 11- | 7.4 | 0.983 | 203 ± | 4.93 | 130.6 | 279 | 47.42
Myoglobin,protein,Myo40-7-27,4.93e-09 M,-8.307,intrinsic,,,24914856,The aptamer with the highest a ffi nity ( K d = 4.93 nM) was then used for the fabrication of a label-free supersandwich electrochemical biosensor for Myo detection
porcine thrombin,protein,RNAR9D-14T,5.0 nM,-8.301,non_intrinsic,filter_binding,,22385910,RNAR9D-14T binds to porcine thrombin (apparent K d=5 nM)
human α-Thrombin,protein,B2,5.0 nM,-8.301,intrinsic,,,31129134,"for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)"
transferrin receptor 1,protein,JBA8.1,5.5 nM,-8.26,non_intrinsic,flow_cytometry,,35875870,JBA8.1 has an apparent binding affinity (K D ) of 5.5 ± 1.2 nM
CD8a,protein,A8,5.59 nM,-8.253,intrinsic,BLI,298.15,31209354,"the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2,  14.7 ± 0.1  and  5.59 ± 0.11  nM, respectively"
sST2,protein,sS9_P,5.6 nM,-8.252,intrinsic,,,37992929,"in case of sS9, parent aptamer has outperformed its truncated counterpart in terms of affinity as it has shown higher affinity (Kd ~5.6 nM)."
RAGE,protein,RAGE-aptamer (clone #1),5.68 nM,-8.246,intrinsic,QCM,,28385802,#1RAGE-aptamer | ccTgATATggTgTcAccgccgccTTAgTATTggTgTcTAc | 5.68±1.10
HIV-1 Rev,protein,RBA-14,5.9 nM,-8.229,intrinsic,,,30017564,RBA-14 (Figure S2A) binds to Rev with high affinity (K d = 5.9 nM) (Table S1 and Figure 2A).
human α-thrombin,protein,Bock,5.96 nM,-8.225,intrinsic,BSI,283.15,22032342,Bock - thrombin | 1.4 - 6.2 nM 19 | 5.96 ( 0.57 nM
biliverdin,protein,Bvd4,6.000000000000001e-09 M,-8.222,intrinsic,,,40669049,"For the biliverdin selection, the tightest affinity aptamer has a dissociation costant ( K d ) value of 6 nM determined using isothermal titration calorimetry (ITC)"
Mouse thrombin,protein,Pse08-29,6.3 nM,-8.201,non_intrinsic,SPR,,37621412,Pse(08 - 29) | 6.72 10^5 | 4.26 10^-3 | 6.3
human α-Thrombin,protein,A2,6.3 nM,-8.201,intrinsic,,,31129134,for SCORE (b-nd analysis) the best are A2 (6.3 nM)
CD64,protein,lw-27,6.676 nM,-8.175,non_intrinsic,flow_cytometry,310.15,42152987,"Kd values of aptamers lw-1, lw-9, lw-27 are 12.76 nM, 14.03 nM, and 6.676 nM respectively"
Lipopolysaccharide from Klebsiella pneumoniae ATCC 15380,protein,aptamer seq. 5,6.68e-09 M,-8.175,intrinsic,DPV,,41323700,The binding affinity of aptamer seq. 5 was 6.68 nM (Fig. 9C).
Mouse thrombin,protein,Lin08-08,6.7 nM,-8.174,non_intrinsic,SPR,,37621412,Lin(08-08) | 6.41 10^5 | 4.30 10^-3 | 6.7
human β-defensin 2,protein,A ad1,6.8 nM,-8.167,intrinsic,,,32067984,"As a result, A ad1 was found to bind strongly, with a K d of 6.8 nM (Fig. 2)."
transferrin receptor 1,protein,JBA8.26,6.87 nM,-8.163,intrinsic,BLI,,35875870,"Using BLI, JBA8.26 was found to bind immobilized TfR1 with a K D of 6.87 ± 0.04 nM"
human α-Thrombin,protein,A3,6.9 nM,-8.161,intrinsic,,,31129134,for SCORE (b-nd analysis) the best are A2 (6.3 nM) and A3 (6.9 nM)
Carcinoembryonic antigen,protein,P,6.95 nM,-8.158,intrinsic,,,35517255,"The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively."
Salmonella enteritidis,protein,SENT-9,7.000000000000001e-09 M,-8.155,apparent_cellular,,,22971146,It was observed that the aptamer pool collected at the seventh round of selection had the highest binding a ffi nity to the bacteria ( K D = 7 nM).
thrombin,protein,HD1,7.1e-09 M,-8.149,intrinsic,SPR,,18826387,HD1 | Thrombin | K D ( M) | 7.1 · 10 ) 9
PTK7,protein,4AsF,7.2 nM,-8.143,intrinsic,SPR,310.15,41065179,"4AsF, which exhibited a 10-fold reduction compared to 4APS (0.77 vs 7.20 nM)"
VEGF165,protein,cot-pega,7.33 nM,-8.135,intrinsic,,,26956592,The K D of cot-pega for VEGF was 7.33 nM (Fig. 1b)
Carcinoembryonic antigen,protein,P-GTG,7.33 nM,-8.135,intrinsic,,,35517255,"The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively."
sLe X -BSA,glycan/conjugate,Clone 4,7.4e-09 M,-8.131,intrinsic,SPR,,11178986,Clone 4 | 4.1 3 10 5 | 3.1 3 10 2 3 | 1.3 3 10 8 | 7.4 3 10 2 9
human α-Thrombin,protein,B3,7.6 nM,-8.119,intrinsic,,,31129134,"for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)"
Surface Antigen 1,protein,SOK16,7.6 nM,-8.119,intrinsic,,,40288708,"SOK16 (7.6 nM, R 2 = 0.8704)"
murine OX40,protein,9.8,8.0 nM,-8.097,intrinsic,filter_binding,,18635004,"Aptamer 9.8 was chosen for further study, since it had the highest affinity for the OX40 fusion protein."
Cu2+,protein,Co-1,8e-09 M,-8.097,intrinsic,,,40656531,The corresponding true K d values were ... 8 nM for Cu 2+
human α-Thrombin,protein,A3,8.0 nM,-8.097,intrinsic,,,31129134,For BLI it was found that aptamer A3 (8 nM and 25.5 nM) is the best binder
EsxG,protein,G43,8.04 nM,-8.095,intrinsic,,,24813997,"The dissociation constants of the G43 and G78 aptamers were 8.04 ± 1.90 and 78.85 ± 9.40 nM, respectively."
NP,protein,NP-C04,8.1e-09 M,-8.092,intrinsic,fluorescence,,30740973,"the K d values of NP-D01, NP-C04, and NP-D02 were 76..1 ± 10.9, 8.1 ± 2.4, and 41.3 ± 9.5 nM, respectively."
digoxin,protein,D1,8.2e-09 M,-8.086,intrinsic,,,23021809,"Binding studies of fluorescein-labeled truncated (without primer binding region) D1 and D2 and full length D1 anti-digoxin aptamers were performed and their corresponding dissociation constants values were 8.2 × 10 -9 , 44.0 × 10 -9 and 17.8 × 10 -9 M, respectively."
EN2,protein,EBA,8.26 nM,-8.083,intrinsic,,,35798816,EBA had K d =  8.26 nM (R 2 =  0.971)
human thrombin,protein,Azo-1,8.3 nM,-8.081,intrinsic,,,33039563,"The K d values of Azo-1 binding to human thrombin were calculated to be around 3.1 and 8.3 nM before and after irradiation, respectively. However, the reproducibility of K d value measurements is poor (n = 3; S.D. = 2.2 and 5.1 nM, respectively)."
human β-defensin 2,protein,A ad1-3,8.4 nM,-8.076,intrinsic,,,32067984,"In contrast, a clone with a 5 ʹ terminal truncation (A ad1 -3 , 69mer, Fig. 4a) could bind to HBD-2 with roughly the same strength as the original sequence ( K d = 8.4 nM, Fig. 4c)."
Okadaic Acid,protein,OA-LC2-TF,8.735 nM,-8.059,intrinsic,BLI,,36322695,The terminal-fixed OA-LC2 (OA-LC2-TF) exhibited a K d of 8.735 ± 0.606 nM
MPO,protein,MPO-25,8778.0 pM,-8.057,non_intrinsic,flow_cytometry,,37277648,"MPO-25 ... K d : 8,778 pM"
human α-thrombin,protein,5'-TMR-T25-Apt15,8.8 nM,-8.056,non_intrinsic,CE-LIF,298.15,28763192,"The apparent K d values of T25-Apt15-3 ′ -TMR and 5 ′ -TMR-T25-Apt15 were estimated as 228 nM and 8.8 nM, respectively"
MPT64,protein,aptamer sequence (17),8.92 nM,-8.05,intrinsic,,,28454652,KD (dissociation equilibrium constant) was 8.92 nM
Streptococcus pyogenes M-type mixture,protein,20A24P,9.000000000000001e-09 M,-8.046,apparent_cellular,flow_cytometry,,21504182,"Two aptamers, 20A24P and 15A3P (with estimated binding dissociation constants of 9 and 10 nM, respectively)"
TAR RNA,protein,TAR RNA aptamer (best binding),9.000000000000001e-09 M,-8.046,intrinsic,,,39167715,A Biolayer Interferometry (BLI) experiment revealed that TAR RNA aptamers with the best binding affinity exhibited the dissociation constant ( K D) at 9 nM
HBeAg,protein,EAg2,9.2e-09 M,-8.036,intrinsic,affinity_real_time_qPCR,,32250595,"A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1, 9.2 nM for EAg2"
human α-Thrombin,protein,B1,9.2 nM,-8.036,intrinsic,,,31129134,For SCORE (Anabel analysis) the best is B1 (9.2 nM)
CD19,protein,WB15/15.CD19.1_2S,9.5 nM,-8.022,non_intrinsic,flow_cytometry,310.15,41079126,WB15/15.CD19.1_2S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 2.64 | 356 ± 534 | 9.5 ± 5.0
HBeAg,protein,EAg1,9.5e-09 M,-8.022,intrinsic,affinity_real_time_qPCR,,32250595,"A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1"
SP6 RNA polymerase,protein,S05,9.5 nM,-8.022,intrinsic,,,22426482,"The dissociation constant and 50% inhibitory concentration of the aptamer were estimated 9.5 nM and 24.8 nM, respectively."
PDGFR β,protein,Gint4.T,9.6 nM,-8.018,intrinsic,filter_binding,,24566984,This aptamer is able to specifically bind to the human PDGFR β ectodomain (Kd: 9.6 nM)
thrombin,protein,3G,9.8 nM,-8.009,intrinsic,MST,,33614235,3G | 52.9 | 9.8 ± 0.6 | 3.34
α-thrombin,protein,TBA-iT7,9.9 nM,-8.004,non_intrinsic,SPR,298.15,30735210,TBA-iT7 | 9.9
sLe X -BSA,glycan/conjugate,Clone 9,1e-08 M,-8.0,intrinsic,SPR,,11178986,Clone 9 | 3.5 3 10 5 | 3.1 3 10 2 3 | 9.5 3 10 7 | 1.0 3 10 2 8
prothrombin,protein,RNAR9D-14T,10.0 nM,-8.0,intrinsic,filter_binding,310.15,22385910,Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM)
hOX40,protein,11F11,10.0 nM,-8.0,intrinsic,filter_binding,310.15,23113766,11F11 | 8 | 10
Streptococcus pyogenes M-type mixture,protein,15A3P,1e-08 M,-8.0,apparent_cellular,flow_cytometry,,21504182,"Two aptamers, 20A24P and 15A3P (with estimated binding dissociation constants of 9 and 10 nM, respectively)"
streptavidin,protein,S8,1e-08 M,-8.0,intrinsic,,,30520292,"At pH 7.4, we determined that S8 has a K d of 10 nM"
bevacizumab,protein,A14#1,10.0 nM,-8.0,intrinsic,,,35114463,"One of the three mutants, A14#1_GC2, showed higher affinity than A14#1 ( K D = 10 nM, Supplementary Fig. S3a)."
MPO,protein,MPO-08,10050.0 pM,-7.998,non_intrinsic,flow_cytometry,,37277648,"MPO-08 ... 10,050"
Neuron specific enolase,protein,P-4A29C,10.13 nM,-7.994,intrinsic,,,38091739,"The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively."
trastuzumab,protein,CH1S-3,1.0300000000000001e-08 M,-7.987,intrinsic,MST,298.15,32516525,a ffi nity with a K d value of aptamer CH1S-3 of 10.3 nM
Sc3+,protein,Sc-1,1.0300000000000001e-08 M,-7.987,intrinsic,fluorescence,,39743479,an apparent K d value of 10.3 nM was obtained
CD8,protein,CD8AP17,10.59 nM,-7.975,non_intrinsic,flow_cytometry,277.15,23791505,Kd=10.59 nM
thrombin,protein,3Leu,10.9 nM,-7.963,intrinsic,MST,,33614235,3Leu | 54.3 | 10.9 ± 0.2 | 4.15
transferrin receptor 1,protein,tJBA8.1,10.9 nM,-7.963,non_intrinsic,flow_cytometry,,35875870,versus that of 10.9 ± 2.4 nM for tJBA8.1
CD19,protein,WB15/15.CD19.1_1S,11.0 nM,-7.959,non_intrinsic,flow_cytometry,310.15,41079126,WB15/15.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 125 ± 68 | 11 ± 6.1
17 β -Estradiol,protein,22-mer aptamer,1.1000000000000001e-08 M,-7.959,intrinsic,,,25803717,new 35-mer and 22-mer aptamers were generated with K D ' s of 14 and 11 nM
PLN 1-32,protein,RNA-Apt30,11.0 nM,-7.959,intrinsic,,,25240642,"Such binding was dependent on the concentration of aptamer, with a dissociation constant ( K d) of 11 nM (Fig. 2A)."
25-HydroxyvitaminD3,protein,VDBA14,11.0 nM,-7.959,intrinsic,,,27520502,the dissociation constants (Kd) of the VDBA14 was estimated to be 11 nM based on a non-linear regression method.
β-conglutin,protein,unmodified β-CBA II aptamer,11.1 nM,-7.955,intrinsic,,,36354481,"with a similar KD of 11.1 nM and 18.5 nM obtained for the unmodified and modified aptamer, respectively."
CD8,protein,CD8AP17,11.23 nM,-7.95,non_intrinsic,flow_cytometry,277.15,23791505,The binding affinity of CD8AP17 to Sup-T1 cells ( K d 5 11.23 nM)
MPO,protein,MPO-06,11223.0 pM,-7.95,non_intrinsic,flow_cytometry,,37277648,"MPO-06 ... 11,223"
thrombin-HRP,protein,TBA,1.13e-08 M,-7.947,intrinsic,SPR,,16053288,thrombin-HRP | 6.7 10 4 | 7.6 10 - 4 | 8.7 10 7 | 1.13 10 - 8
Immunoglobulin E,protein,IgE37-T10-FAM (4-bp truncated),11.4 nM,-7.943,intrinsic,,,32498825,"When 4-base pairs and 5-base pairs were truncated from the stem, the K ds of the aptamers increased to 11.4 nM and 90.5 nM, respectively."
