{"ok": true, "database": "scout", "query_name": "kd_all", "rows": [["PDGF-BB", "protein", "36aApt", "0.036 pM", -13.444, "non_intrinsic", "ELISA", 298.0, "28825469", "36aApt | 0.036 \u00b1 0.012 | - 18.33"], ["PDGF-BB", "protein", "38aApt", "0.094 pM", -13.027, "non_intrinsic", "ELISA", 298.0, "28825469", "38aApt | 0.094 \u00b1 0.008 | - 17.76"], ["IL-8", "protein", "8A-35", "1.72e-12 M", -11.764, "intrinsic", "SPR", 298.0, "24129312", "| 8A-35       | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80         | 3.11 x 10 1  |"], ["human \u03b1-Thrombin", "protein", "A1", "2.0 pM", -11.699, "intrinsic", null, null, "31129134", "Also for aptamer A1 we measured with MST KD values in the pico- and nanomolar range (2 pM and 52 nM). The lowest KD value is determined with MST (shown as bar) for aptamer A1, which is 2 pM."], ["SARS-CoV-2 spike protein (wild type)", "protein", "DSA1N5", "3e-12 M", -11.523, "avidity_multivalent", "dot_blot", null, "36926840", "DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B)."], ["nucleolin", "protein", "Cy5-AT11-B0", "3.3e-12 M", -11.481, "intrinsic", null, null, "31301466", "yielding K D values of 5.2 \u00d7 10 -12 and 3.3 \u00d7 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8"], ["SW480 cells", "cell/EV", "Apt-nanovesicle", "3.66 pM", -11.437, "non_intrinsic", null, null, "32049531", "The dissociation constant ( K d ) value of Apt-nanovesicle against SW480 cells was found to be 3.66 \u00b1 0.34 pM (Figure 2B)"], ["SARS-CoV-2 spike protein (wild type)", "protein", "DSA1N5", "3.9e-12 M", -11.409, "avidity_multivalent", "dot_blot", null, "36926840", "DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B)."], ["SARS-CoV-2 pseudotyped lentivirus (omicron variant)", "protein", "DSA1N5", "4.8e-12 M", -11.319, "avidity_multivalent", "dot_blot", null, "36926840", "This study demonstrates that DSA1N5 has high affinity for recognizing OMPV with a K d value of 4.8 pM, which is in the same order of magnitude as that measured for the WTPV (2.1 pM) in deionized water (DI water)"], ["SARS-CoV-2 pseudotyped lentivirus (omicron variant)", "protein", "DSA1N5", "5.1e-12 M", -11.292, "avidity_multivalent", "dot_blot", null, "36926840", "DSA1N5 preserves its binding affinity in 50% wastewater ( K d = 2.1 -4.1 pM for WTPV and 5.1 for OMPV in wastewater)."], ["nucleolin", "protein", "Cy5-AT11", "5.2e-12 M", -11.284, "intrinsic", null, null, "31301466", "yielding K D values of 5.2 \u00d7 10 -12 and 3.3 \u00d7 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8"], ["PDGF-BB", "protein", "FullApt", "5.33 pM", -11.273, "non_intrinsic", "ELISA", 298.0, "28825469", "FullApt | 5.33 \u00b1 2.36 | - 15.37"], ["PDGF-BB", "protein", "40Apt", "5.92 pM", -11.228, "non_intrinsic", "ELISA", 298.0, "28825469", "40Apt | 5.92 \u00b1 1.13 | - 15.31"], ["PDGF-BB", "protein", "38bApt", "7.03 pM", -11.153, "non_intrinsic", "ELISA", 298.0, "28825469", "38bApt | 7.03 \u00b1 1.28 | - 15.21"], ["nucleolin", "protein", "Cy5-AT11", "9.1e-12 M", -11.041, "intrinsic", null, null, "31301466", "K D values of 9.1 \u00d7 10 -12 and 9.5 \u00d7 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4"], ["nucleolin", "protein", "Cy5-AT11-B0", "9.5e-12 M", -11.022, "intrinsic", null, null, "31301466", "K D values of 9.1 \u00d7 10 -12 and 9.5 \u00d7 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4"], ["thrombin", "protein", "HD1-12A-DAB", "13.1 pM", -10.883, "non_intrinsic", "filter_binding", null, "41053535", "HD1-12A-DAB EXACT inhibitor bound to thrombin and prothrombin with K D s of 13.1 pm"], ["P-selectin", "protein", "PF377", "14.0 pM", -10.854, "intrinsic", "filter_binding", 310.15, "9743465", "PF377 | 14"], ["P-selectin", "protein", "PF377sl", "14.0 pM", -10.854, "intrinsic", "filter_binding", 296.15, "9743465", "PF377sl | 14"], ["P-selectin", "protein", "PF377", "16.0 pM", -10.796, "intrinsic", "filter_binding", 310.15, "9743465", "PF377 | 16"], ["P-selectin", "protein", "PF377", "18.0 pM", -10.745, "intrinsic", "filter_binding", 277.15, "9743465", "PF377 | 18"], ["thrombin", "protein", "Supra-TBA15/29-GO", "1.9e-11 M", -10.721, "avidity_multivalent", null, null, "31157200", "Supra-TBA15 / 29-GO prepared with GO (40 \u03bc g mL -1 ) at 60 \u25e6 C exhibited much higher binding affinity toward thrombin ( K d = 1.9 \u00d7 10 -11 M, Figure S10 , Supporting Information)."], ["Malate Synthase", "protein", "MS10-Trunc", "19.0 pM", -10.721, "intrinsic", null, null, "31704587", "MS10-Trunc aptamer exhibited high af fi nity for MS (equilibrium dissociation constant [KD]  19 pM)"], ["PDGF-C", "protein", "\u03b1-PC", "20.0 pM", -10.699, "intrinsic", "SPR", null, "42138517", "SPR analysis demonstrated that the \u03b1 -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM"], ["SW480 cells", "cell/EV", "Fixed Apt-nanovesicle", "28.06 pM", -10.552, "non_intrinsic", null, null, "32049531", "the K d value of fi xed Apt-nanovesicles to SW480 cells was increased to 28.06 \u00b1 3.31 pM (Figure 2D)"], ["P-selectin", "protein", "PF377sl", "29.0 pM", -10.538, "intrinsic", "filter_binding", 310.15, "9743465", "PF377sl | 29"], ["VEGF165", "protein", "3R02 Bivalent", "3e-11 M", -10.523, "avidity_multivalent", null, null, "23237717", "The K d value of 30 pM for 3R02 Bivalent was calculated by measuring SPR."], ["bevacizumab", "protein", "A14#1", "44.0 pM", -10.357, "intrinsic", null, null, "35114463", "affinity of A14#1 to bevacizumab markedly increased at pH 4.7 ( K D = 44 pM)"], ["P-selectin", "protein", "PF377sl", "46.0 pM", -10.337, "intrinsic", "filter_binding", 310.15, "9743465", "PF377sl | 46"], ["thrombin", "protein", "MP-TBA15/TBA29-T15", "5.2e-11 M", -10.284, "avidity_multivalent", "saturation_binding", null, "22300379", "MP-TBA15/TBA29-T15 -Au NPs provided high flexibility and an appropriate orientation and distance between TBA and TBA units for bivalent binding, allowing stronger interactions with thrombin ( K d = 5.2 \u00d7 10 -11 M; Supporting Information, Figure S3)"], ["P-selectin", "protein", "PF373sl", "56.0 pM", -10.252, "intrinsic", "filter_binding", 310.15, "9743465", "PF373sl | 56"], ["sLe X -BSA", "glycan/conjugate", "Clone 5", "5.7e-11 M", -10.244, "intrinsic", "SPR", 298.15, "11178986", "sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11"], ["von Willebrand factor A1-domain", "protein", "Rn-DsDsDs-53mh", "61.3 pM", -10.213, "intrinsic", "SPR", 310.15, "27966933", "RnDsDsDs-53mh ( K D = 61.3 pM)"], ["Myoglobin", "protein", "anti-Mb aptamer", "65.0 pM", -10.187, "intrinsic", null, null, "25957831", "The corresponding af fi nity, K D, values calculated from the ratio between dissociation ( k d) and association ( k a ) was found to be  65 pM."], ["von Willebrand factor A1-domain", "protein", "Rn-DsDsDs-44", "74.9 pM", -10.126, "intrinsic", "SPR", 310.15, "27966933", "Rn-DsDsDs-44 ( K D = 74.9 pM) exhibited the highest a ffi nity"], ["CCRF-CEM cells", "cell/EV", "CDN-sgc8", "0.08 nM", -10.097, "non_intrinsic", "fluorescence", null, "35670775", "Kd=0.08\u00b10.01 nM"], ["sLe X -BSA", "glycan/conjugate", "Clone 5", "8.5e-11 M", -10.071, "intrinsic", "SPR", 298.15, "11178986", "Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11"], ["PDGF-BB", "protein", "PDGF-B aptamer", "0.1 nM", -10.0, "intrinsic", "filter_binding", null, "9916931", "the binding affinity of the aptamer used in the experiments described below ( K d \u2248 0.1 nM)"], ["ofloxacin", "protein", "Q2", "0.11 nM", -9.959, "intrinsic", null, null, "26547431", "Their K D values were calculated at K D 1\u20444 0.11 nM ( 7 0.06) for aptamer Q2"], ["MutS", "protein", "2-06", "1.23e-10 M", -9.91, "intrinsic", null, null, "25668425", "The best fi t was obtained at K d = 123 pM and [T]0 = 213 pM"], ["MPO", "protein", "MPO-16", "166.0 pM", -9.78, "non_intrinsic", "flow_cytometry", null, "37277648", "MPO16 revealed the highest binding affinity ( K d = 166 pM)"], ["P-selectin", "protein", "PF398sl", "178.0 pM", -9.75, "intrinsic", "filter_binding", 310.15, "9743465", "PF398sl | 178"], ["von Willebrand factor A1-domain", "protein", "Rn-DsDs-51mh2", "182.0 pM", -9.74, "intrinsic", "SPR", 310.15, "27966933", "Rn-DsDs-51mh2 ( K D = 182 pM)"], ["HBcAg", "protein", "A-9", "2.0000000000000003e-10 M", -9.699, "intrinsic", "affinity_real_time_qPCR", null, "32250595", "This aptamer showed strong binding to HBcAg ( K d : 0.2 nM)"], ["ofloxacin", "protein", "Q8", "0.2 nM", -9.699, "intrinsic", null, null, "26547431", "K D 1\u20444 0.20 nM ( 7 0.09) for aptamer Q8"], ["OH-BDE47", "protein", "BDE-A-8", "0.2 nM", -9.699, "intrinsic", null, null, "27566357", "The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition."], ["MPO", "protein", "MPO-02", "227.0 pM", -9.644, "non_intrinsic", "flow_cytometry", null, "37277648", "MPO-02 ... 227"], ["P-selectin", "protein", "PF377sl", "250.0 pM", -9.602, "non_intrinsic", "flow_cytometry", 296.15, "9743465", "PF377sl | 250"], ["thrombin", "protein", "29-mer thrombin-specific aptamer", "298.0 pM", -9.526, "intrinsic", null, null, "32570818", "The n-curve analysis provided a Kd of 298 pM ( + 111 / 81 pM)"], ["VEGF165", "protein", "3R02", "3e-10 M", -9.523, "intrinsic", null, null, "23237717", "The K d value for 3R02 was 300 pM"], ["20 Methyl Spirolide G", "protein", "SPX 7", "3e-10 M", -9.523, "intrinsic", null, null, "34144421", "The present study, among the aptamers selected, the aptamer with highest affinity had a dissociation constant of 0.3 nM for SPX G"], ["chimeric-tPA", "protein", "Chi-tPA 1", "0.32 nM", -9.495, "intrinsic", null, null, "26876003", "selected aptamer having KD values of 0.320 nM"], ["von Willebrand factor A1-domain", "protein", "ARC1172-41", "326.0 pM", -9.487, "intrinsic", "SPR", 310.15, "27966933", "ARC1172-41 ( K D = 326 pM)"], ["FLRPp (O serotype)", "protein", "FMD_1", "3.46e-10 M", -9.461, "intrinsic", "SPR", null, "42010751", "dissociation constants ( KD ) of 3.46 \u00d7 10 -10 M"], ["Human thrombin", "protein", "Lin08-08", "0.4 nM", -9.398, "non_intrinsic", "SPR", null, "37621412", "Lin(08-08) | 1.63 10^6 | 6.94 10^-4 | 0.4"], ["Human thrombin", "protein", "Pse08-08", "0.4 nM", -9.398, "non_intrinsic", "SPR", null, "37621412", "Pse(08-08) | 1.19 10^6 | 5.10 10^-4 | 0.4"], ["HBeAg", "protein", "EAg3-Py", "4.0000000000000007e-10 M", -9.398, "intrinsic", "affinity_real_time_qPCR", null, "32250595", "The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3"], ["CCRF-CEM cells", "cell/EV", "mono-CDN-sgc8", "0.48 nM", -9.319, "non_intrinsic", "fluorescence", null, "35670775", "Kd= 0.48 \u00b1 0.04 nM"], ["PDGF-BB", "protein", "PDGF-specific aptamer", "5e-10 M", -9.301, "intrinsic", "microcantilever", 310.15, "24723743", "K d , as shown in Fig. 10, decreased from approximately 12 \u00d7 10 -10 M to 5 \u00d7 10 -10 M as the temperature changed from 19 to 37 \u25e6 C."], ["human \u03b1-thrombin", "protein", "Apt29", "0.5 nM", -9.301, "non_intrinsic", null, null, "28763192", "a 29nucleotide aptamer (5 \u2032 -AGT CCG TGG TAG GGC AGG TTG GGG TGA CT-3 \u2032 , denoted as Apt29 here) binds to the heparin-binding site of human \u03b1 -thrombin with a dissociation constant ( K d) around 0.5 nM."], ["thrombin", "protein", "TBA29", "0.5 nM", -9.301, "non_intrinsic", null, null, "31614078", "The 29-nt TBA29 aptamer has a bimodular duplex-antiparallel G4 structure and binds to thrombin with a binding a ffi nity of 0.5 nM. 30"], ["BDNF", "protein", "NV_B12", "5e-10 M", -9.301, "intrinsic", "ALISA", null, "38149631", "The equilibrium dissociation constant ( K d) for the NV_B12/BDNF interaction was obtained by fitting the equation, Y = B max \u00d7 X /( K d + X )... The K d value determined to be 0.5 nM (95% CI: 0.4 -0.6 nM)"], ["Thrombin", "protein", "TBA29", "5e-10 M", -9.301, "intrinsic", null, null, "26643617", "and TBA29 (~5 \u00d7 10 -10 M)"], ["PlanarAu", "protein", "1N", "5.600000000000001e-10 M", -9.252, "intrinsic", "QCM", null, "30189130", "aptamer 1N showing the highest affinity (0.56 nM)"], ["AGEs-HSA", "protein", "#9s", "0.57 nM", -9.244, "intrinsic", null, null, "24012635", "Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively."], ["sLe X -BSA", "glycan/conjugate", "Selected pool", "5.8e-10 M", -9.237, "intrinsic", "SPR", null, "11178986", "Selected pool | 2.4 3 10 5 | 1.4 3 10 2 3 | 1.7 3 10 9 | 5.8 3 10 2 10"], ["human \u03b1-thrombin", "protein", "5'-TMR-Apt15-T24", "0.6 nM", -9.222, "non_intrinsic", "CE-LIF", 298.15, "28763192", "0.6 nM for 5 \u2032 -TMR-Apt15-T24"], ["human \u03b1-thrombin", "protein", "5'-TMR-Apt15-T25", "0.6 nM", -9.222, "non_intrinsic", "CE-LIF", 298.15, "28763192", "0.6 nM for 5 \u2032 -TMR-Apt15-T25"], ["EGFR", "protein", "Anti-EGF receptor aptamer", "0.62 nM", -9.208, "non_intrinsic", null, null, "41877526", "Anti-EGF receptor aptamers ( K