α-thrombin,protein,TBA-iT9,11.5 nM,-7.939,non_intrinsic,SPR,298.15,30735210,TBA-iT9 | 11.5
Thyroid-Stimulating Hormone Receptor (TSHR) 6X His tag,protein,ZMXLY-2a,11.5 nM,-7.939,non_intrinsic,flow_cytometry,,40588369,"As determined by flow cytometry, the K d of ZMXLY-2a was 11.5 ± 9.3 nM (Figure 2G)"
thrombin,protein,3L,11.6 nM,-7.936,intrinsic,MST,,33614235,3L | 51.5 | 11.6 ± 0.5 | 5.28
CTLA-4,protein,aptCTLA-4,11.84 nM,-7.927,intrinsic,,,28918052,dissociation constant (Kd) being 11.84 nM
Salmonella typhimurium,protein,NTri-triApt,1.1890000000000001e-08 M,-7.925,avidity_multivalent,ELISA,310.15,37893744,"the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively"
LPS,protein,NH2-5'-CTT CTG CCC GCC TCC TTC CTAG CCG GAT CGC GCT GGC CAG ATG ATA TAA AGG GTC AGC CCC CCA -GGA GAC GAG ATA GGC GGA CAC T-3',11.9 nM,-7.924,intrinsic,,,22182428,Amine-terminated aptamer exhibiting high affinity ( K d = 11.9 nM) to LPS
streptavidin,protein,SA23,12.0 nM,-7.921,intrinsic,,,23312325,The respective Kd values for streptavidin binding in the monofunctional aptamer ... were 12 nM
coat protein of grouper nervous necrosis virus,protein,A5,12.0 nM,-7.921,intrinsic,,,26892075,calculated binding affinities ( Kd ) of 12 nM for A5
bevacizumab,protein,A14#1,12.0 nM,-7.921,intrinsic,,,35114463,A14#1 showed binding capacity with K D = 12 nM.
thrombin,protein,Uyne A - AUyne,12.16 nM,-7.915,intrinsic,BLI,,37531184,U yne A - AUyne | 12.16 ± 0.02
U87MG GBM with IDH1 htz mutation,protein,Gli-55,1.22e-08 M,-7.914,apparent_cellular,flow_cytometry,298.15,39682297,The apparent dissociation constant measured for U87MG GBM with the IDH1 htz mutation ( Kd ) of Gli-55 is 12.2 nM
α-thrombin,protein,TBA-G8-iT8,12.4 nM,-7.907,non_intrinsic,SPR,298.15,30735210,TBA-G8-iT8 | 12.4
RAGE,protein,RAGE-aptamer (clone #3),12.44 nM,-7.905,intrinsic,QCM,,28385802,#3RAGE-aptamer | tTccAcTgAgTgccgcggAcTgTTgTTgggAggTggTgTg | 12.44±1.52
CD64,protein,lw-1,12.76 nM,-7.894,non_intrinsic,flow_cytometry,310.15,42152987,"Kd values of aptamers lw-1, lw-9, lw-27 are 12.76 nM, 14.03 nM, and 6.676 nM respectively"
CD8,protein,CD8AP17s,12.86 nM,-7.891,non_intrinsic,flow_cytometry,277.15,23791505,Kd=12.86 nM
HIV-1 Rev,protein,Stem IIB,12.9 nM,-7.889,intrinsic,,,30017564,The 35-nt hairpin with the Stem IIB sequence (Figure S2B) binds to Rev with a similar affinity (K d  = 12.9 nM) (Table S1 and Figure 2B).
human α-thrombin,protein,5'-TMR-Apt15-T18,13.0 nM,-7.886,non_intrinsic,CE-LIF,298.15,28763192,the apparent dissociation constants ( K d) of TMR-labeled Apt15 having polyT tail with length ranging from 18 to 35 T were estimated and are summarized in Figure 1C: 13 nM for 5 ′ -TMR-Apt15-T18
sST2,protein,sS9_P,13.0 nM,-7.886,intrinsic,,,37992929,The best performing aptamer candidate sS9_P (80mer) has shown affinity in low nanomolar range (~5.6 nM in ALISA and ~13 nM in ITC)
PlanarAu,protein,1N truncated,1.304e-08 M,-7.885,intrinsic,QCM,,30189130,1N truncated (Kd = 13.04 nM)
Bisphenol A,protein,38-mer BPA aptamer,13.17 nM,-7.88,intrinsic,,,32113141,"The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM"
Staphylococcal enterotoxin A,protein,Apt5,13.36 nM,-7.874,intrinsic,,,38762575,The aptamer with the highest affinity showed an experimental dissociation constant (K D) of 13.36 ± 18.62 nM.
CD25,protein,Apt51,13.4 nM,-7.873,intrinsic,,,29055191,"Using non-linear regression analysis, the Kd of Apt51 and Apt70 aptamers were found to be 13.4 nM and 138.6 nM, respectively"
Staphylococcal enterotoxin D,protein,Aptamer 1,13.43 nM,-7.872,intrinsic,,,39894103,"The KD of the aptamer for SED was determined using SPR and ELASA. The KD values were calculated as 4.4 ± 2.26 nM and 13.43 nM, respectively."
SARS-CoV-2 RBD,protein,CoV2-RBD-4,1.3600000000000001e-08 M,-7.866,intrinsic,flow_cytometry,,32551560,the dissociation constant values ( K d) of the ... CoV2-RBD-4 aptamer ... were ... 13.6 nM
U87MG GBM with IDH1 htz mutation,protein,Gli-35,1.3600000000000001e-08 M,-7.866,apparent_cellular,flow_cytometry,298.15,39682297,"while for Gli-35, it is 13.6 nM."
thrombin,protein,Uyne A - Uyne Uyne,13.96 nM,-7.855,intrinsic,BLI,,37531184,U yne A - U yne U yne | 13.96 ± 0.03
Le A,protein,Clone 5,1.4e-08 M,-7.854,intrinsic,SPR,,11178986,Le A | 7.3 3 10 2 | 1.0 3 10 2 5 | 7.2 3 10 7 | 1.4 3 10 2 8
IL4Rα,protein,cl.42,14.0 nM,-7.854,intrinsic,FACS,,22282665,"The calculated K d (14 nM, Fig. 2D) was within the range of anti -IL4R a antibodies"
CD20,protein,WB1/1.CD20.1_3S,14.0 nM,-7.854,non_intrinsic,flow_cytometry,310.15,41079126,WB1/1.CD20.1_3S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 3.96 | 15 ± 7.4 | 14 ± 8.3
17 β -Estradiol,protein,35-mer aptamer,1.4000000000000001e-08 M,-7.854,intrinsic,,,25803717,new 35-mer and 22-mer aptamers were generated with K D ' s of 14 and 11 nM
Oxytetracycline,protein,OTC16,14.0 nM,-7.854,intrinsic,,,24011458,"The other 3 aptamers, that is, OTC6, OTC9, and OTC16, showed higher K d values, that is, 9.5, 8.0, and 14.0 nM, respectively"
CD64,protein,lw-9,14.03 nM,-7.853,non_intrinsic,flow_cytometry,310.15,42152987,"Kd values of aptamers lw-1, lw-9, lw-27 are 12.76 nM, 14.03 nM, and 6.676 nM respectively"
enrofloxacin,protein,Apt58,14.19 nM,-7.848,intrinsic,,,29574118,"The obtained Kd of Apt58 and Apt6, with non-linear regression analysis, were 14.19 nM and 50.77 nM, respectively."
Escherichia coli O157:H7,protein,E. coli O157:H7-specific aptamer,1.4400000000000002e-08 M,-7.842,apparent_cellular,fluorescence,298.15,41850902,"the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM)."
thrombin,protein,3Ser,14.6 nM,-7.836,intrinsic,MST,,33614235,3Ser | 51.7 | 14.6 ± 0.3 | 2.51
CD8a,protein,A3,14.7 nM,-7.833,intrinsic,BLI,298.15,31209354,"the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2,  14.7 ± 0.1  and  5.59 ± 0.11  nM, respectively"
Neuron specific enolase,protein,P-4G10T,14.82 nM,-7.829,intrinsic,,,38091739,"The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively."
human immunoglobulin E,protein,T40-AptIgE-3'-TMR,15.0 nM,-7.824,non_intrinsic,CE-LIF,298.15,28763192,The K d of T40-AptIgE-3 ′ -TMR was about 15 nM
CD20,protein,WB1/1.CD20.1_3S,15.0 nM,-7.824,non_intrinsic,flow_cytometry,277.15,41079126,WB1/1.CD20.1_3S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 3.96 | 15 ± 7.4 | 14 ± 8.3
thrombin,protein,TBA15-AnBtz,1.5000000000000002e-08 M,-7.824,intrinsic,,,37857354,apparent dissociation constant ( K d ) of 15 nM
XBP1,protein,R6 pool,15.0 nM,-7.824,intrinsic,,,26874109,dissociation equilibrium constant equal to 15 nM
hexahistidine peptide,protein,AptHis-1,15.0 nM,-7.824,intrinsic,,,32739349,the Kd was as low as 15 nM (Table S1)
hexahistidine peptide,protein,AptHis-2,15.0 nM,-7.824,intrinsic,,,32739349,the Kd was as low as 15 nM (Table S1)
hexahistidine peptide,protein,AptHis-3,15.0 nM,-7.824,intrinsic,,,32739349,the Kd was as low as 15 nM (Table S1)
THY1,protein,XA-A9,15.0 nM,-7.824,intrinsic,,,33242496,"The equilibrium dissociation constants, Kd, were derived from these curves and are determined as XA-A9=15 nM"
Dinophysistoxin,protein,DTX-SL1-TF,15.45 nM,-7.811,intrinsic,BLI,,36322695,DTX-SL1-TF showed a K d of 15.45 ± 1.92 nM
human α-Thrombin,protein,B1,15.7 nM,-7.804,intrinsic,,,31129134,"for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)"
α-thrombin,protein,TBA-iT7,15.9 nM,-7.799,non_intrinsic,SPR,298.15,30735210,TBA-iT7 | 15.9
N-acetyl-5-hydroxytryptamine,protein,MLT-A-4F,0.016 μM,-7.796,intrinsic,,,36925277,"for NAT very low K d value was observed i.e., 0.016 μM"
fibrin,protein,FA,16.6 nM,-7.78,non_intrinsic,microscale thermophoresis,,33395250,"Interestingly, it was determined that FA has a higher a ffi nity toward fi brin, with the K d of 16.6 nM"
sLe A,glycan/conjugate,Clone 5,1.7e-08 M,-7.77,intrinsic,SPR,,11178986,sLe A | 1.2 3 10 3 | 1.9 3 10 2 5 | 5.9 3 10 7 | 1.7 3 10 2 8
CD19,protein,WB17/17.CD19.1_3S,17.0 nM,-7.77,non_intrinsic,flow_cytometry,310.15,41079126,WB17/17.CD19.1_3S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 3.96 | 18 ± 6.4 | 17 ± 5.5
Progesterone,protein,P4G13,1.7e-08 M,-7.77,intrinsic,,,25486123,"The dissociation constant of the best aptamer, designated as P4G13, was estimated to be 17 nM by electrochemical impedance spectroscopy (EIS) as well as fl uorometric assay."
VEGF-165,protein,bivalent construct for VEGF-165 (no linker),1.7e-08 M,-7.77,avidity_multivalent,,,27043498,this bivalent construct had about 28-fold higher binding affinity ( K D = 17 nM)
human α-Thrombin,protein,A2,17.0 nM,-7.77,intrinsic,,,31129134,"for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)"
hnRNP A1,protein,AS1411,1.75e-08 M,-7.757,intrinsic,BLI,,38784467,"for AS1411, the K d value was 17.5 nM (Fig. 6B)"
human α-Thrombin,protein,B3,17.6 nM,-7.754,intrinsic,,,31129134,"for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)"
GTX1/4,protein,GO18-T-d,17.7 nM,-7.752,intrinsic,,,26802576,we truncated GTX1/4 aptamer and obtained the aptamer core sequence with a higher K d of 17.7 nM.
digoxin,protein,D1,1.78e-08 M,-7.75,intrinsic,,,23021809,"Truncated (without primer binding region) D1, truncated D2 and full length D1 were bound to digoxin-BSA with Kd value of 8.2 × 10 -9 , 44 × 10 -9 and 17.8 × 10 -9 M, respectively"
CD19,protein,WB17/17.CD19.1_3S,18.0 nM,-7.745,non_intrinsic,flow_cytometry,277.15,41079126,WB17/17.CD19.1_3S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 3.96 | 18 ± 6.4 | 17 ± 5.5
CD8a,protein,A1,18.3 nM,-7.738,non_intrinsic,flow_cytometry,,31209354,"the A1, A3 and A8 aptamers have apparent K D values of 18.3 ± 4.6, 1.9 ± 0.8 and 2.4 ± 0.9  nM, respectively"
β-conglutin,protein,biotinylated dUTPs aptamer,18.5 nM,-7.733,intrinsic,,,36354481,"with a similar KD of 11.1 nM and 18.5 nM obtained for the unmodified and modified aptamer, respectively."
Escherichia coli O157:H7,protein,E. coli O157:H7-specific aptamer,1.92e-08 M,-7.717,apparent_cellular,fluorescence,298.15,41850902,"the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM)."
LDL-R,protein,RNV-L7,19.6 nM,-7.708,intrinsic,,,31841991,RNV-L7 aptamer showed speci fi c binding to its LDL-R target with a binding af fi nity value of 19.6 nM.
CD19,protein,WB17/17.CD19.1_4S,20.0 nM,-7.699,non_intrinsic,flow_cytometry,310.15,41079126,WB17/17.CD19.1_4S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 5.28 | 21 ± 13 | 20 ± 12
hMMP-9,protein,F3Bomf,2e-08 M,-7.699,intrinsic,SPR,296.15,23043415,"The K d was taken as the concentration leading to half saturation, i.e., about 20 nM."
hMMP-9,protein,F3,2e-08 M,-7.699,intrinsic,,,23043415,exhibits a strong a ffi nity for hMMP-9 ( K d = 20 nM)
xanthylacrylamide,protein,XAA-1,2e-08 M,-7.699,intrinsic,,,40261307,The true K d of aptamer XAA-1 was calculated to be 20 nM after accounting for the competitive effect of the quencher-labeled strand
CD8a,protein,A1,20.1 nM,-7.697,intrinsic,BLI,298.15,31209354,"the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2,  14.7 ± 0.1  and  5.59 ± 0.11  nM, respectively"
thrombin,protein,TBA,20.2 nM,-7.695,intrinsic,MST,,33614235,TBA | 50.7 | 20.2 ± 1.3 | 4.81
thrombin,protein,12G,20.7 nM,-7.684,intrinsic,MST,,33614235,12G | 53.4 | 20.7 ± 2.8 | 2.88
hexahistidine peptide,protein,AptHis-C,20.8 nM,-7.682,intrinsic,,,32739349,its dissociation constant was as low as 20.8 nM
CD19,protein,WB17/17.CD19.1_4S,21.0 nM,-7.678,non_intrinsic,flow_cytometry,277.15,41079126,WB17/17.CD19.1_4S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 5.28 | 21 ± 13 | 20 ± 12
hnRNP A1,protein,TBA,2.1100000000000004e-08 M,-7.676,intrinsic,BLI,,38784467,"for TBA, the K d value was 21.1 nM (Fig. 6A)"
saxitoxin,protein,45e,21.2 nM,-7.674,intrinsic,,,35324725,aptamer 45e with a K d value of 21.2 nM
thrombin,protein,3Ala,21.4 nM,-7.67,intrinsic,MST,,33614235,3Ala | 50.9 | 21.4 ± 2.8 | 3.67
SARS-CoV-2 spike RBD,protein,Aptx2-S,2.17e-08 M,-7.664,avidity_multivalent,flow_cytometry,298.15,41498844,compared to 21.7 nM for Aptx2-S
Dinophysistoxin,protein,DTX-SL1,21.75 nM,-7.663,intrinsic,BLI,,36322695,DTX-SL1 showed the lowest K d at 21.75 ± 1.42 nM
CD117,protein,Apta02,21.8 nM,-7.662,intrinsic,BLI,298.15,40487293,"Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 µ m, respectively ( Figure 2 a,b)."
SARS-CoV-2 spike trimer,protein,S14,21.8 nM,-7.662,intrinsic,,,34188971,The aptamer S14 evinced 3-fold higher affinity (KD = 21.8 nM) then S1 (KD = 68.9 nM).
GTX1/4,protein,GO18-T-d,21.9 nM,-7.66,intrinsic,,,26802576,"Therefore, we further removed inactive nucleotides from GO18-T-a and obtained the core aptamer sequence GO18-T-d with a K d of 21.9 nM"
Mouse thrombin,protein,TBA29,22.0 nM,-7.658,intrinsic,SPR,,37621412,TBA29 | 2.76 10^5 | 6.07 10^-3 | 22.0
thrombin,protein,3Phe,22.6 nM,-7.646,intrinsic,MST,,33614235,3Phe | 54.3 | 22.6 ± 4.8 | 3.39
M2-like macrophage,protein,A2,22.81 nM,-7.642,non_intrinsic,flow_cytometry,277.15,32589412,"apparent dissociation constants ( K d ) of 44.12 ± 8.0 and 22.81 ± 5.6 nM to M0- and M2-like macrophages, respectively"
HBeAg,protein,A-9,2.29e-08 M,-7.64,intrinsic,affinity_real_time_qPCR,,32250595,The measured dissociation constant ( K d) is improved by 19 times  from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.
prometryn,protein,P60-1,23.0 nM,-7.638,intrinsic,,,37453395,The Kd value of P60-1 aptamer for prometryn was approximately 23 nM
beta-conglutin,protein,11-mer,2.3300000000000003e-08 M,-7.633,intrinsic,BLI,303.15,33498970,A 2:1 heterogenous model was used to fit the data and calculate the binding affinities resulting in two different KD values of 6.95 and 23.30 nM.
Neuron specific enolase,protein,P,23.83 nM,-7.623,intrinsic,,,38091739,Each of them exhibited higher affinity to NSE than the parent aptamer ( K d = 23.83 nM).
Le X,protein,Clone 5,2.4e-08 M,-7.62,intrinsic,SPR,,11178986,Le X | 6.7 3 10 2 | 1.6 3 10 2 5 | 4.1 3 10 7 | 2.4 3 10 2 8
CD19,protein,WB17.CD19,24.0 nM,-7.62,non_intrinsic,flow_cytometry,310.15,41079126,WB17.CD19 | 5'-AGAGACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGTGGCTTCTT-3' | - | N.P. | 24 ± 4.1
melamine,protein,Mel36-1,2.4000000000000003e-08 M,-7.62,non_intrinsic,,298.15,42261635,Mel36-1 has the most sensitive response with an apparent K d of 24 nM
Cry j 2,protein,CJ2-06,24.0 nM,-7.62,intrinsic,,,25083924,Scatchard analysis based on ELONA showed that BioCJ206 exhibited a high af fi nity for Cry j 2 with a dissociation constant of 24 nM
prostate-cancer-derived small extracellular vesicles,cell/EV,seq25,24.02 nM,-7.619,non_intrinsic,SPR,,41646885,"The affinity of seq25 for positive selection was significantly higher than that of the other aptamers, with a KD of 24.02 nM"
NMP22,protein,NT2a,2.4260000000000003e-08 M,-7.615,intrinsic,MST,,42173503,"The K d values were also determined using MicroScale Thermophoresis (MST), and the K d values of NT2a and NT4a were determined to be 24.26 ± 10.47 and 77.29 ± 25.78 nM (Figures 2d and S3)."
MPO,protein,MPO-34,24910.0 pM,-7.604,non_intrinsic,flow_cytometry,,37277648,"MPO-34 ... K d : 24,910 pM"
murine OX40,protein,11.2,25.0 nM,-7.602,intrinsic,filter_binding,,18635004,11.2 | AUACCAGGAUCACAUCCUGAGGAACCCCGGCUCCCAACCU | 25 | 4
murine OX40,protein,11.4,25.0 nM,-7.602,intrinsic,filter_binding,,18635004,11.4 | CUUUAAUCCUCGCACUCAGCGCGCAUCACCCUUGACAUCA | 25 | 5
murine OX40,protein,9.3,25.0 nM,-7.602,intrinsic,filter_binding,,18635004,9.3 | CAAACCAGCUAUUUCCUGAGGUACCCCGGCUCUCCAUGG | 25 | 4
CD20,protein,WB1/1.CD20.1_4S,25.0 nM,-7.602,non_intrinsic,flow_cytometry,277.15,41079126,WB1/1.CD20.1_4S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 5.28 | 25 ± 12 | 65 ± 38
CD19,protein,WB15/17.CD19.1_3S,25.0 nM,-7.602,non_intrinsic,flow_cytometry,310.15,41079126,WB15/17.CD19.1_3S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 3.96 | N.P. | 25 ± 7.1
Salmonella typhimurium,protein,STYP-3,2.5000000000000002e-08 M,-7.602,apparent_cellular,,,23075417,It was observed that the aptamer pool collected at the seventh round of selection had the highest binding a ffi nity to the bacteria ( K D = 25 nM).
S-adenosylmethionine,protein,Bs SAM-I riboswitch,2.5000000000000002e-08 M,-7.602,intrinsic,,,23343213,Both μ MSA values agree well with results from the in-line probing assays performed using identical buffer conditions: 25 nM K d 
16mer peptide from collagen XI alpha 1 chain,protein,D1,25.0 nM,-7.602,intrinsic,,,34815029,The K d values were identical (about 25 nM)
16mer peptide from collagen XI alpha 1 chain,protein,C1,25.0 nM,-7.602,intrinsic,,,34815029,The K d values were identical (about 25 nM)
transferrin receptor 1,protein,tJBA8.1,25.11 nM,-7.6,intrinsic,BLI,,35875870,tJBA8.1 bound the TfR1 protein with a K D value of 25.11 ± 0.19 nM
rmCD3 d ε,protein,CD3_Apt1 dimer,25.2 nM,-7.599,non_intrinsic,BLI,298.15,38745854,The affinity of the dimeric aptamer was determined by OCTET and was 25.2 nM for Apt1 dimer
Sterigmatocystin,protein,H Seq02,2.53e-08 M,-7.597,intrinsic,ITC,,38175632,"The final fitting curve showed a reduced chi-squared (kcal/mol) 2 of 0.871, and the K D value was 25.3 nM."
human α-Thrombin,protein,A3,25.5 nM,-7.593,intrinsic,,,31129134,For BLI it was found that aptamer A3 (8 nM and 25.5 nM) is the best binder
transferrin receptor 1,protein,tJBA8.1,25.6 nM,-7.592,non_intrinsic,flow_cytometry,,35875870,compared to tJBA8.1's apparent K D of 25.6 ± 13.0 nM for these cells
Staphylococcal enterotoxin B,protein,A2,26.0 nM,-7.585,intrinsic,,,25624325,"A2 and A11 both bound with high affinity to SEB, with dissociation constants of 26 nM and 64 nM, respectively"
adenosine monophosphate,protein,AMP aptamer,26.0 nM,-7.585,intrinsic,,,35934372,BHQ-2-(NH2)2 binds DNA aptamer for AMP with KD = 26 nM.
human α-Thrombin,protein,A2,26.4 nM,-7.578,intrinsic,,,31129134,for iRIf aptamer A2 is the best (26.4 nM)
Bisphenol A,protein,12-mer BPA aptamer,27.05 nM,-7.568,intrinsic,,,32113141,"The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM"
thrombin,protein,3Nic,27.1 nM,-7.567,intrinsic,MST,,33614235,3Nic | 52.1 | 27.1 ± 4.2 | 3.69
thrombin,protein,12L,27.2 nM,-7.565,intrinsic,MST,,33614235,12L | 51.0 | 27.2 ± 3.0 | 4.17
α-thrombin,protein,TBA,27.2 nM,-7.565,non_intrinsic,SPR,298.15,30735210,TBA | 27.2
MPO,protein,MPO-07,27751.0 pM,-7.557,non_intrinsic,flow_cytometry,,37277648,"MPO-07 ... 27,751"
thrombin,protein,HD22 (TA-TT),27.8 nM,-7.556,intrinsic,BLI,,37531184,TA - TT | 27.80 ± 0.09
FGFR3 K650E,protein,SU-3,2.82e-08 M,-7.55,intrinsic,SPR,,31265241,"The predicted K D was 28.2 × 10 -9 ± 19.6 × 10 -9 M( n = 5) in 1 × PBS bu ff er, using 1:1 Langmuir binding model."
CD71,protein,rvCD71apt,28.5 nM,-7.545,non_intrinsic,flow_cytometry,277.15,36149728,"rvCD71apt binds at a high affinity to both activated CD4 + and CD8 + T cells, with apparent K D around 28.5 and 35 nM, respectively (Figure 4A,B)."
hOX40,protein,9C7T,29.0 nM,-7.538,intrinsic,filter_binding,310.15,23113766,observed Kd of * 29nM
dT35,protein,DCC-SSB,2.9e-08 M,-7.538,intrinsic,,,34085169,The second stage was fitted to a hyperbola to give a K d value of 29 nM.
thrombin,protein,3Amide,29.2 nM,-7.535,intrinsic,MST,,33614235,3Amide | 52.6 | 29.2 ± 0.4 | 4.17
Thrombin,protein,aptamer 2S,2.9400000000000002e-08 M,-7.532,intrinsic,SPR,,32268723,"The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 μM and 29.4 nM, respectively"
verrucarin A,protein,Ver1_JYP,2.9500000000000003e-08 M,-7.53,intrinsic,fluorescence,,39404132,The novel ssDNA aptamer exhibited a binding affinity of 29.5 nM
thrombin,protein,3Bz,30.0 nM,-7.523,intrinsic,MST,,33614235,3Bz | 52.3 | 30.0 ± 6.6 | 4.54
L-TAR RNA,protein,D-6-4t,3.0000000000000004e-08 M,-7.523,intrinsic,,,23977945,The Kd of in vitro transcribed D-6-4t for L-TAR is 30 nM
Nucleolin (NCL),protein,rG4-C8 (short loop),30.0 nM,-7.523,intrinsic,,,31325486,"The K D values for the binding interaction between the short loop (112) rG4 and its rG4-C8 complex with NCL were 309 ± 45 nM and 30 ± 22 nM, respectively."
thrombin,protein,12Amide,30.6 nM,-7.514,intrinsic,MST,,33614235,12Amide | 51.2 | 30.6 ± 6.1 | 3.97
Mycobacterium tuberculosis H37Rv,protein,NK2,31.0 nM,-7.509,non_intrinsic,flow_cytometry,,21643749,| NK2    | 31 ± 4 |
Ciprofloxacin,protein,R10K6,3.1e-08 M,-7.509,intrinsic,,,30609709,a dissociation constant (KD) for the RNA-ligand complex of 31 nM was determined.
Clenbuterol,protein,CLB-2,3.1e-08 M,-7.509,intrinsic,,,42204903,The ITC of the CLB2 aptamer showed a complex pattern with a fitted K d of 31 nM (Figure S4)
tetrodotoxin,protein,A36,32.4 nM,-7.489,intrinsic,,,40435760,"Aptamer A36, which exhibited high binding affinity (32.4 nM) and stability ( Δ G = 2.58 kcal/mol), was identified as the optimal TTX aptamer."
PDGF-C,protein,α-PC,33.0 nM,-7.481,intrinsic,SPR,,42138517,SPR analysis demonstrated that the α -PC aptamer bound tightly to mouse PDGF-C with a high affinity ( KD = 33 nM
Thrombin,protein,Antithrombin aptamer,3.3000000000000004e-08 M,-7.481,intrinsic,,,31580650,Antithrombin aptamer with KD of 33 nM was successfully isolated by four rounds of MCP-SELEX.
Alpha-fetoprotein,protein,Group I aptamer,33.0 nM,-7.481,intrinsic,,,22166203,The aptamer interacted with the AFP with a K D of 33 nM.
α-thrombin,protein,TBA-iT3,33.9 nM,-7.47,non_intrinsic,SPR,298.15,30735210,TBA-iT3 | 33.9
Alpha-fetoprotein,protein,Group I aptamer,33.9 nM,-7.47,intrinsic,,,22166203,with a K D of 33.9 nM (group I RNA)
human α-Thrombin,protein,A3,34.6 nM,-7.461,intrinsic,,,31129134,For SCORE (Anabel analysis) the best is B1 (9.2 nM) and the poorest A3 (34.6 nM)
paramylon,protein,Par-15,3.49e-08 M,-7.457,intrinsic,fluorescence,,31809034,"The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 ± 2.61, 34.90 ± 5.83, 64.06 ± 6.72, 123.81 ± 13.41, and 249.52 ± 46.39 nM, respectively."
HNP 1-3,protein,6J,35.0 nM,-7.456,intrinsic,ELISA,,38591344,Regression analysis (Figure 4a) yielded a K d value of 35 nM
Mycobacterium tuberculosis H37Rv,protein,NK7,35.0 nM,-7.456,non_intrinsic,flow_cytometry,,21643749,| NK7    | 35 ± 9 |
CD71,protein,rvCD71apt,35.0 nM,-7.456,non_intrinsic,flow_cytometry,277.15,36149728,"rvCD71apt binds at a high affinity to both activated CD4 + and CD8 + T cells, with apparent K D around 28.5 and 35 nM, respectively (Figure 4A,B)."