d : 0.62 nM, DNA aptamers)"], ["AGEs-HSA", "protein", "#4s", "0.63 nM", -9.201, "intrinsic", null, null, "24012635", "Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively."], ["thrombin", "protein", "HD1-22", "6.5e-10 M", -9.187, "non_intrinsic", "SPR", null, "18826387", "HD1-22 | Thrombin | K D ( M) | 6.5 \u00b7 10 ) 10"], ["MutS", "protein", "2-06", "6.5e-10 M", -9.187, "intrinsic", null, null, "25668425", "The experimental points from the second step resulted in the best fi t with the theoretical dependence of R versus [L] 0 at K d = 650 pM"], ["human \u03b1-thrombin", "protein", "5'-TMR-Apt15-T30", "0.7 nM", -9.155, "non_intrinsic", "CE-LIF", 298.15, "28763192", "0.7 nM for 5 \u2032 -TMR-Apt15-T30"], ["human \u03b1-thrombin", "protein", "5'-TMR-Apt15-T35", "0.7 nM", -9.155, "non_intrinsic", "CE-LIF", 298.15, "28763192", "0.7 nM for 5 \u2032 -TMR-Apt15-T35"], ["tetracycline", "protein", "TC aptamer", "770.0 pM", -9.114, "intrinsic", null, null, "25517161", "dissociation constant Kd of 770 pM ([Mg 2 \u00fe ] 1\u20444 10 mM)"], ["sLe X -BSA", "glycan/conjugate", "Clone 2", "8e-10 M", -9.097, "intrinsic", "SPR", null, "11178986", "Clone 2 | 9.8 3 10 5 | 7.3 3 10 2 5 | 1.2 3 10 9 | 8.0 3 10 2 10"], ["PSMA", "protein", "C3", "8.000000000000001e-10 M", -9.097, "intrinsic", "EMSA", null, "41126016", "an exemplar shows very high affinity for PSMA ( K d \u223c 0.8 nM)."], ["Immunoglobulin E", "protein", "IgE37-T10-FAM", "0.8 nM", -9.097, "intrinsic", null, null, "32498825", "The FA assay using T10-labeled aptamer with a dissociation constant ( K d) about 0.8 nM"], ["CCRF-CEM cells", "cell/EV", "individual sgc8", "0.82 nM", -9.086, "non_intrinsic", "fluorescence", null, "35670775", "Kd=0.82 \u00b1 0.12 nM"], ["Tasset - thrombin complex", "protein", "Bock", "0.87 nM", -9.06, "intrinsic", "BSI", 283.15, "22032342", "Bock - [Tasset complex] | not available | 0.87 ( 0.18 nM"], ["MPO", "protein", "MPO-14", "897.0 pM", -9.047, "non_intrinsic", "flow_cytometry", null, "37277648", "MPO-14 ... K d : 897 pM"], ["MPO", "protein", "MPO-03", "912.0 pM", -9.04, "non_intrinsic", "flow_cytometry", null, "37277648", "MPO-03 ... 912"], ["alpha-thrombin", "protein", "RNAR9D-14T", "1.0 nM", -9.0, "intrinsic", "filter_binding", 310.15, "22385910", "Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) and \u03b1-thrombin (apparent Kd =1 nM)"], ["P-selectin", "protein", "PF422sl", "1000.0 pM", -9.0, "intrinsic", "filter_binding", 310.15, "9743465", "PF422sl | 1 X 103"], ["neomycin", "protein", "Aptamer A", "1e-09 M", -9.0, "intrinsic", null, null, "36453647", "The binding affinity of neomycin to Aptamer A shows a strong K d  of 1 nM with an enthalpy and entropy value of -100 kJ/mol & -163.1 J/mol. K"], ["Sc3+", "protein", "Sc-1", "1e-09 M", -9.0, "intrinsic", "fluorescence", null, "39743479", "true K d for the binding of Sc-1 to Sc 3+ to be 1.0 nM"], ["PSMA", "protein", "C3 (without fluorescein)", "1e-09 M", -9.0, "intrinsic", "EMSA", null, "41126016", "EMSA data show that Cy5-labeled C3 without fluorescein binds PSMA just as strongly as the parent construct, with an apparent K d of \u223c 1 nM (Figure S9)."], ["von Willebrand factor A1-domain", "protein", "Pr-DsDsDs-40", "1.03 nM", -8.987, "intrinsic", "SPR", 310.15, "27966933", "Pr-DsDsDs-40 ( K D = 1.03 nM)"], ["Heparin-binding protein", "protein", "Apt-13", "1.04 nM", -8.983, "intrinsic", null, null, "38675537", "The KD values of the three aptamers were 3.42, 1.44, and 1.04 nM, respectively"], ["beta-conglutin", "protein", "11-mer", "1.05e-09 M", -8.979, "intrinsic", "MST", 298.15, "33498970", "KD values determined (Figure 6b) are very similar (11-mer: 1.05 nM"], ["AP65", "protein", "AP65_A1", "1.057e-09 M", -8.976, "intrinsic", "ELAA", 298.15, "29972299", "A K D value of 1.057 nM was obtained using the sigmoidal dose-response curve model"], ["MPO", "protein", "MPO-01", "1148.0 pM", -8.94, "non_intrinsic", "flow_cytometry", null, "37277648", "MPO-01 ... 1,148"], ["PDGF-BB", "protein", "PDGF-specific aptamer", "1.2e-09 M", -8.921, "intrinsic", "microcantilever", 292.15, "24723743", "K d , as shown in Fig. 10, decreased from approximately 12 \u00d7 10 -10 M to 5 \u00d7 10 -10 M as the temperature changed from 19 to 37 \u25e6 C."], ["HBeAg", "protein", "A-9S", "1.2e-09 M", -8.921, "intrinsic", "affinity_real_time_qPCR", null, "32250595", "The measured dissociation constant ( K d) is improved by 19 times \ue0d5 from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer."], ["PvTRAg", "protein", "Apt_16", "1.2e-09 M", -8.921, "intrinsic", null, null, "40042916", "The K D of Apt_14 and Apt_16 was found to be comparable, 1.9 and 1.2 nM, respectively"], ["ATP", "protein", "Huizenga-Szostak ATP aptamer", "1.3e-09 M", -8.886, "intrinsic", "fluorescence", null, "25170558", "binding a ffi nity can be tuned over 4 orders of magnitude (1.3 nM -203 \u03bc M)"], ["prothrombin", "protein", "RNAR9D-14T", "1.4 nM", -8.854, "intrinsic", "SPR", 298.15, "22385910", "Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM"], ["PD-L1", "protein", "8-60", "1.4 nM", -8.854, "intrinsic", null, null, "34711320", "8 e 60, a representative aptamer with high af fi nity (KD 1\u20444 1.4 nM determined by SPR)"], ["Heparin-binding protein", "protein", "Apt-02", "1.44 nM", -8.842, "intrinsic", null, null, "38675537", "The KD values of the three aptamers were 3.42, 1.44, and 1.04 nM, respectively"], ["alkaline phosphatase", "protein", "ALP binding aptamer", "1.49e-09 M", -8.827, "avidity_multivalent", "PISA", null, "30827094", "Similarly, from the response -dose curve (Figure 3B), the K d value for the aptamer -MIP hybrid-coated array was estimated to be 1.49 \u00d7 10 -9 M"], ["thrombin", "protein", "T.7", "1.5 nM", -8.824, "intrinsic", "SPR", null, "37798416", "T.7 exhibited the strongest binding signal with a 1.5 nM K d"], ["alkaline phosphatase", "protein", "ALP binding aptamer", "1.5000000000000002e-09 M", -8.824, "avidity_multivalent", "PISA", null, "30827094", "giving cross-reactivity of 3.2 -5.6% and a dissociation constant of 1.5 nM"], ["OH-BDE47", "protein", "BDE-A-12", "1.53 nM", -8.815, "intrinsic", null, null, "27566357", "The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition."], ["IgE", "protein", "S2", "1.5500000000000002e-09 M", -8.81, "intrinsic", "NECEEM", null, "36144553", "Based on the results of these experiments, the K D values of S1 and S2 were estimated to be 0.83 and 1.55 nM, respectively"], ["human \u03b1-thrombin", "protein", "LOOPER modified thrombin aptamer", "1.6000000000000003e-09 M", -8.796, "intrinsic", "SPR", null, "28938065", "Using single-cycle kinetics surface plasmon resonance (SPR), the LOOPER aptamer exhibited a Kd of 1.6 nM"], ["hOX40", "protein", "9C7", "1.7 nM", -8.77, "intrinsic", "filter_binding", 310.15, "23113766", "9C7 | 11 | 1.7"], ["HBeAg", "protein", "EAg3", "1.7000000000000001e-09 M", -8.77, "intrinsic", "affinity_real_time_qPCR", null, "32250595", "The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3, as compared to the K d value of 1.7 nM with the unmodi fi ed EAg3 aptamer."], ["beta-conglutin", "protein", "TT-11-mer", "1.88e-09 M", -8.726, "intrinsic", "MST", 298.15, "33498970", "KD values determined (Figure 6b) are very similar (... TT-11 mer: 1.88 nM"], ["Bock - thrombin complex", "protein", "Tasset", "1.9 nM", -8.721, "intrinsic", "BSI", 283.15, "22032342", "Tasset - [Bock complex] | not available | 1.9 ( 0.2 nM"], ["CD8a", "protein", "A3", "1.9 nM", -8.721, "non_intrinsic", "flow_cytometry", null, "31209354", "the A1, A3 and A8 aptamers have apparent K D values of 18.3 \u00b1 4.6, 1.9 \u00b1 0.8 and 2.4 \u00b1 0.9  nM, respectively"], ["CD8", "protein", "CD8 aptamer", "1.9 nM", -8.721, "non_intrinsic", "flow_cytometry", null, "32786336", "The aptamer with the highest apparent affinity (1.9 nM) and association rate, measured by flow cytometry and biolayer interferometry, respectively, was chosen for further use in cell isolation."], ["VWF A1-domain", "protein", "ARC1779", "2.0 nM", -8.699, "intrinsic", "filter_binding", 298.15, "19422452", "This resulted in a final aptamer (ARC1779) that is a 40-nucleotide modified DNA/RNA oligonucleotide with a K D of 2 nM for the A1-domain."], ["von Willebrand factor", "protein", "42-nt DNA aptamer", "2.0 nM", -8.699, "intrinsic", "ELISA", null, "31493779", "a biotinylated DNA aptamer was able to bind an antibody-captured VWF in a concentration-dependent manner with a dissociation constant ( KD ) of 2.0 nM  0.3."], ["von Willebrand factor A1 domain", "protein", "ARC1779", "2.0 nM", -8.699, "non_intrinsic", null, null, "21108551", "ARC1779 binds with high affinity (Kd ~ 2 nM) to the vWF A1 domain"], ["VWF A1 domain", "protein", "ARC1779", "2.0 nM", -8.699, "non_intrinsic", null, null, "31315441", "ARC1779 has a high binding affinity to VWF A1 domain (K D \u2248 2 nM)"], ["CD8", "protein", "A3t", "2.0 nM", -8.699, "non_intrinsic", null, null, "36149728", "A3t, a CD8 receptor-binding aptamer, which binds CD8-expressing cells with an equilibrium dissociation constant K D of 2 nM."], ["CD8", "protein", "rvCD8apt", "2.0 nM", -8.699, "non_intrinsic", null, null, "36149728", "apparent K D = 2 nM for CD8 + cells"], ["CD44-HABD", "protein", "Motif 4 (ADDA adduct)", "2e-09 M", -8.699, "intrinsic", null, null, "23057694", "motifs 2 and 4(ADDA adduct) have ~2 nM affinity to CD44-HABD"], ["THY1", "protein", "XA-B217", "2.0 nM", -8.699, "intrinsic", null, null, "33242496", "The equilibrium dissociation constants, Kd, were derived from these curves and are determined as ... XA-B217=2 nM"], ["Progesterone", "protein", "PG13T2", "2.1 nM", -8.678, "intrinsic", null, null, "28237255", "The dissociation constant of the PG13T2-P4 complex calculated using non-linear regression fi tting of the obtained curve was found to be 2.1 nM."], ["IL-23", "protein", "A23P15", "2.139 nM", -8.67, "intrinsic", null, null, "38810331", "the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively"], ["sLe X -BSA", "glycan/conjugate", "Clone 15", "2.3e-09 M", -8.638, "intrinsic", "SPR", null, "11178986", "Clone 15 | 3.5 3 10 5 | 8.1 3 10 2 4 | 4.3 3 10 8 | 2.3 3 10 2 9"], ["alpha-fetoprotein", "protein", "AFP-specific ssDNA aptamer", "2.37 nM", -8.625, "intrinsic", null, null, "22410487", "The K d of the AFP-specific ssDNA was calculated to be 2.37 nM"], ["thrombin", "protein", "HD22", "2.4e-09 M", -8.62, "intrinsic", "SPR", null, "18826387", "HD22 | Thrombin | K D ( M) | 2.4 \u00b7 10 ) 9"], ["CD8a", "protein", "A8", "2.4 nM", -8.62, "non_intrinsic", "flow_cytometry", null, "31209354", "the A1, A3 and A8 aptamers have apparent K D values of 18.3 \u00b1 4.6, 1.9 \u00b1 0.8 and 2.4 \u00b1 0.9  nM, respectively"], ["melatonin", "protein", "MLT-A-2", "2.4 nM", -8.62, "intrinsic", null, null, "36925277", "K d = 2.4 \u00b1 2.8 nM for MLT-A-2"], ["melatonin", "protein", "MLT-A-2F", "2.4 nM", -8.62, "intrinsic", null, null, "36925277", "MLT-A-2F K d = 2.4 \u00b1 2.8 nM"], ["MPO", "protein", "MPO-05", "2584.0 pM", -8.588, "non_intrinsic", "flow_cytometry", null, "37277648", "MPO-05 ... 2,584"], ["beta-conglutin", "protein", "11-mer-TT", "2.59e-09 M", -8.587, "intrinsic", "MST", 298.15, "33498970", "KD values determined (Figure 6b) are very similar (... and 11-mer-TT: 2.59 nM)"], ["Human thrombin", "protein", "Pse08-29", "2.6 nM", -8.585, "non_intrinsic", "SPR", null, "37621412", "Pse(08 - 29) | 1.33 10^6 | 3.47 10^-3 | 2.6"], ["Prostate Specific Antigen", "protein", "Apta", "2.6 nM", -8.585, "intrinsic", null, null, "25569871", "The change in current is used to determine the PSA -aptamer dissociation constant KD , of ca. 2.6 nM."], ["Human Cardiac Troponin I", "protein", "TnIApt 23", "2.69 nM", -8.57, "intrinsic", null, null, "26003883", "Finally TnIApt 23 showed beast affinity in nanomolar range (2.69 nM) toward the target protein."], ["beta-conglutin", "protein", "TT-11-mer-TT", "2.71e-09 M", -8.567, "intrinsic", "MST", 298.15, "33498970", "KD values determined (Figure 6b) are very similar (... TT-11-mer-TT: 2.71 nM"], ["Neuron specific enolase", "protein", "P-5C8G", "2.76 nM", -8.559, "intrinsic", null, null, "38091739", "The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively."], ["thrombin", "protein", "TBA", "2.86e-09 M", -8.544, "intrinsic", "SPR", null, "16053288", "thrombin | 2.2 10 5 | 6.3 10 - 4 | 3.4 10 8 | 2.86 10 - 9"], ["IL-23", "protein", "A23P6", "2.88 nM", -8.541, "intrinsic", null, null, "38810331", "the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively"], ["hCD4", "protein", "U26", "2.93 nM", -8.533, "intrinsic", "qPCR", 298.15, "32567629", "U26 exhibited the highest binding affinity ( K d = 2.93 \u00b1 1.03 nM) to hCD4-conjugated beads."], ["S-adenosylmethionine", "protein", "Bs SAM-I riboswitch", "3.0000000000000004e-09 M", -8.523, "intrinsic", null, null, "23343213", "Both \u03bc MSA values agree well with results from the in-line probing assays performed using identical buffer conditions: ... 