Progesterone,protein,PG13,35.0 nM,-7.456,intrinsic,,,28237255,The full length PG13 aptamer which showed the highest af fi nity (Kd 1⁄4 35 nM)
Enrofloxacin,protein,ENR-Apt 6,35.08 nM,-7.455,intrinsic,,,38540931,"Figure 4A shows the non-linear fitting curve of ENR-Apt 6, with a Kd value of 35.08 nM."
CD71,protein,rvCD71apt,35.2 nM,-7.453,non_intrinsic,flow_cytometry,277.15,36149728,rvCD71apt binds to the same cell line with an apparent K D of around 35.2 nM (Figure 2B).
Zearalenone,protein,M1,35.83 nM,-7.446,intrinsic,,,38608399,resulting in a slightly higher Kd value of 35.83 nM
Ciprofloxacin,protein,R10K6_V11,3.6000000000000005e-08 M,-7.444,intrinsic,,,30609709,The determined dissociation constant of 36 nM for V11 is similar to the original full-length aptamer R10K6 (31 nM).
THY1,protein,XA-B216,36.0 nM,-7.444,intrinsic,,,33242496,"The equilibrium dissociation constants, Kd, were derived from these curves and are determined as ... XA-B216=36 nM"
Ara h1,protein,CB-APT1,3.63e-08 M,-7.44,avidity_multivalent,MST,298.15,40083221,"Among them, CBAPT1 exhibited the strongest binding to Ara h1 with a K d value of 36.3 nM in aqueous solutions."
Human thrombin,protein,TBA29,36.9 nM,-7.433,intrinsic,SPR,,37621412,TBA29 | 1.34 10^5 | 4.94 10^-3 | 36.9
α-thrombin,protein,TBA-iT12,37.0 nM,-7.432,non_intrinsic,SPR,298.15,30735210,TBA-iT12 | 37.0
Ni2+,protein,Co-1,3.7e-08 M,-7.432,intrinsic,,,40656531,The corresponding true K d values were ... 37 nM for Ni 2+
human α-Thrombin,protein,B1,37.0 nM,-7.432,intrinsic,,,31129134,and the poorest B1 (37 nM)
α-thrombin,protein,TBA-G8-iT8,37.1 nM,-7.431,non_intrinsic,SPR,298.15,30735210,TBA-G8-iT8 | 37.1
ceftiofur,protein,Apt-9,37.68 nM,-7.424,intrinsic,,,40203705,"Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were ... 37.68 nM"
rmCD3 d ε -Fc,protein,CD3_Apt5,37.9 nM,-7.421,intrinsic,SPR,298.15,38745854,aptamer 5 was the strongest binder (37.9 nM)
Lipopolysaccharide,protein,B2,38.0 nM,-7.42,intrinsic,,,22370280,The SPR-based K d between the immobilized B2 and the LPS was found to be approximately 38 nM.
thrombin,protein,TA-AT,38.7 nM,-7.412,intrinsic,BLI,,37531184,TA - AT | 38.7 ± 0.5
methionyl-tRNA synthetase,protein,70mer pool,38.8 nM,-7.411,intrinsic,,,23399565,"The dissociation constants of the selected 70 and 42mer pools to M. tuberculosis MRS were 38.8 and 51.3 nM, respectively."
thrombin,protein,LOOP,39.0 nM,-7.409,intrinsic,QCM,,16725379,LOOP | 3.27±1.22 | 127±100 | 0.026±0.018 | 39±27
α-thrombin,protein,TBA-iT9,41.0 nM,-7.387,non_intrinsic,SPR,298.15,30735210,TBA-iT9 | 41.0
K562,protein,aptamer-FAM,41.0 nM,-7.387,non_intrinsic,,,32307868,the K d value (3.2 nM) of PAM in binding the K562 cell is one order of magnitude lower than that of the aptamer alone (41 nM).
BTX-2,protein,BT10,42.0 nM,-7.377,intrinsic,,,25725463,"Under these optimum conditions, we have again estimated the binding af fi nity of the BT10 aptamer and a K d value of 42 nM was obtained."
tobramycin,protein,Ap 4,42.12 nM,-7.376,intrinsic,,,30268963,"The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively"
CD71,protein,XQ 2d,42.34 nM,-7.373,non_intrinsic,flow_cytometry,,40156524,"aptamers (HG1-9, K d = 43.23 ± 4.62 nM and XQ-2d, K d = 42.34 ± 5.15 nM))"
saxitoxin,protein,STX-G4-45,42.6 nM,-7.371,intrinsic,,,35324725,"STX-G4-45 ( K d: 42.6 nM, Table S1)"
α-thrombin,protein,TBA,42.7 nM,-7.37,non_intrinsic,SPR,298.15,30735210,TBA | 42.7
Salmonella typhimurium,protein,NTri-biApt,4.3090000000000004e-08 M,-7.366,avidity_multivalent,ELISA,310.15,37893744,"the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively"
CD71,protein,HG1-9,43.23 nM,-7.364,non_intrinsic,flow_cytometry,,40156524,"aptamers (HG1-9, K d = 43.23 ± 4.62 nM and XQ-2d, K d = 42.34 ± 5.15 nM))"
cefquinome,protein,Apt-9,43.3 nM,-7.364,intrinsic,,,40203705,"Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were ... 43.30 nM"
cefapirin,protein,Apt-9,43.68 nM,-7.36,intrinsic,,,40203705,"Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were 43.68 nM"
digoxin,protein,D2,4.4e-08 M,-7.357,intrinsic,,,23021809,"Truncated (without primer binding region) D1, truncated D2 and full length D1 were bound to digoxin-BSA with Kd value of 8.2 × 10 -9 , 44 × 10 -9 and 17.8 × 10 -9 M, respectively"
Total Phthalate Esters (TP),protein,Truncated 24-mer aptamer,44.1 nM,-7.356,intrinsic,,,33524734,that of the truncated 24-mer aptamer was 44.1 nM
M0-like macrophage,protein,A2,44.12 nM,-7.355,non_intrinsic,flow_cytometry,277.15,32589412,"apparent dissociation constants ( K d ) of 44.12 ± 8.0 and 22.81 ± 5.6 nM to M0- and M2-like macrophages, respectively"
HBeAg,protein,EAg0,4.4200000000000005e-08 M,-7.355,intrinsic,affinity_real_time_qPCR,,32250595,A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0
monocyte,protein,A2,45.0 nM,-7.347,non_intrinsic,flow_cytometry,277.15,32589412,aptamer A2 bound CD14 + cells (monocytes) with high speci fi city ( K d ∼ 45 ± 9.1 nM)
Oxytetracycline,protein,OTC5,4.5000000000000006e-08 M,-7.347,intrinsic,,,35777074,"the binding was slightly enhanced when NaCl was decreased (Figure 3B, K d reached 45 nM when no NaCl was present)"
Ara h1,protein,CB-APT1,4.5000000000000006e-08 M,-7.347,avidity_multivalent,MST,298.15,40083221,"Notably, a similar binding affinity was observed even in a complex matrix that contained 80% w/w total peanut proteins ( K d = 45.0 nM, Figures 3 and S5)."
α-thrombin,protein,TBA-iT12,46.8 nM,-7.33,non_intrinsic,SPR,298.15,30735210,TBA-iT12 | 46.8
Zearalenone,protein,A2,47.1 nM,-7.327,intrinsic,,,38608399,The GO method showed that the Kd value for A2 was 47.1 nM
Human thrombin,protein,M08s,47.2 nM,-7.326,intrinsic,SPR,,37621412,M08s | 7.04 10^5 | 3.33 10^-2 | 47.2
ASPH,protein,AP-Cell 1,4.751e-08 M,-7.323,apparent_cellular,flow_cytometry,,36959438,"three proper oligomers, AP-Cell 1, AP-Cell 2, and AP-Cell 3 with reasonable dissociation constants ( K d ) of 47.51, 39.38, and 65.23 nM, respectively, were achieved."
sCD80,protein,CD80-16,47.69 nM,-7.322,intrinsic,,,37816286,"CD80-4 and CD80-16 aptamers showed the lowest K d values of 200.5 nM and 47.69 nM, respectively"
ODAM,protein,OD64,4.771e-08 M,-7.321,intrinsic,SPR,,33455205,"the obtained OD64 and OD35 (aptamer cognate pair) presented high a ffi nity and excellent speci fi city, along with dissociation constants ( K d ) of 47.71 nM (OD64)"
tobramycin,protein,Ap 3,47.79 nM,-7.321,intrinsic,,,30268963,"The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively"
ODAM,protein,OD64,47.71 nM,-7.321,intrinsic,,,30396019,"From this dose-dependency curves, the Kd values of OD64 and OD35, estimated by adopting non-linear regression analysis, were 47.71 nM and 51.36 nM, for OD64 and OD35, respectively."
Mycobacterium tuberculosis H37Rv,protein,NK1,48.0 nM,-7.319,non_intrinsic,flow_cytometry,,21643749,| NK1     | 48 ± 13 |
CD71,protein,ATL,48.17 nM,-7.317,non_intrinsic,flow_cytometry,277.15,41412185,K(pH 6.5) = 48.17 ± 2.70 nM
Immunoglobulin E,protein,IgE37-T10-FAM (no MgCl2),49.0 nM,-7.31,intrinsic,,,32498825,"Without MgCl2 in the binding buffer, the K d of IgE37-T10-FAM increased to 49 nM"
SEC1,protein,C36.2,49.43 nM,-7.306,intrinsic,,,25053102,"The Kd values are 49.43 ± 11.76, 65.14 ± 11.64 and 154.9 ± 45.67 nM, respectively."
lysozyme,protein,lysozyme-binding aptamer,49.5 nM,-7.305,intrinsic,,,21616496,average ligand-site dissociation constant ( k d ) of 49.5 nM ± 8.3 nM
murine OX40,protein,11.8,50.0 nM,-7.301,intrinsic,filter_binding,,18635004,11.8 | AUACCAGCGAAUAACUCGCUGAGGAACCCGACUCACAAA | 50 | 1
human immunoglobulin E,protein,AptIgE-3'-TMR,50.0 nM,-7.301,non_intrinsic,CE-LIF,298.15,28763192,The apparent K d of AptIgE-3 ′ -TMR was about 50 nM
CD20,protein,WB1/1.CD20.1_2S,50.0 nM,-7.301,non_intrinsic,flow_cytometry,310.15,41079126,WB1/1.CD20.1_2S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 2.64 | 53 ± 40 | 50 ± 2.3
CD19,protein,WB15.CD19,50.0 nM,-7.301,non_intrinsic,flow_cytometry,310.15,41079126,WB15.CD19 | 5'-AGAGACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGTGGCTTCTT-3' | - | N.P. | 50 ± 9.1
HAP 1b,protein,Aptamer 21,5.0000000000000004e-08 M,-7.301,intrinsic,,,21899290,A high-affinity RNA aptamer (K d  = 50 nM) was efficiently identified by SELEX against a heteroaryl dihydropyrimidine structure
Ochratoxin A,protein,OBA36,5.0000000000000004e-08 M,-7.301,intrinsic,,,35442665,OBA36 binds OTA with a dissociation constant ( K d) down to ∼ 50 nM
human prothrombin,protein,thrombin aptamer,50.0 nM,-7.301,intrinsic,,,21700444,the thrombin aptamer does bind prothrombin but with a lower KD (50 nM versus 2 nM for thrombin)
17 β -estradiol,protein,E2 aptamer,50.0 nM,-7.301,intrinsic,,,24594593,Kd was determined to be 50 nM.
HSV-1 gD,protein,DApt,50.0 nM,-7.301,intrinsic,,,29246315,Our 45-nt-long DNA aptamer showed high af fi nity for HSV-1 gD (binding af fi nity constant [Kd] = 50 nM)
enrofloxacin,protein,Apt6,50.77 nM,-7.294,intrinsic,,,29574118,"The obtained Kd of Apt58 and Apt6, with non-linear regression analysis, were 14.19 nM and 50.77 nM, respectively."
thrombin,protein,12Ala,51.0 nM,-7.292,intrinsic,MST,,33614235,12Ala | 51.7 | 51.0 ± 3.8 | 2.74
kanamycin,protein,KAN8-1,5.1e-08 M,-7.292,intrinsic,,,41914599,"Its top sequence, named KAN8 -1, shows a K d of 51 nM at pH 7.5 for kanamycin as measured by isothermal titration calorimetry"
adenosine monophosphate,protein,AMP aptamer,51.0 nM,-7.292,intrinsic,,,35934372,KD of BHQ-2-(NH2)2-AMP aptamer complex was 51 nM
methionyl-tRNA synthetase,protein,42mer pool,51.3 nM,-7.29,intrinsic,,,23399565,"The dissociation constants of the selected 70 and 42mer pools to M. tuberculosis MRS were 38.8 and 51.3 nM, respectively."
Zearalenone,protein,M2,51.31 nM,-7.29,intrinsic,,,38608399,"However, the fluorescence-measured Kd value was 51.31 nM"
ODAM,protein,OD35,5.1360000000000005e-08 M,-7.289,intrinsic,SPR,,33455205,"the obtained OD64 and OD35 (aptamer cognate pair) presented high a ffi nity and excellent speci fi city, along with dissociation constants ( K d ) of 47.71 nM (OD64) and 51.36 nM (OD35)."
ODAM,protein,OD35,51.36 nM,-7.289,intrinsic,,,30396019,"From this dose-dependency curves, the Kd values of OD64 and OD35, estimated by adopting non-linear regression analysis, were 47.71 nM and 51.36 nM, for OD64 and OD35, respectively."
human α-Thrombin,protein,A1,52.0 nM,-7.284,intrinsic,,,31129134,Also for aptamer A1 we measured with MST KD values in the pico- and nanomolar range (2 pM and 52 nM).
tobramycin,protein,Ap 1,52.37 nM,-7.281,intrinsic,,,30268963,"Compared with Ap 1 (Kd =52.37nM), the a ffi nity of the aptamer maintains and slightly increases with the removing of the redundant sequence."
CD20,protein,WB1/1.CD20.1_2S,53.0 nM,-7.276,non_intrinsic,flow_cytometry,277.15,41079126,WB1/1.CD20.1_2S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 2.64 | 53 ± 40 | 50 ± 2.3
BHQ-2-(NH(NH)NH2)2,protein,AMP aptamer,53.0 nM,-7.276,intrinsic,,,35934372,Incubation of the aptamer with AMP decreased KD down to 53 nM
CD8,protein,CD8AP17s-Stemloop2,53.04 nM,-7.275,non_intrinsic,flow_cytometry,277.15,23791505,Kd=53.04 nM
Aβ42 oligomer,protein,Aβ-Apt,5.33e-08 M,-7.273,intrinsic,SPR,298.15,35019631,suggesting that the binding a ffi nity of A β -Apt with A β 42 oligomer ( K d = 53.3 nM) was stronger than that of A β -Apt with A β 42 monomer.
Ochratoxin A,protein,OBA33,5.4e-08 M,-7.268,intrinsic,,,35442665,The binding a ffi nity of OBA33 is 54 nM for OTA
HSV-1 gD,protein,DApt,53.92 nM,-7.268,intrinsic,,,29246315,a nonlinear regression analysis of the determined values was plotted to give a speci fi c Kd of 53.92 nM (Figure 1C).
Thyroid-Stimulating Hormone Receptor (TSHR),protein,TSHRly-1c,54.37 nM,-7.265,non_intrinsic,flow_cytometry,,40588369,"As shown in Figure 4E, the apparent equilibrium dissociation constant ( K d) of TSHRly-1c was determined to be 54.37 ± 8.22 nM."
tobramycin,protein,Ap 2,54.58 nM,-7.263,intrinsic,,,30268963,"The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively"
Mycobacterium tuberculosis H37Rv,protein,NK20,55.0 nM,-7.26,non_intrinsic,flow_cytometry,,21643749,| NK20    | 55 ± 16 |
CD19,protein,WB17/17.CD19.1_1S,56.0 nM,-7.252,non_intrinsic,flow_cytometry,310.15,41079126,WB17/17.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 530 ± 1278 | 56 ± 49
Surface Antigen 1,protein,SOK11,56.66 nM,-7.247,intrinsic,,,40288708,"SOK11 (56.66 nM, R 2 = 0.8128)"
ofloxacin,protein,Q1,56.9 nM,-7.245,intrinsic,,,26547431,Aptamer Q1 was found to have an af fi nity constant of K D 1⁄4 56.9 nM ( 7 11.3)
α-thrombin,protein,TBA-iT3,57.3 nM,-7.242,non_intrinsic,SPR,298.15,30735210,TBA-iT3 | 57.3
Salmonella typhimurium,protein,NTri-monoApt,5.7320000000000006e-08 M,-7.242,apparent_cellular,ELISA,310.15,37893744,"the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively"
PTK7,protein,Sgc8c-Si6,5.7230000000000004e-08 M,-7.242,apparent_cellular,flow_cytometry,277.15,40415219,Sgc8c-Si6 maintained strong binding affinity ( K d = 57.23 nM)
CD63,protein,CD63 Aptamer,5.8e-08 M,-7.237,intrinsic,SPR,,26500145,The equilibrium constant of the aptamer immobilized via 3 0 end was found to be KD = 5.8 -10  8 M.
t-Bu Hoechst dye,protein,Aptamer II,58.2 nM,-7.235,intrinsic,,,38613867,The Aptamer II sequence has a fluorescence-determined KD of 58.2 nM (Table 2)
CD20,protein,WB1.CD20.1,59.0 nM,-7.229,non_intrinsic,flow_cytometry,310.15,41079126,WB1.CD20.1 | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | - | N.P. | 59 ± 19
Rat beta-crosslaps,protein,BC2,59.0 nM,-7.229,intrinsic,,,33379043,"The BC1 and BC2 aptamers show high affinity in the nanomolar range, 69 and 59 nM, respectively"
Rat osteocalcin,protein,OC2,59.0 nM,-7.229,intrinsic,,,33379043,The high-affinity aptamers of OC and BC showed the Kd values of 59 and 55 nM respectively.
melamine,protein,Mel36-1,6.000000000000001e-08 M,-7.222,intrinsic,,,42261635,The highest affinity aptamers exhibited a dissociation constant ( K d) of ∼ 60 nM
adenosine monophosphate,protein,AMP aptamer,60.0 nM,-7.222,intrinsic,,,35934372,KD in saturated AMP concentration (500 μ M) was 60 nM
prothrombin,protein,ARC-183,60.7 nM,-7.217,intrinsic,SPR,298.15,22385910,"Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM and ARC-183 = 60.7 nM)"
prothrombin,protein,HD1-22,6.1e-08 M,-7.215,intrinsic,SPR,,18826387,HD1-22 | Prothrombin | K D ( M) | 6.1 · 10 ) 8
Tau,protein,Apt,62.5 nM,-7.204,intrinsic,SPR,298.15,41034513,Surface plasmon resonance (SPR) assay revealed that Apt could specifically bind to Tau proteins with high affinity (dissociation constant = 62.5 ± 1.1 nM)
Pb2+,protein,TBA-4PI[T3],6.300000000000001e-08 M,-7.201,intrinsic,,298.15,34543022,a titration of Pb(NO3)2 to 1 μ M TBA-4PI[T3] provided an apparent dissociate constant ( K d) of 63 nM
Aβ42 monomer,protein,Aβ-Apt,6.34e-08 M,-7.198,intrinsic,SPR,298.15,35019631,It was evaluated that A β -Apt showed the ability to bind A β 42 with a K d of 63.4 nM.
SipA,protein,Apt17,63.4 nM,-7.198,intrinsic,,,31953175,"Apt17 displayed Kd values of 114.9 and 63.4 nM at 27 °C and 37 °C, respectively"
Staphylococcal enterotoxin B,protein,A11,64.0 nM,-7.194,intrinsic,,,25624325,"A2 and A11 both bound with high affinity to SEB, with dissociation constants of 26 nM and 64 nM, respectively"
paramylon,protein,Par-18,6.406e-08 M,-7.193,intrinsic,fluorescence,,31809034,"The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 ± 2.61, 34.90 ± 5.83, 64.06 ± 6.72, 123.81 ± 13.41, and 249.52 ± 46.39 nM, respectively."
CD20,protein,WB1/1.CD20.1_4S,65.0 nM,-7.187,non_intrinsic,flow_cytometry,310.15,41079126,WB1/1.CD20.1_4S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 5.28 | 25 ± 12 | 65 ± 38
ASPH,protein,AP-Cell 3,6.523000000000001e-08 M,-7.186,apparent_cellular,flow_cytometry,,36959438,"three proper oligomers, AP-Cell 1, AP-Cell 2, and AP-Cell 3 with reasonable dissociation constants ( K d ) of 47.51, 39.38, and 65.23 nM, respectively, were achieved."
Total Phthalate Esters (TP),protein,Parental 39-mer aptamer,65.7 nM,-7.182,intrinsic,,,33524734,Compared with the Kd (TP) of 65.7 nM for the parental 39-mer aptamer
prothrombin,protein,HD1-22,6.7e-08 M,-7.174,non_intrinsic,SPR,,18826387,HD1-22 | Prothrombin+ phospholipids | K D ( M) | 6.7 · 10 ) 8
thrombin,protein,12Trp,67.3 nM,-7.172,intrinsic,MST,,33614235,12Trp | 54.7 | 67.3 ± 12.1 | 3.12
SARS-CoV-2 spike trimer,protein,S1,68.9 nM,-7.162,intrinsic,,,34188971,The aptamer S14 evinced 3-fold higher affinity (KD = 21.8 nM) then S1 (KD = 68.9 nM).
Rat beta-crosslaps,protein,BC1,69.0 nM,-7.161,intrinsic,,,33379043,"The BC1 and BC2 aptamers show high affinity in the nanomolar range, 69 and 59 nM, respectively"
chlorpromazine,protein,CHL-3,69.8 nM,-7.156,intrinsic,,,36049339,The Kd value of CHL-3 is 69.8 nM.
RA-FLSs,protein,SAPT8,71.2 nM,-7.148,non_intrinsic,flow_cytometry,310.15,39237134,"The equilibrium dissociation constants (Kd) of SAPT4 and SAPT8 with RA-FLSs were 101.7 ± 29.6 and 71.2 ± 15.0 nM, respectively ( fi gure 1H)."
thrombin,protein,12Leu,72.2 nM,-7.141,intrinsic,MST,,33614235,12Leu | 53.6 | 72.2 ± 0.9 | 4.14
Nampt,protein,no. 19,72.52 nM,-7.14,intrinsic,,,22704839,dissociation constant ( Kd ) was calculated to be 72.52 nM for the no. 19 aptamer
SCAF4,protein,PTf-SRiApt,0.073 µM,-7.137,intrinsic,fluorescence,,40574704,0.073 ± 0.003 µ m for PTf -SRiApt
CD20,protein,WB1-CD20,73.0 nM,-7.137,non_intrinsic,flow_cytometry,298.15,35829681,"The apparent affinities of WB1-CD20 and WB2-CD20 were calculated as 73 nM and 163 nM at 25°C, respectively"
Fok I,protein,F6#71,74.0 nM,-7.131,intrinsic,,,27899266,"dissociation constants of F6#8 and #71 were 82 nM and 74 nM, respectively"
HFIXa,protein,Seq 5,74.07 nM,-7.13,intrinsic,ITC,298.15,38776649,Seq 5- | 7.4 | 0.921 | 13.5 | 74.07 | 209.1 | 565 | 40.43
alkaline phosphatase,protein,ALP binding aptamer,7.49e-08 M,-7.126,intrinsic,PISA,,30827094,"From the response -dose curve (Figure 3A), the dissociation constant ( K d ) for aptamermodi fi ed array was estimated by the logistic function fi tting to be 7.49 × 10 -8 M"
neomycin-B,protein,NEO7A,75.0 nM,-7.125,intrinsic,,,23535583,NEO7A bound neomycin-B with a Kd of 75 nM in buffer A
gonyautoxin 1/4,protein,GO18-T-d,75.63 nM,-7.121,intrinsic,,,33294137,"Corresponding Kd values of GO18-T-d and tGO18-T-d, determined by the average of 8 independent measurements, were 75.63 nM and 3.60 nM, respectively."
Co2+,protein,Co-1,7.6e-08 M,-7.119,intrinsic,,,40656531,The corresponding true K d values were ... 76 nM for Co 2+
PAUF,protein,P12FR2,77.0 nM,-7.114,intrinsic,,,21963224,the equilibrium dissociation constant calculated from the relation of KD = kd / ka was 77 nM
prothrombin,protein,HD1,7.8e-08 M,-7.108,intrinsic,SPR,,18826387,HD1 | Prothrombin | K D ( M) | 7.8 · 10 ) 8
hemagglutinin (HA) protein of H1N1 influenza virus (A/Puerto Rico/8/1934),protein,aptamer 1,78.0 nM,-7.108,intrinsic,fluorescence,310.15,26904922,"As it showed a higher binding affinity for HA protein (Kd = 78 -1nM), aptamer 1 was tested"
kanamycin,protein,Ky2,78.8 nM,-7.103,intrinsic,,,21530479,The dissociation constants ( K d [kanamycin] = 78.8 nM
kanamycin,protein,Ky2,78.8 nM,-7.103,intrinsic,,,28259207,The dissociation constants (Kd [kanamycin] = 78.8 nM
Plasmodium falciparum glutamate dehydrogenase,protein,NG3,79.0 nM,-7.102,intrinsic,,,29909195,A thiolated ssDNA aptamer (NG3) that binds speci fi cally to Pf GDH antigen with high a ffi nity (K d= 79 nM) was used to develop the aptasensor.
BCMA,protein,apt69.T,79.4 nM,-7.1,non_intrinsic,qRT-PCR,310.15,31778956,with an apparent dissociation constant (KD = 79.4 nM) (Figure 2C)
lysozyme,protein,lysozyme-binding aptamer,80.0 nM,-7.097,intrinsic,,,21616496,average dissociation constant ( k d ) was 80.0nM ± 14nM
MUP13,protein,Apt-1.4,80.0 nM,-7.097,intrinsic,,,35026634,The equilibrium dissociation constants ( KD ) were 180 ± 80 nM for Apt-2.5 and 80 ± 44 nM for Apt-1.4.
CD19,protein,WB17.CD19.1,81.0 nM,-7.092,non_intrinsic,flow_cytometry,310.15,41079126,WB17.CD19.1 | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | - | N.P. | 81 ± 16
patulin,protein,PAT C3,8.2e-08 M,-7.086,intrinsic,SPR,,35546052,"PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 × 10 -8 and 1.9 × 10 -7 M, respectively"
Oxytetracycline,protein,OTC5,8.2e-08 M,-7.086,intrinsic,,,35777074,"In a buffer containing 300 mM NaCl and 10 mM MgCl2, the fitted K d value was 82 nM (Figure 3B, black trace)"
Fok I,protein,F6#8,82.0 nM,-7.086,intrinsic,,,27899266,"dissociation constants of F6#8 and #71 were 82 nM and 74 nM, respectively"
CD20,protein,WB1/1.CD20.1_1S,83.0 nM,-7.081,non_intrinsic,flow_cytometry,277.15,41079126,WB1/1.CD20.1_1S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 1.32 | 83 ± 58 | inconclusive
Neuron specific enolase,protein,NSE-Apt5-5BioTEG,83.0 nM,-7.081,intrinsic,,,35495513,"Through kinetic analysis, the binding rate constant and dissociation rate constant were determined to be 1.21 -10 4 Ms 1 and 1.004 -10 3 s 1 , respectively... Though this SPR analysis, the dissociation constant ( K d) was determined to be about 83 nM"
Staphylococcal enterotoxin B,protein,PEGA11,83.5 nM,-7.078,intrinsic,,,25624325,PEGA11 had a dissociation constant of 83.5 nM in selection buffer
kanamycin B,protein,Ky2,84.5 nM,-7.073,intrinsic,,,21530479,K d [kanamycin B] = 84.5 nM
kanamycin B,protein,Ky2,84.5 nM,-7.073,intrinsic,,,28259207,Kd [kanamycin B] = 84.5 nM
kanamycin,protein,Kana2,85.6 nM,-7.068,intrinsic,,,21530479,"The K d values of Kana2 and Ky2 as determined by fluorescence measurement were 85.6 and 78.8 nM, respectively"
thrombin,protein,12Ser,86.6 nM,-7.062,intrinsic,MST,,33614235,12Ser | 52.0 | 86.6 ± 4.5 | 2.34
CD20,protein,WB1.CD20,87.0 nM,-7.06,non_intrinsic,flow_cytometry,310.15,41079126,WB1.CD20 | 5'-AGAGACCCTGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTTGCTTCTTGGACACGGTGGCTTCTT-3' | - | N.P. | 87 ± 24
Zearalenone,protein,Z100,87.22 nM,-7.059,intrinsic,,,38608399,"Moreover, the Kd value of Z100 measured by the GO method was found to be 87.22 nM"
thrombin,protein,APTA,88.0 nM,-7.056,intrinsic,QCM,,16725379,APTA | 0.97±0.45 | 86±73 | 0.011±0.006 | 88±52
fibrinogen,protein,FA,89.6 nM,-7.048,intrinsic,microscale thermophoresis,,33395250,The K d calculated for the fi brinogen target was 89.6 nM
HspX,protein,H63 SL-2 M6,9e-08 M,-7.046,intrinsic,,,30205966,H63 SL-2 M6 displayed a speci fi c and high a ffi nity interaction with HspX (Kd ∼ 9.0 × 10 -8 M).