3 nM K d , respectively"], ["S-adenosylmethionine", "protein", "Pi SAM-I riboswitch", "3.0000000000000004e-09 M", -8.523, "intrinsic", null, null, "23343213", "which is on the order of the 3 nM value measured using a conventional inline probing assay"], ["dT70", "protein", "DCC-SSB", "3.0000000000000004e-09 M", -8.523, "intrinsic", null, null, "34085169", "At a low concentration ( \u223c 2.5 nM), the titration with dT70 gave an approximate assessment of affinity ( K d \u223c 3 nM)."], ["SARS-CoV-2 RBD", "protein", "CoV2-RBD-1", "3.1000000000000005e-09 M", -8.509, "intrinsic", "flow_cytometry", null, "32551560", "the dissociation constant values ( K d) of the CoV2-RBD-1 aptamer ... were 3.1 nM"], ["MPO", "protein", "MPO-18", "3192.0 pM", -8.496, "non_intrinsic", "flow_cytometry", null, "37277648", "MPO-18 ... K d : 3,192 pM"], ["human \u03b1-thrombin", "protein", "Apt15-T25-3'-TMR", "3.2 nM", -8.495, "non_intrinsic", "CE-LIF", 298.15, "28763192", "The apparent K d of Apt15-T25 -3 \u2032 -TMR was estimated to be about 3.2 nM."], ["K562", "protein", "PAM", "3.2 nM", -8.495, "non_intrinsic", null, null, "32307868", "the K d value (3.2 nM) of PAM in binding the K562 cell is one order of magnitude lower than that of the aptamer alone (41 nM)."], ["sLe X", "glycan/conjugate", "Clone 5", "3.3e-09 M", -8.481, "intrinsic", "SPR", null, "11178986", "sLe X | 1.7 3 10 5 | 5.5 3 10 2 4 | 3.0 3 10 8 | 3.3 3 10 2 9"], ["transferrin receptor 1", "protein", "JBA8.26", "3.3 nM", -8.481, "non_intrinsic", "flow_cytometry", null, "35875870", "JBA8.26 bound TfR1 hi H9 T-lymphoma cells with an apparent K D of 3.3 \u00b1 0.6 nM"], ["human \u03b1-Thrombin", "protein", "B1", "3.4 nM", -8.469, "intrinsic", null, null, "31129134", "for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)"], ["prothrombin", "protein", "HD1", "3.5e-09 M", -8.456, "non_intrinsic", "SPR", null, "18826387", "HD1 | Prothrombin+ phospholipids | K D ( M) | 3.5 \u00b7 10 ) 9"], ["Immunoglobulin E", "protein", "Unlabeled anti-IgE aptamer", "3.5 nM", -8.456, "intrinsic", null, null, "32498825", "close to the K d of the unlabeled aptamer (3.5 nM)"], ["gonyautoxin 1/4", "protein", "tGO18-T-d", "3.6 nM", -8.444, "intrinsic", null, null, "33294137", "Corresponding Kd values of GO18-T-d and tGO18-T-d, determined by the average of 8 independent measurements, were 75.63 nM and 3.60 nM, respectively."], ["Surface Antigen 1", "protein", "SOK14", "3.736 nM", -8.428, "intrinsic", null, null, "40288708", "SOK14 (3.736 nM, R 2 = 0.7367)"], ["human \u03b1-thrombin", "protein", "Tasset", "3.84 nM", -8.416, "intrinsic", "BSI", 283.15, "22032342", "Tasset - thrombin | 0.5 - 1.0 nM 14 | 3.84 ( 0.68 nM"], ["sLe X -BSA", "glycan/conjugate", "Clone 18", "3.9e-09 M", -8.409, "intrinsic", "SPR", null, "11178986", "Clone 18 | 5.1 3 10 5 | 2.0 3 10 2 3 | 2.5 3 10 8 | 3.9 3 10 2 9"], ["Carcinoembryonic antigen", "protein", "GAC-P", "3.93 nM", -8.406, "intrinsic", null, null, "35517255", "The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively."], ["human \u03b1-thrombin", "protein", "LOOPER modified thrombin aptamer", "4e-09 M", -8.398, "intrinsic", null, null, "28938065", "Preliminary binding analysis by label-free microscale thermophoresis showed a promising dissociation constant K d = 4 nM for thrombin"], ["Surface Antigen 1", "protein", "SOK18", "4.034 nM", -8.394, "intrinsic", null, null, "40288708", "SOK18 (4.034 nM, R 2 = 0.8422)"], ["Surface Antigen 1", "protein", "SOK3", "4.185 nM", -8.378, "intrinsic", null, null, "40288708", "SOK3 (4.185 nM, R 2 = 0.8153)"], ["Mouse thrombin", "protein", "Pse08-08", "4.2 nM", -8.377, "non_intrinsic", "SPR", null, "37621412", "Pse(08-08) | 7.35 10^5 | 3.06 10^-3 | 4.2"], ["CD19", "protein", "WB15/15.CD19.1_3S", "4.3 nM", -8.367, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB15/15.CD19.1_3S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 3.96 | N.P. | 4.3 \u00b1 2.4"], ["MPO", "protein", "MPO-04", "4376.0 pM", -8.359, "non_intrinsic", "flow_cytometry", null, "37277648", "MPO-04 ... 4,376"], ["melamine", "protein", "Apt M", "4.4000000000000005e-09 M", -8.357, "intrinsic", null, null, "37343019", "dissociation constant K d = 4.4 nM"], ["RAGE", "protein", "RAGE-aptamer (clone #2)", "4.44 nM", -8.353, "intrinsic", "QCM", null, "28385802", "#2RAGE-aptamer | tcTgTTcAggTTggTAcggTggAAggTgTgATTcAcgAgg | 4.44\u00b10.56"], ["Thyroglobulin", "protein", "Seq.T-2", "4.51 nM", -8.346, "intrinsic", null, null, "33303143", "kon = 3.2 \u00d7 10 5  M 1 s 1 , koff = 1.44 \u00d7 10 3 s 1 , Kd = 4.51 nM"], ["Carcinoembryonic antigen", "protein", "P-ATG", "4.62 nM", -8.335, "intrinsic", null, null, "35517255", "The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively."], ["Hemagglutinin (HA) protein of AIV H5N1 (A/Vietnam/1203/04)", "protein", "Aptamer sequence (2)", "4.65 nM", -8.333, "intrinsic", null, null, "23523887", "the KD (dissociation constants) was 4.65 nM, indicating strong binding between the HA protein and the selected aptamer."], ["VEGF165", "protein", "VEap121", "4.700000000000001e-09 M", -8.328, "intrinsic", "SPR", 293.15, "23237717", "As the calculated K d value of VEap121 was 4.7 nM"], ["Oxytetracycline", "protein", "OTC3", "4.7 nM", -8.328, "intrinsic", null, null, "24011458", "The lowest K d value (4.7 nM) was obtained with the aptamer OTC3."], ["SARS-CoV-2 spike RBD", "protein", "Aptx2-L", "4.900000000000001e-09 M", -8.31, "avidity_multivalent", "flow_cytometry", 298.15, "41498844", "The Aptx2-L variant showed superior affinity with a dissociation constant ( K d) of 4.9 nM"], ["HFIXa", "protein", "Seq 11", "4.93 nM", -8.307, "intrinsic", "ITC", 298.15, "38776649", "Seq 11- | 7.4 | 0.983 | 203 \u00b1 | 4.93 | 130.6 | 279 | 47.42"], ["Myoglobin", "protein", "Myo40-7-27", "4.93e-09 M", -8.307, "intrinsic", null, null, "24914856", "The aptamer with the highest a ffi nity ( K d = 4.93 nM) was then used for the fabrication of a label-free supersandwich electrochemical biosensor for Myo detection"], ["porcine thrombin", "protein", "RNAR9D-14T", "5.0 nM", -8.301, "non_intrinsic", "filter_binding", null, "22385910", "RNAR9D-14T binds to porcine thrombin (apparent K d=5 nM)"], ["human \u03b1-Thrombin", "protein", "B2", "5.0 nM", -8.301, "intrinsic", null, null, "31129134", "for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)"], ["transferrin receptor 1", "protein", "JBA8.1", "5.5 nM", -8.26, "non_intrinsic", "flow_cytometry", null, "35875870", "JBA8.1 has an apparent binding affinity (K D ) of 5.5 \u00b1 1.2 nM"], ["CD8a", "protein", "A8", "5.59 nM", -8.253, "intrinsic", "BLI", 298.15, "31209354", "the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 \u00b1 0.2,  14.7 \u00b1 0.1  and  5.59 \u00b1 0.11  nM, respectively"], ["sST2", "protein", "sS9_P", "5.6 nM", -8.252, "intrinsic", null, null, "37992929", "in case of sS9, parent aptamer has outperformed its truncated counterpart in terms of affinity as it has shown higher affinity (Kd ~5.6 nM)."], ["RAGE", "protein", "RAGE-aptamer (clone #1)", "5.68 nM", -8.246, "intrinsic", "QCM", null, "28385802", "#1RAGE-aptamer | ccTgATATggTgTcAccgccgccTTAgTATTggTgTcTAc | 5.68\u00b11.10"], ["HIV-1 Rev", "protein", "RBA-14", "5.9 nM", -8.229, "intrinsic", null, null, "30017564", "RBA-14 (Figure S2A) binds to Rev with high affinity (K d = 5.9 nM) (Table S1 and Figure 2A)."], ["human \u03b1-thrombin", "protein", "Bock", "5.96 nM", -8.225, "intrinsic", "BSI", 283.15, "22032342", "Bock - thrombin | 1.4 - 6.2 nM 19 | 5.96 ( 0.57 nM"], ["biliverdin", "protein", "Bvd4", "6.000000000000001e-09 M", -8.222, "intrinsic", null, null, "40669049", "For the biliverdin selection, the tightest affinity aptamer has a dissociation costant ( K d ) value of 6 nM determined using isothermal titration calorimetry (ITC)"], ["Mouse thrombin", "protein", "Pse08-29", "6.3 nM", -8.201, "non_intrinsic", "SPR", null, "37621412", "Pse(08 - 29) | 6.72 10^5 | 4.26 10^-3 | 6.3"], ["human \u03b1-Thrombin", "protein", "A2", "6.3 nM", -8.201, "intrinsic", null, null, "31129134", "for SCORE (b-nd analysis) the best are A2 (6.3 nM)"], ["CD64", "protein", "lw-27", "6.676 nM", -8.175, "non_intrinsic", "flow_cytometry", 310.15, "42152987", "Kd values of aptamers lw-1, lw-9, lw-27 are 12.76 nM, 14.03 nM, and 6.676 nM respectively"], ["Lipopolysaccharide from Klebsiella pneumoniae ATCC 15380", "protein", "aptamer seq. 5", "6.68e-09 M", -8.175, "intrinsic", "DPV", null, "41323700", "The binding affinity of aptamer seq. 5 was 6.68 nM (Fig. 9C)."], ["Mouse thrombin", "protein", "Lin08-08", "6.7 nM", -8.174, "non_intrinsic", "SPR", null, "37621412", "Lin(08-08) | 6.41 10^5 | 4.30 10^-3 | 6.7"], ["human \u03b2-defensin 2", "protein", "A ad1", "6.8 nM", -8.167, "intrinsic", null, null, "32067984", "As a result, A ad1 was found to bind strongly, with a K d of 6.8 nM (Fig. 2)."], ["transferrin receptor 1", "protein", "JBA8.26", "6.87 nM", -8.163, "intrinsic", "BLI", null, "35875870", "Using BLI, JBA8.26 was found to bind immobilized TfR1 with a K D of 6.87 \u00b1 0.04 nM"], ["human \u03b1-Thrombin", "protein", "A3", "6.9 nM", -8.161, "intrinsic", null, null, "31129134", "for SCORE (b-nd analysis) the best are A2 (6.3 nM) and A3 (6.9 nM)"], ["Carcinoembryonic antigen", "protein", "P", "6.95 nM", -8.158, "intrinsic", null, null, "35517255", "The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively."], ["Salmonella enteritidis", "protein", "SENT-9", "7.000000000000001e-09 M", -8.155, "apparent_cellular", null, null, "22971146", "It was observed that the aptamer pool collected at the seventh round of selection had the highest binding a ffi nity to the bacteria ( K D = 7 nM)."], ["thrombin", "protein", "HD1", "7.1e-09 M", -8.149, "intrinsic", "SPR", null, "18826387", "HD1 | Thrombin | K D ( M) | 7.1 \u00b7 10 ) 9"], ["PTK7", "protein", "4AsF", "7.2 nM", -8.143, "intrinsic", "SPR", 310.15, "41065179", "4AsF, which exhibited a 10-fold reduction compared to 4APS (0.77 vs 7.20 nM)"], ["VEGF165", "protein", "cot-pega", "7.33 nM", -8.135, "intrinsic", null, null, "26956592", "The K D of cot-pega for VEGF was 7.33 nM (Fig. 1b)"], ["Carcinoembryonic antigen", "protein", "P-GTG", "7.33 nM", -8.135, "intrinsic", null, null, "35517255", "The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively."], ["sLe X -BSA", "glycan/conjugate", "Clone 4", "7.4e-09 M", -8.131, "intrinsic", "SPR", null, "11178986", "Clone 4 | 4.1 3 10 5 | 3.1 3 10 2 3 | 1.3 3 10 8 | 7.4 3 10 2 9"], ["human \u03b1-Thrombin", "protein", "B3", "7.6 nM", -8.119, "intrinsic", null, null, "31129134", "for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)"], ["Surface Antigen 1", "protein", "SOK16", "7.6 nM", -8.119, "intrinsic", null, null, "40288708", "SOK16 (7.6 nM, R 2 = 0.8704)"], ["murine OX40", "protein", "9.8", "8.0 nM", -8.097, "intrinsic", "filter_binding", null, "18635004", "Aptamer 9.8 was chosen for further study, since it had the highest affinity for the OX40 fusion protein."], ["Cu2+", "protein", "Co-1", "8e-09 M", -8.097, "intrinsic", null, null, "40656531", "The corresponding true K d values were ... 8 nM for Cu 2+"], ["human \u03b1-Thrombin", "protein", "A3", "8.0 nM", -8.097, "intrinsic", null, null, "31129134", "For BLI it was found that aptamer A3 (8 nM and 25.5 nM) is the best binder"], ["EsxG", "protein", "G43", "8.04 nM", -8.095, "intrinsic", null, null, "24813997", "The dissociation constants of the G43 and G78 aptamers were 8.04 \u00b1 1.90 and 78.85 \u00b1 9.40 nM, respectively."], ["NP", "protein", "NP-C04", "8.1e-09 M", -8.092, "intrinsic", "fluorescence", null, "30740973", "the K d values of NP-D01, NP-C04, and NP-D02 were 76..1 \u00b1 10.9, 8.1 \u00b1 2.4, and 41.3 \u00b1 9.5 nM, respectively."], ["digoxin", "protein", "D1", "8.2e-09 M", -8.086, "intrinsic", null, null, "23021809", "Binding studies of fluorescein-labeled truncated (without primer binding region) D1 and D2 and full length D1 anti-digoxin aptamers were performed and their corresponding dissociation constants values were 8.2 \u00d7 10 -9 , 44.0 \u00d7 10 -9 and 17.8 \u00d7 10 -9 M, respectively."], ["EN2", "protein", "EBA", "8.26 nM", -8.083, "intrinsic", null, null, "35798816", "EBA had K d =  8.26 nM (R 2 =  0.971)"], ["human thrombin", "protein", "Azo-1", "8.3 nM", -8.081, "intrinsic", null, null, "33039563", "The K d values of Azo-1 binding to human thrombin were calculated to be around 3.1 and 8.3 nM before and after irradiation, respectively. However, the reproducibility of K d value measurements is poor (n = 3; S.D. = 2.2 and 5.1 