Zearalenone,protein,A1,90.25 nM,-7.045,intrinsic,,,38608399,The Kd value was 90.25 nM as determined by the GO method
Immunoglobulin E,protein,IgE37-T10-FAM (5-bp truncated),90.5 nM,-7.043,intrinsic,,,32498825,"When 4-base pairs and 5-base pairs were truncated from the stem, the K ds of the aptamers increased to 11.4 nM and 90.5 nM, respectively."
N-acetylneuraminic acid,protein,Neu5Ac aptamer,91.0 nM,-7.041,intrinsic,ITC,310.15,37217750,"To validate ARPLA, we first determined the binding affinity ( K d ) of the Neu5Ac aptamer by isothermal titration calorimetry (ITC) as 91 nM (Extended Data Fig. 2a,b)"
mouse IL-2,protein,M20,91.0 nM,-7.041,intrinsic,,,35756119,"The results indicated that the af fi nity of the M20 aptamer was greater than the M15, and its predicted Kd was 91 nM"
Okadaic Acid,protein,OA-LC2,91.13 nM,-7.04,intrinsic,BLI,,36322695,OA-LC2 exhibited K d of 91.13 ± 4.64 nM
rmCD3 d ε -Fc,protein,CD3_Apt1,91.3 nM,-7.04,intrinsic,SPR,298.15,38745854,aptamer 1 (91.3 nM)
6'-sialyllactose,protein,Apt9-1,9.175000000000001e-08 M,-7.037,intrinsic,fluorescence,298.15,36700646,A 35 nt truncated aptamer Apt9-1 ( K d = 91.75 nM) with higher affinity than Apt9 was finally obtained.
BHQ-2-(NH(NH)NH2)2,protein,AMP aptamer,92.0 nM,-7.036,intrinsic,,,35934372,BHQ-2-(NH(NH)NH2)2 had lower affinity to the aptamer in the low salt buffer. KD was 92 nM
17 β -estradiol,protein,HEV1,9.276e-08 M,-7.033,intrinsic,MST,,38276613,the dissociation constant (KD value) is 92.76 ± 66.02 nM as calculated by the calculation function that comes with the system.
Mycobacterium tuberculosis H37Rv,protein,NK10,95.0 nM,-7.022,non_intrinsic,flow_cytometry,,21643749,| NK10    | 95 ± 28 |
Gymnodimine-A,protein,G48nop,95.3 nM,-7.021,intrinsic,,,35324692,The resulting K D value of G48nop (95.30 nM) was about one third of that of G48 (288 nM)
EpCAM,protein,SYL3C,9.700000000000001e-08 M,-7.013,apparent_cellular,,,36856721,SYL3C can bind to SW480 cells (EpCAM+) with a K d of 97 nM
thrombin,protein,TBA15,97.0 nM,-7.013,intrinsic,,,23850569,A K D value of 97 nM  1 nM was determined for the TBA/Thr complex in the MST assay
Oxytetracycline,protein,OTC5,9.8e-08 M,-7.009,intrinsic,,,35777074,we fitted the peak fluorescence to obtain a K d of 98 nM (Figure 4B)
neomycin,protein,NAN-NEO,98.101 nM,-7.008,intrinsic,,,22321384,"Using the LineweaverBurk equation (Equation 1), we calculated the dissociation constant (Kd) to be 98.101 nM (Figure 5, B )."
thrombin,protein,12Phe,99.1 nM,-7.004,intrinsic,MST,,33614235,12Phe | 54.3 | 99.1 ± 6.3 | 4.07
BSA,glycan/conjugate,Clone 5,1e-07 M,-7.0,intrinsic,SPR,,11178986,BSA | 2.2 3 10 4 | 2.3 3 10 2 3 | 9.9 3 10 6 | 1.0 3 10 2 7
human α-thrombin,protein,Apt15,100.0 nM,-7.0,non_intrinsic,,,28763192,"One 15-mer DNA aptamer (5 ′ -GGT TGG TGT GGT TGG-3 ′ , denoted as Apt15 here) binds to the fi brinogen-binding site of human α -thrombin with a K d around 100 nM."
D-TAR RNA,protein,L-6-4t,1.0000000000000001e-07 M,-7.0,intrinsic,,,23977945,the K d  of the L-aptamer for D-TAR RNA is 100 nM
Bisphenol A,protein,BPA-specific aptamer,1.0000000000000001e-07 M,-7.0,intrinsic,,,25329684,the K d value for free BPA binding to the BPA aptamer was determined experimentally using MST to be ∼ 100 nM
Thrombin,protein,TBA15,1e-07 M,-7.0,intrinsic,,,26643617,K d of free TBA15 (~1 × 10 -7 M)
human β-defensin 2,protein,U gu1,100.0 nM,-7.0,intrinsic,,,32067984,"Besides, clone U gu1 bound somewhat poorly to HBD-2 ( K d = 100 nM, Fig. S2)."
RA-FLSs,protein,SAPT4,101.7 nM,-6.993,non_intrinsic,flow_cytometry,310.15,39237134,"The equilibrium dissociation constants (Kd) of SAPT4 and SAPT8 with RA-FLSs were 101.7 ± 29.6 and 71.2 ± 15.0 nM, respectively ( fi gure 1H)."
CD9,protein,CD9-26,101.96 nM,-6.992,intrinsic,fluorescence,277.15,37585601,CD9-26 | 5 ′ -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG TGC GCA CTA GAG CAG GTA CGG TGT CA-3 ′ | - 8.92
human α-Thrombin,protein,A3,101.9 nM,-6.992,intrinsic,,,31129134,and as poorest binder aptamer A3 (101.9 nM).
tobramycin,protein,Ky2,103.0 nM,-6.987,intrinsic,,,21530479,and K d [tobramycin] = 103 nM)
tobramycin,protein,Ky2,103.0 nM,-6.987,intrinsic,,,28259207,and Kd [tobramycin] = 103nM
Okadaic Acid,protein,OA-SL2,103.4 nM,-6.985,intrinsic,BLI,,36322695,"from OA-SL1 to OASL2, K d was lowered from 340.5 ± 14.5 to 103.4 ± 7.0 nM"
aflatoxin B2,protein,A50-T26-TMR,105.0 nM,-6.979,intrinsic,,,30086944,the K d for AFB2 was determined to be 105 nM in our study.
Mycobacterium tuberculosis H37Rv,protein,NK8,107.0 nM,-6.971,non_intrinsic,flow_cytometry,,21643749,| NK8      | 107 ± 44 |
luteolin,protein,LUT#28,107.0 nM,-6.971,intrinsic,,,29524380,"The value of Kd for LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively."
luteolin,protein,LUT#3,109.0 nM,-6.963,intrinsic,,,29524380,"The value of Kd for LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively."
domoic acid,protein,C1-d,1.09e-07 M,-6.963,intrinsic,,,36421085,"Biolayer interferometry assay illustrated that C1-d possessed a K on (1/Ms) value of 2.94 × 10 5 , a K dis (1/s) value of 5.13 × 10 -2 , and a K D (M) value of 1.09 × 10 -7  M in the interaction with DA."
thrombin,protein,HD1,110.0 nM,-6.959,intrinsic,filter_binding,,41053535,HD1 binds both thrombin (K D = 110 nm)
BHQ-2-(NH2)2,protein,off-target DNA hairpin,110.0 nM,-6.959,intrinsic,,,35934372,"KD of the complex between BHQ-2-(NH2)2 and off-target DNA hairpin ... was twice higher, 110 nM"
PA toxin,protein,Apt11,1.1200000000000001e-07 M,-6.951,intrinsic,,,20136122,The aptamer was developed in-house by capillary electrophoresis systematic evolution of ligands by exponential enrichment (CE-SELEX) and had a dissociation constant (K d ) of 112 nM.
polysialic acid,protein,Apt3,114.0 nM,-6.943,intrinsic,,,35151974,"The K d value of candidate Apt3 is the lowest among all the tested candidate aptamer sequences, which is 114.0 nM"
trisialic acid,protein,Apt3,114.0 nM,-6.943,intrinsic,,,40545079,aptamer Apt3 ( K d = 114.0 nM)
CD19,protein,WB15.CD19.1,117.0 nM,-6.932,non_intrinsic,flow_cytometry,310.15,41079126,WB15.CD19.1 | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | - | N.P. | 117 ± 28
human α-Thrombin,protein,A3,117.8 nM,-6.929,intrinsic,,,31129134,and the poorest binder is A3 (117.8 nM).
Moraxella osloensis,protein,MO9,1.1890000000000001e-07 M,-6.925,apparent_cellular,fluorescence,,41784024,high-a ffi nity aptamer (K d = 118.9 nM)
SCAF4,protein,PT1/2-SRiApt,0.121 µM,-6.917,intrinsic,fluorescence,,40574704,0.121 ± 0.054 µ m for PT1/2 -SRiApt
SIRT2,protein,Apt 45,1.233e-07 M,-6.909,intrinsic,fluorescence,310.15,40200675,selected Apt 45 ( K d = 123.3 nM) to fabricate the 'turn-on' fluorescent biosensor
CD19,protein,WB15/15.CD19.1_1S,125.0 nM,-6.903,non_intrinsic,flow_cytometry,277.15,41079126,WB15/15.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 125 ± 68 | 11 ± 6.1
Netilmicin,protein,APT-21,126.0 nM,-6.9,intrinsic,,,35752088,"Intriguingly, the Kd value in the experiment (Fig. 4B) is 126.0 nM"
thrombin,protein,A4,127.0 nM,-6.896,intrinsic,,,23850569,The K D value determined for A4 (127 nM  1.4 nM) was very close to that of TBA15
human α-Thrombin,protein,A1,129.8 nM,-6.887,intrinsic,,,31129134,for iRIf aptamer A2 is the best (26.4 nM) and aptamer A1 the poorest (129.8 nM)
sLe X -BSA,glycan/conjugate,Original pool,1.3e-07 M,-6.886,intrinsic,SPR,,11178986,Original pool | 2.6 3 10 4 | 3.3 3 10 2 3 | 7.6 3 10 6 | 1.3 3 10 2 7
H-Thr,protein,Seq-1,136.0 nM,-6.866,intrinsic,,,31103164,The good af fi nity of Seq-1 (Fig. S2) with 136 nM and Apt-29 with 199 nM were obtained
saxitoxin,protein,75a,136.0 nM,-6.866,intrinsic,,,35324725,aptamer 75a with a K d value of 136 nM
CD25,protein,Apt70,138.6 nM,-6.858,intrinsic,,,29055191,"Using non-linear regression analysis, the Kd of Apt51 and Apt70 aptamers were found to be 13.4 nM and 138.6 nM, respectively"
guanine,protein,R10G2,1.4e-07 M,-6.854,intrinsic,,,38194356,"In our R10G2 aptamer, a K d of 140 nM guanine was achieved"
SW480 cells,cell/EV,SYL3C,142.5 nM,-6.846,non_intrinsic,,,32049531,"monovalent SYL3C aptamer ( K d = 142.50 ± 20.55 nM, Figure 2A)"
Oxytetracycline,protein,OTC5,1.47e-07 M,-6.833,intrinsic,,298.15,35777074,a representative sequence named OTC5 had a dissociation constant of 147 nM measured by isothermal titration calorimetry.
AP65,protein,AP65_A1,1.48e-07 M,-6.83,intrinsic,,,29972299,The resulting K D was 148 nM
6'-sialyllactose,protein,Apt9,1.5230000000000003e-07 M,-6.817,intrinsic,fluorescence,298.15,36700646,The ssDNA aptamer Apt9 ( K d = 152.3 nM) with a length of 79 nucleotides (nt) was demonstrated as the optimal aptamer candidate
Surface Antigen 1,protein,SOK10,152.9 nM,-6.816,intrinsic,,,40288708,"SOK10 (152.9 nM, R 2 = 0.7217)"
CD19,protein,WB15-CD19,153.0 nM,-6.815,non_intrinsic,flow_cytometry,298.15,35829681,"At 25 °C, WB15-CD19 showed an apparent affinity of 153 nM"
progastrin-releasing peptide (31-98),protein,ProGRP-48-5BioTEG,153.0 nM,-6.815,intrinsic,,,35495513,The dissociation constant ( K d) of ProGRP31-98 to aptamer was calculated to be 153 nM
D-TAR RNA,protein,L-6-4t,1.6e-07 M,-6.796,intrinsic,,,23977945,The L-6-4t aptamer has somewhat reduced affinity for D-TAR RNA under the low-salt conditions (K d  = 160 nM)
Hen egg white lysozyme,protein,DNA analog a2,161.0 nM,-6.793,intrinsic,,,21167858,"The aptamerlysozyme equilibrium dissociation constant of 161 ± 16nM agrees reasonably well with the Kd from fluorescence anisotropy (467 ± 140nM). The overall free energy and enthalpy changes are -9.32 ± 0.06kcal/mol and 2.2 ± 1.0 kcal/mol, respectively."
CD20,protein,WB2-CD20,163.0 nM,-6.788,non_intrinsic,flow_cytometry,298.15,35829681,"The apparent affinities of WB1-CD20 and WB2-CD20 were calculated as 73 nM and 163 nM at 25°C, respectively"
thrombin,protein,3NB,163.5 nM,-6.786,intrinsic,MST,,33614235,3NB | 51.7 | 163.5 ± 3.5 | 3.82
Phosphatidylserine,protein,PS-LC3-TF,166.2 nM,-6.779,intrinsic,BLI,,36322695,The terminal-fixed PS-LC3-TF exhibited an even lower K d at 166.2 ± 10.7 nM
xanthylacrylamide,protein,XAA-1,1.6800000000000002e-07 M,-6.775,intrinsic,,,40261307,an apparent K d value of 168 nM was obtained
CD19,protein,WB15/17.CD19.1_2S,173.0 nM,-6.762,non_intrinsic,flow_cytometry,277.15,41079126,WB15/17.CD19.1_2S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 2.64 | 173 ± 82 | inconclusive
Tramadol hydrochloride,protein,Apt39,178.4 nM,-6.749,intrinsic,,,33965888,the Kd of Apt39 was measured to be 178.4 nM
CD19,protein,WB15/17.CD19.1_1S,183.0 nM,-6.738,non_intrinsic,flow_cytometry,277.15,41079126,WB15/17.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 183 ± 140 | inconclusive
CD19,protein,WB17-CD19,187.0 nM,-6.728,non_intrinsic,flow_cytometry,298.15,35829681,and WB17-CD19 showed an apparent affinity of 187 nM (Figure S12A-B).
patulin,protein,PAT C4,1.9e-07 M,-6.721,intrinsic,SPR,,35546052,"PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 × 10 -8 and 1.9 × 10 -7 M, respectively"
Sc3+,protein,Sc-1,1.9200000000000003e-07 M,-6.717,intrinsic,,,39743479,obtained an apparent K d value of 192 nM
Netilmicin,protein,APT-21,194.1 nM,-6.712,intrinsic,,,35752088,APT-21 bound to NET with high affinity (Kd = 194.1 nM)
CD20,protein,WB1.CD20.2,196.0 nM,-6.708,non_intrinsic,flow_cytometry,310.15,41079126,WB1.CD20.2 | 5'-TGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACAC-3' | - | N.P. | 196 ± 117
streptomycin,protein,STR1,199.1 nM,-6.701,intrinsic,,,23601877,"the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively."