nM, respectively)."], ["human \u03b2-defensin 2", "protein", "A ad1-3", "8.4 nM", -8.076, "intrinsic", null, null, "32067984", "In contrast, a clone with a 5 \u02b9 terminal truncation (A ad1 -3 , 69mer, Fig. 4a) could bind to HBD-2 with roughly the same strength as the original sequence ( K d = 8.4 nM, Fig. 4c)."], ["Okadaic Acid", "protein", "OA-LC2-TF", "8.735 nM", -8.059, "intrinsic", "BLI", null, "36322695", "The terminal-fixed OA-LC2 (OA-LC2-TF) exhibited a K d of 8.735 \u00b1 0.606 nM"], ["MPO", "protein", "MPO-25", "8778.0 pM", -8.057, "non_intrinsic", "flow_cytometry", null, "37277648", "MPO-25 ... K d : 8,778 pM"], ["human \u03b1-thrombin", "protein", "5'-TMR-T25-Apt15", "8.8 nM", -8.056, "non_intrinsic", "CE-LIF", 298.15, "28763192", "The apparent K d values of T25-Apt15-3 \u2032 -TMR and 5 \u2032 -TMR-T25-Apt15 were estimated as 228 nM and 8.8 nM, respectively"], ["MPT64", "protein", "aptamer sequence (17)", "8.92 nM", -8.05, "intrinsic", null, null, "28454652", "KD (dissociation equilibrium constant) was 8.92 nM"], ["Streptococcus pyogenes M-type mixture", "protein", "20A24P", "9.000000000000001e-09 M", -8.046, "apparent_cellular", "flow_cytometry", null, "21504182", "Two aptamers, 20A24P and 15A3P (with estimated binding dissociation constants of 9 and 10 nM, respectively)"], ["TAR RNA", "protein", "TAR RNA aptamer (best binding)", "9.000000000000001e-09 M", -8.046, "intrinsic", null, null, "39167715", "A Biolayer Interferometry (BLI) experiment revealed that TAR RNA aptamers with the best binding affinity exhibited the dissociation constant ( K D) at 9 nM"], ["HBeAg", "protein", "EAg2", "9.2e-09 M", -8.036, "intrinsic", "affinity_real_time_qPCR", null, "32250595", "A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1, 9.2 nM for EAg2"], ["human \u03b1-Thrombin", "protein", "B1", "9.2 nM", -8.036, "intrinsic", null, null, "31129134", "For SCORE (Anabel analysis) the best is B1 (9.2 nM)"], ["CD19", "protein", "WB15/15.CD19.1_2S", "9.5 nM", -8.022, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB15/15.CD19.1_2S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 2.64 | 356 \u00b1 534 | 9.5 \u00b1 5.0"], ["HBeAg", "protein", "EAg1", "9.5e-09 M", -8.022, "intrinsic", "affinity_real_time_qPCR", null, "32250595", "A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1"], ["SP6 RNA polymerase", "protein", "S05", "9.5 nM", -8.022, "intrinsic", null, null, "22426482", "The dissociation constant and 50% inhibitory concentration of the aptamer were estimated 9.5 nM and 24.8 nM, respectively."], ["PDGFR \u03b2", "protein", "Gint4.T", "9.6 nM", -8.018, "intrinsic", "filter_binding", null, "24566984", "This aptamer is able to specifically bind to the human PDGFR \u03b2 ectodomain (Kd: 9.6 nM)"], ["thrombin", "protein", "3G", "9.8 nM", -8.009, "intrinsic", "MST", null, "33614235", "3G | 52.9 | 9.8 \u00b1 0.6 | 3.34"], ["\u03b1-thrombin", "protein", "TBA-iT7", "9.9 nM", -8.004, "non_intrinsic", "SPR", 298.15, "30735210", "TBA-iT7 | 9.9"], ["sLe X -BSA", "glycan/conjugate", "Clone 9", "1e-08 M", -8.0, "intrinsic", "SPR", null, "11178986", "Clone 9 | 3.5 3 10 5 | 3.1 3 10 2 3 | 9.5 3 10 7 | 1.0 3 10 2 8"], ["prothrombin", "protein", "RNAR9D-14T", "10.0 nM", -8.0, "intrinsic", "filter_binding", 310.15, "22385910", "Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM)"], ["hOX40", "protein", "11F11", "10.0 nM", -8.0, "intrinsic", "filter_binding", 310.15, "23113766", "11F11 | 8 | 10"], ["Streptococcus pyogenes M-type mixture", "protein", "15A3P", "1e-08 M", -8.0, "apparent_cellular", "flow_cytometry", null, "21504182", "Two aptamers, 20A24P and 15A3P (with estimated binding dissociation constants of 9 and 10 nM, respectively)"], ["streptavidin", "protein", "S8", "1e-08 M", -8.0, "intrinsic", null, null, "30520292", "At pH 7.4, we determined that S8 has a K d of 10 nM"], ["bevacizumab", "protein", "A14#1", "10.0 nM", -8.0, "intrinsic", null, null, "35114463", "One of the three mutants, A14#1_GC2, showed higher affinity than A14#1 ( K D = 10 nM, Supplementary Fig. S3a)."], ["MPO", "protein", "MPO-08", "10050.0 pM", -7.998, "non_intrinsic", "flow_cytometry", null, "37277648", "MPO-08 ... 10,050"], ["Neuron specific enolase", "protein", "P-4A29C", "10.13 nM", -7.994, "intrinsic", null, null, "38091739", "The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively."], ["trastuzumab", "protein", "CH1S-3", "1.0300000000000001e-08 M", -7.987, "intrinsic", "MST", 298.15, "32516525", "a ffi nity with a K d value of aptamer CH1S-3 of 10.3 nM"], ["Sc3+", "protein", "Sc-1", "1.0300000000000001e-08 M", -7.987, "intrinsic", "fluorescence", null, "39743479", "an apparent K d value of 10.3 nM was obtained"], ["CD8", "protein", "CD8AP17", "10.59 nM", -7.975, "non_intrinsic", "flow_cytometry", 277.15, "23791505", "Kd=10.59 nM"], ["thrombin", "protein", "3Leu", "10.9 nM", -7.963, "intrinsic", "MST", null, "33614235", "3Leu | 54.3 | 10.9 \u00b1 0.2 | 4.15"], ["transferrin receptor 1", "protein", "tJBA8.1", "10.9 nM", -7.963, "non_intrinsic", "flow_cytometry", null, "35875870", "versus that of 10.9 \u00b1 2.4 nM for tJBA8.1"], ["CD19", "protein", "WB15/15.CD19.1_1S", "11.0 nM", -7.959, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB15/15.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 125 \u00b1 68 | 11 \u00b1 6.1"], ["17 \u03b2 -Estradiol", "protein", "22-mer aptamer", "1.1000000000000001e-08 M", -7.959, "intrinsic", null, null, "25803717", "new 35-mer and 22-mer aptamers were generated with K D ' s of 14 and 11 nM"], ["PLN 1-32", "protein", "RNA-Apt30", "11.0 nM", -7.959, "intrinsic", null, null, "25240642", "Such binding was dependent on the concentration of aptamer, with a dissociation constant ( K d) of 11 nM (Fig. 2A)."], ["25-HydroxyvitaminD3", "protein", "VDBA14", "11.0 nM", -7.959, "intrinsic", null, null, "27520502", "the dissociation constants (Kd) of the VDBA14 was estimated to be 11 nM based on a non-linear regression method."], ["\u03b2-conglutin", "protein", "unmodified \u03b2-CBA II aptamer", "11.1 nM", -7.955, "intrinsic", null, null, "36354481", "with a similar KD of 11.1 nM and 18.5 nM obtained for the unmodified and modified aptamer, respectively."], ["CD8", "protein", "CD8AP17", "11.23 nM", -7.95, "non_intrinsic", "flow_cytometry", 277.15, "23791505", "The binding affinity of CD8AP17 to Sup-T1 cells ( K d 5 11.23 nM)"], ["MPO", "protein", "MPO-06", "11223.0 pM", -7.95, "non_intrinsic", "flow_cytometry", null, "37277648", "MPO-06 ... 