H-Thr,protein,Apt-29,199.0 nM,-6.701,intrinsic,,,31103164,The good af fi nity of Seq-1 (Fig. S2) with 136 nM and Apt-29 with 199 nM were obtained
malachite green,protein,MGA,200.0 nM,-6.699,intrinsic,,,27591602,"Based on the fl uorescence enhancement of MG, the initial dissociation constant ( K d) is determined to be 200 nM as seen in Figs. 2A and B"
sCD80,protein,CD80-4,200.5 nM,-6.698,intrinsic,,,37816286,"CD80-4 and CD80-16 aptamers showed the lowest K d values of 200.5 nM and 47.69 nM, respectively"
bilirubin,protein,Brb7,2.03e-07 M,-6.693,intrinsic,,,40669049,The tightest binding bilirubin aptamer has a K d value of 203 nM based on ITC
rmCD3 d ε -Fc,protein,CD3_Apt12,206.0 nM,-6.686,intrinsic,SPR,298.15,38745854,aptamer 12 (206 nM)
AP65,protein,AP65_A1,2.09e-07 M,-6.68,intrinsic,,,29972299,K D of 209 nM was obtained
saxitoxin,protein,STX-R-75,209.4 nM,-6.679,intrinsic,,,35324725,"STX-R-75 ( K d: 209.4 nM, Table S1)"
di-2-ethylhexyl phthalate,protein,PT01 aptamer,213.0 nM,-6.672,intrinsic,,,30189334,"The dissociation constant, Kd, of the PT01 aptamer was calculated as 213.0 nM using Eq. (1)."
CD8,protein,CD8AP17s-Stemloop1,217.0 nM,-6.664,non_intrinsic,flow_cytometry,277.15,23791505,Kd=217.0 nM
rmCD3 d ε,protein,CD3_Apt12 dimer,218.0 nM,-6.662,non_intrinsic,BLI,298.15,38745854,218 nM for Apt12 dimer
rhGH,protein,rhGH-specific aptamer,218.0 nM,-6.662,intrinsic,,,19500672,the affinity constant was K D = 218 nM rhGH
Cd2+,protein,probe,2.2e-07 M,-6.658,intrinsic,,,32618180,"the disassociation constant ( K D) between Cd 2+ and its aptamer were calculated to be 96 M -1 S -1 , 2.11 × 10 -5 S -1 , and 220 nM, respectively"
streptomycin,protein,STR3,221.3 nM,-6.655,intrinsic,,,23601877,"the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively."
SCAF4,protein,PT1/3-SRiApt,0.223 µM,-6.652,intrinsic,fluorescence,,40574704,0.223 ± 0.030 µ m for PT 1/3 -SRiApt
xanthylacrylamide,protein,XAA-1,2.2400000000000002e-07 M,-6.65,intrinsic,,,40261307,"Using the ThT assay, an apparent K d of 224 nM was obtained for XAA-1"
benzovindiflupyr,protein,Apt.BZF01,2.2650000000000002e-07 M,-6.645,intrinsic,fluorescence,,41614999,corrected KDs of 226.5 nM (Apt.BZF01)
human α-thrombin,protein,T25-Apt15-3'-TMR,228.0 nM,-6.642,non_intrinsic,CE-LIF,298.15,28763192,"The apparent K d values of T25-Apt15-3 ′ -TMR and 5 ′ -TMR-T25-Apt15 were estimated as 228 nM and 8.8 nM, respectively"
Adenosine,protein,Ade1301b,2.3000000000000002e-07 M,-6.638,intrinsic,,,36947745,Ade1301b showed an even lower K d of 230 nM
aflatoxin M1,protein,A50-T26-TMR,230.0 nM,-6.638,intrinsic,,,30086944,"The aptamer showed almost the same FA responses to AFM1 and AFM2, with K ds to be 230 nM and 302 nM, respectively."
urea,protein,U38,232.0 nM,-6.635,intrinsic,,,26002019,isolate a urea speci fi c DNA aptamer with a dissociation constant ( K d) of 232 nM
Okadaic Acid,protein,OA-SL3,234.4 nM,-6.63,intrinsic,BLI,,36322695,"When OA-SL1 was tripled to get the chimera OA-SL3, K d rose to 234.4 ± 15.6 nM"
urea,protein,U38,238.0 nM,-6.623,intrinsic,,,26002019,The K d of aptamer was calculated to be 238 nM
Sr2+,protein,Thrombin Binding Aptamer,240.0 nM,-6.62,intrinsic,mass_spectrometry,298.15,18318508,the Kd determined from the best-fit curve is 240 ( 50 nM for the interaction of TBA and Sr 2 +
Zika NS1,protein,10 (truncated),2.4000000000000003e-07 M,-6.62,intrinsic,,,29120623,"comparable binding affinities (24 and 45 pM for 100-nt and 41-nt 2 , and 134 and 240 nM for 100-nt and 54-nt 10 , respectively)"
dT20,protein,DCC-SSB,2.4000000000000003e-07 M,-6.62,intrinsic,,293.15,34085169,"Titrations of dT 27 and dT20 at low concentrations of DCCSSB gave smaller fluorescence changes, and the data were fit to give single K d values of 43 and 240 nM, respectively"
cortisol,protein,CSS.3,2.4000000000000003e-07 M,-6.62,intrinsic,,,38270529,Our own internal work confirmed that CSS.3 had the best binding affinity in binding buffer with a K D of 240 nM
kanamycin,protein,Apt 1/Apt 2 (split aptamers),247.0 nM,-6.607,intrinsic,,,35316405,"With the (GlcN)5 added in the binding buffer, the Kd was measured to be 247 nM"
Ni2+,protein,Ni-4,2.5700000000000004e-07 M,-6.59,intrinsic,,,40656531,and 257 nM for Ni 2+ in the same titration
rHuEPOa,protein,813,260.0 nM,-6.585,intrinsic,,,20971648,"The K d values of sequences of 807, 813, and 850 were 82 ± 32 nM, 260 ± 117 nM, and 590 ± 354 nM, respectively"
Tetracycline,protein,OTC5,2.6400000000000003e-07 M,-6.578,intrinsic,,,35777074,they also showed a similar fluorescence enhancement with a K d of 264 nM TC
streptomycin,protein,STR6,272.0 nM,-6.565,intrinsic,,,23601877,"the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively."
5-Methoxytryptamine,protein,MLT-C-1F,0.274 μM,-6.562,intrinsic,,,36925277,"For L-TRP and 5-MT very low K d were observed i.e., 0.324 μM and 0.274 μM respectively"
human α-Thrombin,protein,A1,279.0 nM,-6.554,intrinsic,,,31129134,"Whereas the highest value was determined with iRIf for aptamer A1, which is 279 nM."
trisialic acid,protein,Apt3-1,282.7 nM,-6.549,intrinsic,,,40545079,Apt3 -1 ( K d = 282.7 nM)
VEGF165,protein,no. 529,2.8800000000000004e-07 M,-6.541,intrinsic,,,36215718,"The K D values of 524, 64, and 529, were 36.3, 79.3, and 288 nM, respectively."
Lactose,protein,Clone 5,2.9e-07 M,-6.538,intrinsic,SPR,,11178986,Lactose | 6.3 3 10 2 | 1.8 3 10 2 4 | 3.4 3 10 6 | 2.9 3 10 2 7
CD9,protein,CD9-28,289.67 nM,-6.538,intrinsic,fluorescence,277.15,37585601,CD9-28 | 5 ′ -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG GGC GCA CTA GAG CAG GTA CGG TGT CA-3 ′ | - 8.80
prothrombin,protein,HD1-12A-DAB,296.0 nM,-6.529,non_intrinsic,filter_binding,,41053535,and prothrombin with K D s of 13.1 pm and 296 nm
Sc3+,protein,Sc-1b,3.0200000000000003e-07 M,-6.52,intrinsic,,,39743479,its K d (302 nM) was comparable to that of Sc-1
aflatoxin M2,protein,A50-T26-TMR,302.0 nM,-6.52,intrinsic,,,30086944,"The aptamer showed almost the same FA responses to AFM1 and AFM2, with K ds to be 230 nM and 302 nM, respectively."
kanamycin,protein,Apt 1/Apt 2 (split aptamers),304.0 nM,-6.517,intrinsic,,,35316405,"The split aptamers exhibited high affinity towards the kanamycin, with an Kd of 304 nM."
CD20,protein,WB1.CD20.3,309.0 nM,-6.51,non_intrinsic,flow_cytometry,310.15,41079126,WB1.CD20.3 | 5'-TGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | - | N.P. | 309 ± 100
SW620,protein,XL-33-1,3.22e-07 M,-6.492,apparent_cellular,,,25867099,Binding affinity of XL-33-1 against SW620 at 37 ° C was found to be 322 nM.
streptomycin,protein,STR12,340.64 nM,-6.468,intrinsic,,,23601877,"the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively."
CD19,protein,WB15/15.CD19.1_2S,356.0 nM,-6.449,non_intrinsic,flow_cytometry,277.15,41079126,WB15/15.CD19.1_2S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 2.64 | 356 ± 534 | 9.5 ± 5.0
serotonin,protein,Serotonin Aptamer,3.6000000000000005e-07 M,-6.444,intrinsic,,,36704862,"The steady-state binding responses were fitted to the affinity model in eq 1, as shown in Figure 3B, which yielded a K d of 360 nM."
Hen egg white lysozyme,protein,DNA analog a1,378.0 nM,-6.423,intrinsic,,,21167858,"The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 ◦ C are 378nM, 467nM and 573nM, respectively."
benzylpenicillin,protein,BBA1,383.4 nM,-6.416,intrinsic,,,28522308,a Kd of 383.4 nM (dissociation constant) was determined.
benzylpenicillin,protein,BBA1,383.4 nM,-6.416,intrinsic,,,33184760,a Kd of 383.4 nM (dissociation constant) was determined.
bilirubin,protein,Bvd4,3.9e-07 M,-6.409,intrinsic,,,40669049,"We then performed a careful bilirubin titration (Figure S3A), and a clear binding was observed with an apparent K d of 390 nM bilirubin (Figure S3B)."
dT20,protein,DCC-SSB,3.96e-07 M,-6.402,intrinsic,,293.15,34085169,"With dT20, the intercept suggests a dissociation rate constant of 49 s -1 , producing a value of 396 nM for the equilibrium dissociation constant"
biliverdin,protein,Bvd4,4.0999999999999994e-07 M,-6.387,intrinsic,fluorescence,,40669049,"Titration of biliverdin into 1 μM Bvd4 aptamer led to an approximate 90% fluorescence drop (Figure 3A), and the fitted dissociation constant ( K d ) was 0.41 μM"
H-6 cells,cell/EV,Apta25,0.42 µM,-6.377,non_intrinsic,flow_cytometry,310.15,40487293,H-6 cells showed binding with Apta25 ( K D value-0.42 ± 0.093 µ m)
theophylline,protein,ΔTCT8-4 theophylline-binding aptamer,4.2e-07 M,-6.377,intrinsic,,,41248478,Analysis of the SPR dose -response data gave a binding affinity of 420 nM.
rmCD3 d ε -Fc,protein,CD3_Apt3,430.0 nM,-6.367,intrinsic,SPR,298.15,38745854,aptamer 3 (430 nM)
Kringle 5,protein,KG-4,432.0 nM,-6.365,intrinsic,,,37149949,"The preferred aptamer KG-4, which demonstrated a low dissociation constant ( K d) of ~ 432 nM"
mannose-capped lipoarabinomannan,protein,ZXL1,436.3 nM,-6.36,intrinsic,ELONA,310.15,24572295,The K d of 436.3 ± 37.84 nM was established as described in the Methods section.
Uric Acid,protein,Apt2,4.61e-07 M,-6.336,intrinsic,,,42095518,Microscale thermophoresis (MST) analysis yielded a Kd value of 461 nM for Apt2
Hen egg white lysozyme,protein,DNA analog a2,467.0 nM,-6.331,intrinsic,,,21167858,"The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 ◦ C are 378nM, 467nM and 573nM, respectively."
Muscovy duck parvovirus,protein,Apt-10,467.0 nM,-6.331,intrinsic,,,28917743,"the ssDNA aptamer Apt-10, which specifically bound to MDPV with high affinity ( Kd = 467 nM) was successfully screened"
Fe2+,protein,Co-1,4.68e-07 M,-6.33,intrinsic,,,40656531,The corresponding true K d values were ... 468 nM for Fe 2+
SCAF4,protein,SRiApt,0.469 µM,-6.329,intrinsic,fluorescence,,40574704,The binding affinities (K D ) were determined to be 0.469 ± 0.010 µ m for unmodified SRiApt
Bisphenol A,protein,63-mer BPA aptamer,491.69 nM,-6.308,intrinsic,,,32113141,"The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM"
CD9,protein,CD9-08,494.37 nM,-6.306,non_intrinsic,fluorescence,277.15,37585601,CD9-08 | 5 ′ -TGA CAC CGT ACC TGC TCT AGT GCG CAC TGA ACG ATC CTG CGT CAA GTT CAA GGT TGT GAA GCA CGC CAA GGG ACT AT-3 ′ | - 11.71
Mouse thrombin,protein,M08s,495.0 nM,-6.305,intrinsic,SPR,,37621412,M08s | 3.56 10^5 | 1.76 10^-1 | 495
thrombospondin-1,protein,M55,0.5 μM,-6.301,intrinsic,ELISA,,24434496,The K D value of the aptamer M55 binding to thrombospondin-1 was determined as 0.5 7 0.2 μ M
adenine,protein,R10A4,5.000000000000001e-07 M,-6.301,intrinsic,,,38194356,our R10A4 aptamer has a comparable K d of 500 nM
CD19,protein,WB17/17.CD19.1_1S,530.0 nM,-6.276,non_intrinsic,flow_cytometry,277.15,41079126,WB17/17.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 530 ± 1278 | 56 ± 49
mannose-capped lipoarabinomannan,protein,12th-round ssDNA pool,537.5 nM,-6.27,non_intrinsic,ELONA,310.15,24572295,The dissociation constant ( K d values) of the 12th-round pool was determined to be 537.5 ± 69.98 nM
Clenbuterol,protein,CLB-1,5.61e-07 M,-6.251,intrinsic,,,42204903,the apparent K d was 561 nM (Figure 3B)
Hen egg white lysozyme,protein,DNA analog a3,573.0 nM,-6.242,intrinsic,,,21167858,"The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 ◦ C are 378nM, 467nM and 573nM, respectively."
mouse IL-2,protein,M15,600.0 nM,-6.222,intrinsic,,,35756119,"The calculation of the dissociation constant predicted 91 and 600 nM Kd for M20 and M15, respectively"
K-1 cells,cell/EV,Apta30,0.66 µM,-6.18,non_intrinsic,flow_cytometry,310.15,40487293,Apta30 ( K D -0.66 ± 0.12 µ m)
human β-defensin 2,protein,A ad1-2,676.0 nM,-6.17,intrinsic,,,32067984,"a clone with a truncation at the 3 ʹ terminal (A ad1 -2 , 58mer, Fig. 4a) was found to bind more weakly to HBD-2 ( K d = 676 nM, Fig. 4b)."
CD71,protein,ATL,696.7 nM,-6.157,non_intrinsic,flow_cytometry,277.15,41412185,K(pH 7.5)= 696.7 ± 68.03 nM
HER3,protein,HBR,700.0 nM,-6.155,intrinsic,,,33770580,The dissociation constant ( K D) of HBR was calculated from the resulting BLI sensorgrams was 700 nM.
Alternariol,protein,AOH 6C,701.0 nM,-6.154,intrinsic,,,34655971,"The apparent KD of AOH 6C, B-2-3 and T-23 were 701 nM, 445 nM and 274 nM, respectively"
Co2+,protein,Co-1,7.310000000000001e-07 M,-6.136,intrinsic,,,40656531,the Co-1 aptamer has a K d of 731 nM for Co 2+
Dinophysistoxin,protein,anti-DTX parent aptamer,778.1 nM,-6.109,intrinsic,BLI,,36322695,antiDTX parent aptamer ( K d = 778.1 ± 73.5 nM)
IL4Rα,protein,cl.42,788.0 nM,-6.103,non_intrinsic,FACS,310.15,22282665,with an apparent K d of 788 nM (Supplementary Fig. S3B)
EpCAM,protein,TD05,7.92e-07 M,-6.101,apparent_cellular,,,36856721,TD05's K d value is 792 nM
Clenbuterol,protein,CLB-1,7.98e-07 M,-6.098,intrinsic,,,42204903,CLB binding was preserved in the absence of Mg 2+ ( K d 798 nM)
Clenbuterol,protein,CLB-1,8.850000000000001e-07 M,-6.053,intrinsic,,,42204903,ITC showed that the CLB-1 aptamer has a K d of 885 nM (Figure 3D)... The enthalpy ( Δ H = -24.9 kcal mol -1 ) and entropy ( Δ S = -55.9 cal K -1 mol -1 )
Co2+,protein,Ni-4,9.01e-07 M,-6.045,intrinsic,,,40656531,Ni-4 exhibited a K d of 901 nM for Co 2+
prothrombin,protein,HD1,992.0 nM,-6.003,intrinsic,filter_binding,,41053535,and prothrombin (K D = 992 nm)
Thrombin,protein,aptamer 1S,1.08e-06 M,-5.967,intrinsic,SPR,,32268723,"The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 μM and 29.4 nM, respectively"
CD117,protein,Apta04,1100.0 nM,-5.959,intrinsic,BLI,298.15,40487293,"Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 µ m, respectively ( Figure 2 a,b)."
H-6 cells,cell/EV,Apta30,1.107 µM,-5.956,non_intrinsic,flow_cytometry,310.15,40487293,H-6 cells showed binding with ... Apta30 ( K D -1.107 ± 0.208 µ m)
CD123,protein,Apta25,1.16 µM,-5.936,intrinsic,BLI,298.15,40487293,"BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 µ m for ZW25 and 15.6 µ m for CY30 (Figure S2, Supporting Information)."
Bisphenol A,protein,23-mer BPA aptamer,1190.61 nM,-5.924,intrinsic,,,32113141,"The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM"
CD20,protein,Aptamer 2,1.2 μM,-5.921,intrinsic,ITC,298.15,39004051,| 2 | 1.2 ± 0.2 | 1.49 ± 0.01 | > mM | N/D |
IL-8,protein,8A-30,1.22e-06 M,-5.914,intrinsic,SPR,298.0,24129312,| 8A-30       | 1.32 x 10 6 | 1.62         | 1.22 x 10 -6  | 4.62 x 10 -5 | 1.06 x 10 -3 |
K-1 cells,cell/EV,Apta25,1.358 µM,-5.867,non_intrinsic,flow_cytometry,310.15,40487293,Apta25 ( K D value-1.358 ± 0.201 µ m)
bilirubin,protein,Brb7,1.4e-06 M,-5.854,intrinsic,fluorescence,,40669049,"After titrating bilirubin into 1.0 μM Brb7 aptamer, the saturation fluorescence decrease reached 99% (Figure 6A) and its K d was fitted to be 1.4 μM"
Okadaic Acid,protein,anti-OA parent aptamer,1402.0 nM,-5.853,intrinsic,BLI,,36322695,"anti-OA aptamer with high affinity from its parent aptamer ( K d = 1402 ± 58 nM, Figure 1a)"
amikacin,protein,Aptamer A1,1.5e-06 M,-5.824,intrinsic,ITC,298.15,36453647,Aptamer A1 binds 7-fold stronger to amikacin with a K d  value of 1.5 μM
domoic acid,protein,C1-s,1.5e-06 M,-5.824,intrinsic,,,36421085,"BLI results showed that the affinity of C1-s ( K D value, 1.50 × 10 -6 M) and C1 for DAwas at an equivalent level."
thrombin,protein,TBA15,1690.0 nM,-5.772,intrinsic,,,23850569,The addition of 10% blood plasma to the working buffer changed the K D values significantly ( K D TBA 1⁄4 1690 nM  15 nM
ESAT6/CFP10 fusion protein,protein,Aptamer 3 (core 21-nt),1.81e-06 M,-5.742,intrinsic,,,40359808,retaining only the core 21-nucleotide sequence at the 5 ′ end results in a dramatic reduction of the K d value to 1.81E-6
K-1 cells,cell/EV,Apta02,1.821 µM,-5.74,non_intrinsic,flow_cytometry,310.15,40487293,Apta02 ( K D value-1.821 ± 0.117 µ m)
K-1 cells,cell/EV,Apta04,1.867 µM,-5.729,non_intrinsic,flow_cytometry,310.15,40487293,Apta04 ( K D value-1.867 ± 0.19 µ m)
cRNA,protein,CRP-specific RNA aptamer,1.98 μM,-5.703,intrinsic,,,22365749,"Binding kinetics as determined by incubating different target concentrations against constant number of aptamers immobilized on sensor surface showed the K d values of 1.98 and 2.4 μM for cRNA and CRP, respectively."
biliverdin,protein,Bvd1,2e-06 M,-5.699,intrinsic,fluorescence,,40669049,"The same trend was also observed for the Bvd1 aptamer (Figure S1), and the fitted K d was 2.0 μM."
CTNNA1,protein,EA2,2.07 µM,-5.684,intrinsic,MST,,40265971,The K d values (2.07 ± 0.60 µ M) obtained from MST assay (Figure 2l) further corroborated the specific binding between CTNNA1 and EA2.
verrucarin A,protein,14_Ver1,2.2e-06 M,-5.658,intrinsic,fluorescence,,39404132,The binding test demonstrated that the decrease in fluorescence was correlated with increasing verrucarin A concentration with K D = 2.2 μM.
verrucarin A,protein,Ver1_JYP (C32G mutant),2.2999999999999996e-06 M,-5.638,intrinsic,fluorescence,,39404132,guanine with both functional groups exhibited partially recovered binding activity ( K D = 2.3 μM).
C-reactive protein,protein,CRP-specific RNA aptamer,2.4 μM,-5.62,intrinsic,,,22365749,"Binding kinetics as determined by incubating different target concentrations against constant number of aptamers immobilized on sensor surface showed the K d values of 1.98 and 2.4 μM for cRNA and CRP, respectively."
hemin,protein,Sequence D,2.9 μM,-5.538,intrinsic,fluorescence,,40368877,"Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 μ M for sequences C and D, respectively."
thrombin,protein,A4,3040.0 nM,-5.517,intrinsic,,,23850569,K D A4 1⁄4 3040 nM  65 nM
swine C5a,protein,S1,4.0 μM,-5.398,intrinsic,,,30336124,Aptamer S1 bound specifically to swine C5a with a dissociation constant of 4 μM as measured by surface plasmon resonance (SPR).
Brevetoxin-2,protein,Bap5,4.83 uM,-5.316,intrinsic,,,28058132,The Kd value for the binding between the Bap5 aptamer and BTX-2 was 4.83 uM
H-9 cells,cell/EV,Apta02,4.93 µM,-5.307,non_intrinsic,flow_cytometry,310.15,40487293,H-9 cells showed binding with Apta02 ( K D value-4.93 ± 0.367 µ m)
K+,protein,Thrombin Binding Aptamer,5000.0 nM,-5.301,intrinsic,mass_spectrometry,298.15,18318508,the Kd determined from the bestfit curve is 5000 ( 1000 nM for the interaction of TBA and K +
H-9 cells,cell/EV,Apta04,5.402 µM,-5.267,non_intrinsic,flow_cytometry,310.15,40487293,H-9 cells showed binding with ... Apta04 ( K D value-5.402 ± 0.795 µ m)
CD20,protein,Aptamer 2-f1,5.5 μM,-5.26,intrinsic,ITC,298.15,39004051,| 2-f1 | 5.5 ± 1.3 | 1.46 ± 0.03 | > mM | N/D |
CD20,protein,Aptamer 1,6.4 μM,-5.194,intrinsic,ITC,298.15,39004051,| 1 | 6.4 ± 1.0 | 0.86 ± 0.01 | N/D | N/D |
hemin,protein,Sequence C,8.3 μM,-5.081,intrinsic,fluorescence,,40368877,"Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 μ M for sequences C and D, respectively."
CD20,protein,Aptamer 1-f1,9.0 μM,-5.046,intrinsic,ITC,298.15,39004051,| 1-f1 | 9.0 ± 2.4 | 0.98 ± 0.02 | > mM | N/D |
P-selectin,protein,NX244,9000000.0 pM,-5.046,intrinsic,filter_binding,310.15,9743465,NX244 | 9 X 106
bilirubin,protein,Brb9,9e-06 M,-5.046,intrinsic,fluorescence,,40669049,"The same trend was also observed in the Brb9 aptamer (Figure S4), which showed a K d of 9.0 μM."
amikacin,protein,Aptamer A,9.999999999999999e-06 M,-5.0,intrinsic,,,36453647,"native Aptamer A, which has a K d  value of 10 μM"
Patulin,protein,PTL-1,1.2499999999999999e-05 M,-4.903,intrinsic,ITC,298.15,41473783,The measured K d from ITC value was 12.5 μM
CD123,protein,Apta30,15.6 µM,-4.807,intrinsic,BLI,298.15,40487293,"BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 µ m for ZW25 and 15.6 µ m for CY30 (Figure S2, Supporting Information)."
Patulin,protein,PTL-1,1.8399999999999997e-05 M,-4.735,intrinsic,fluorescence,,41473783,yielding an apparent K d of 18.4 μM
CD20,protein,Aptamer 1-f2,18.9 μM,-4.724,intrinsic,ITC,298.15,39004051,| 1-f2 | 18.9 ± 3.3 | 1.07 ± 0.03 | > mM | N/D |
dehydroepiandrosterone sulfate,protein,"DHEAS aptamer (stem, Rp)",32.03 μM,-4.494,intrinsic,fluorescence,,40368877,Values calculated are 32.03 μ M for stem Rp
dehydroepiandrosterone sulfate,protein,"DHEAS aptamer (loop, Rp)",33.28 μM,-4.478,intrinsic,fluorescence,,40368877,33.28 μ M for loop Rp
dehydroepiandrosterone sulfate,protein,"DHEAS aptamer (stem, Sp)",36.57 μM,-4.437,intrinsic,fluorescence,,40368877,36.57 μ M for stem Sp
patulin,protein,PAT Rep,4e-05 M,-4.398,intrinsic,SPR,,35546052,PAT Rep showed a K D value of 4.0 × 10 -5 M
Patulin,protein,PAT-6,4.8e-05 M,-4.319,intrinsic,fluorescence,,41473783,"PAT-6 has weaker binding affinities ( Kd = 48 μM by ThT, Fig. 4S)"
thiamethoxam,protein,Thi-5R-18,4.935e-05 M,-4.307,intrinsic,,,36831921,"According to the ITC results (Figure 5), the Kd value was 4.935 × 10 -5 Mfor Thi-5R-18 combined with the target to release heat"
dehydroepiandrosterone sulfate,protein,"DHEAS aptamer (loop, Sp)",59.62 μM,-4.225,intrinsic,fluorescence,,40368877,59.62 μ M for loop Sp
YRLFRK,protein,BC 007,86.7 μM,-4.062,intrinsic,,,33163683,followed by YRLFRK with Kd = 86.7 μM
L-lactate,protein,D-Lac1103,8.999999999999999e-05 M,-4.046,intrinsic,fluorescence,,41779931,The true K d for D-Lac1103 was calculated to be 0.09 mM for L-lactate
L-lactate,protein,Lac2059,0.00011 M,-3.959,intrinsic,ITC,298.15,41779931,The K d from ITC was determined to be 0.11 mM
L-lactate,protein,Lac201,0.0009000000000000001 M,-3.046,intrinsic,fluorescence,296.15,41779931,"the fitted K d was 0.9 mM (Figure 5C, black line)"
D-lactate,protein,D-Lac1103,0.0025 M,-2.602,intrinsic,fluorescence,295.15,41779931,"In addition, the apparent K d values for D-Lac1103 are 0.46 mMfor L-lactate and 2.5 mM for D-lactate"
Tris(hydroxymethyl)aminomethane,protein,Tris aptamer,0.0026000000000000003 M,-2.585,intrinsic,fluorescence,,40905906,ThT yielded K d values changed modestly from 1.6 to 2.6 mM
L-lactate,protein,Lac2059,0.0033 M,-2.481,intrinsic,fluorescence,296.15,41779931,The fitted K d was 3.3 mM for this 2AP-labeled aptamer
L-lactate,protein,Lac201,0.0043 M,-2.367,intrinsic,fluorescence,296.15,41779931,although the obtained K d (4.3 mM) was about 5-fold higher than that obtained using Mg 2+ .
acrylamide,protein,AA-1,0.0047 M,-2.328,intrinsic,fluorescence,,40261307,"Similarly, the AA-1 aptamer exhibited a true K d value of 4.7 mM via the strand-displacement assay"
acrylamide,protein,AA-1,0.0105 M,-1.979,intrinsic,fluorescence,,40261307,the fitted K d value was 10.5 mM