11,223"], ["thrombin-HRP", "protein", "TBA", "1.13e-08 M", -7.947, "intrinsic", "SPR", null, "16053288", "thrombin-HRP | 6.7 10 4 | 7.6 10 - 4 | 8.7 10 7 | 1.13 10 - 8"], ["Immunoglobulin E", "protein", "IgE37-T10-FAM (4-bp truncated)", "11.4 nM", -7.943, "intrinsic", null, null, "32498825", "When 4-base pairs and 5-base pairs were truncated from the stem, the K ds of the aptamers increased to 11.4 nM and 90.5 nM, respectively."], ["\u03b1-thrombin", "protein", "TBA-iT9", "11.5 nM", -7.939, "non_intrinsic", "SPR", 298.15, "30735210", "TBA-iT9 | 11.5"], ["Thyroid-Stimulating Hormone Receptor (TSHR) 6X His tag", "protein", "ZMXLY-2a", "11.5 nM", -7.939, "non_intrinsic", "flow_cytometry", null, "40588369", "As determined by flow cytometry, the K d of ZMXLY-2a was 11.5 \u00b1 9.3 nM (Figure 2G)"], ["thrombin", "protein", "3L", "11.6 nM", -7.936, "intrinsic", "MST", null, "33614235", "3L | 51.5 | 11.6 \u00b1 0.5 | 5.28"], ["CTLA-4", "protein", "aptCTLA-4", "11.84 nM", -7.927, "intrinsic", null, null, "28918052", "dissociation constant (Kd) being 11.84 nM"], ["Salmonella typhimurium", "protein", "NTri-triApt", "1.1890000000000001e-08 M", -7.925, "avidity_multivalent", "ELISA", 310.15, "37893744", "the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively"], ["LPS", "protein", "NH2-5'-CTT CTG CCC GCC TCC TTC CTAG CCG GAT CGC GCT GGC CAG ATG ATA TAA AGG GTC AGC CCC CCA -GGA GAC GAG ATA GGC GGA CAC T-3'", "11.9 nM", -7.924, "intrinsic", null, null, "22182428", "Amine-terminated aptamer exhibiting high affinity ( K d = 11.9 nM) to LPS"], ["streptavidin", "protein", "SA23", "12.0 nM", -7.921, "intrinsic", null, null, "23312325", "The respective Kd values for streptavidin binding in the monofunctional aptamer ... were 12 nM"], ["coat protein of grouper nervous necrosis virus", "protein", "A5", "12.0 nM", -7.921, "intrinsic", null, null, "26892075", "calculated binding affinities ( Kd ) of 12 nM for A5"], ["bevacizumab", "protein", "A14#1", "12.0 nM", -7.921, "intrinsic", null, null, "35114463", "A14#1 showed binding capacity with K D = 12 nM."], ["thrombin", "protein", "Uyne A - AUyne", "12.16 nM", -7.915, "intrinsic", "BLI", null, "37531184", "U yne A - AUyne | 12.16 \u00b1 0.02"], ["U87MG GBM with IDH1 htz mutation", "protein", "Gli-55", "1.22e-08 M", -7.914, "apparent_cellular", "flow_cytometry", 298.15, "39682297", "The apparent dissociation constant measured for U87MG GBM with the IDH1 htz mutation ( Kd ) of Gli-55 is 12.2 nM"], ["\u03b1-thrombin", "protein", "TBA-G8-iT8", "12.4 nM", -7.907, "non_intrinsic", "SPR", 298.15, "30735210", "TBA-G8-iT8 | 12.4"], ["RAGE", "protein", "RAGE-aptamer (clone #3)", "12.44 nM", -7.905, "intrinsic", "QCM", null, "28385802", "#3RAGE-aptamer | tTccAcTgAgTgccgcggAcTgTTgTTgggAggTggTgTg | 12.44\u00b11.52"], ["CD64", "protein", "lw-1", "12.76 nM", -7.894, "non_intrinsic", "flow_cytometry", 310.15, "42152987", "Kd values of aptamers lw-1, lw-9, lw-27 are 12.76 nM, 14.03 nM, and 6.676 nM respectively"], ["CD8", "protein", "CD8AP17s", "12.86 nM", -7.891, "non_intrinsic", "flow_cytometry", 277.15, "23791505", "Kd=12.86 nM"], ["HIV-1 Rev", "protein", "Stem IIB", "12.9 nM", -7.889, "intrinsic", null, null, "30017564", "The 35-nt hairpin with the Stem IIB sequence (Figure S2B) binds to Rev with a similar affinity (K d  = 12.9 nM) (Table S1 and Figure 2B)."], ["human \u03b1-thrombin", "protein", "5'-TMR-Apt15-T18", "13.0 nM", -7.886, "non_intrinsic", "CE-LIF", 298.15, "28763192", "the apparent dissociation constants ( K d) of TMR-labeled Apt15 having polyT tail with length ranging from 18 to 35 T were estimated and are summarized in Figure 1C: 13 nM for 5 \u2032 -TMR-Apt15-T18"], ["sST2", "protein", "sS9_P", "13.0 nM", -7.886, "intrinsic", null, null, "37992929", "The best performing aptamer candidate sS9_P (80mer) has shown affinity in low nanomolar range (~5.6 nM in ALISA and ~13 nM in ITC)"], ["PlanarAu", "protein", "1N truncated", "1.304e-08 M", -7.885, "intrinsic", "QCM", null, "30189130", "1N truncated (Kd = 13.04 nM)"], ["Bisphenol A", "protein", "38-mer BPA aptamer", "13.17 nM", -7.88, "intrinsic", null, null, "32113141", "The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM"], ["Staphylococcal enterotoxin A", "protein", "Apt5", "13.36 nM", -7.874, "intrinsic", null, null, "38762575", "The aptamer with the highest affinity showed an experimental dissociation constant (K D) of 13.36 \u00b1 18.62 nM."], ["CD25", "protein", "Apt51", "13.4 nM", -7.873, "intrinsic", null, null, "29055191", "Using non-linear regression analysis, the Kd of Apt51 and Apt70 aptamers were found to be 13.4 nM and 138.6 nM, respectively"], ["Staphylococcal enterotoxin D", "protein", "Aptamer 1", "13.43 nM", -7.872, "intrinsic", null, null, "39894103", "The KD of the aptamer for SED was determined using SPR and ELASA. The KD values were calculated as 4.4 \u00b1 2.26 nM and 13.43 nM, respectively."], ["SARS-CoV-2 RBD", "protein", "CoV2-RBD-4", "1.3600000000000001e-08 M", -7.866, "intrinsic", "flow_cytometry", null, "32551560", "the dissociation constant values ( K d) of the ... CoV2-RBD-4 aptamer ... were ... 13.6 nM"], ["U87MG GBM with IDH1 htz mutation", "protein", "Gli-35", "1.3600000000000001e-08 M", -7.866, "apparent_cellular", "flow_cytometry", 298.15, "39682297", "while for Gli-35, it is 13.6 nM."], ["thrombin", "protein", "Uyne A - Uyne Uyne", "13.96 nM", -7.855, "intrinsic", "BLI", null, "37531184", "U yne A - U yne U yne | 13.96 \u00b1 0.03"], ["Le A", "protein", "Clone 5", "1.4e-08 M", -7.854, "intrinsic", "SPR", null, "11178986", "Le A | 7.3 3 10 2 | 1.0 3 10 2 5 | 7.2 3 10 7 | 1.4 3 10 2 8"], ["IL4R\u03b1", "protein", "cl.42", "14.0 nM", -7.854, "intrinsic", "FACS", null, "22282665", "The calculated K d (14 nM, Fig. 2D) was within the range of anti -IL4R a antibodies"], ["CD20", "protein", "WB1/1.CD20.1_3S", "14.0 nM", -7.854, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB1/1.CD20.1_3S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 3.96 | 15 \u00b1 7.4 | 14 \u00b1 8.3"], ["17 \u03b2 -Estradiol", "protein", "35-mer aptamer", "1.4000000000000001e-08 M", -7.854, "intrinsic", null, null, "25803717", "new 35-mer and 22-mer aptamers were generated with K D ' s of 14 and 11 nM"], ["Oxytetracycline", "protein", "OTC16", "14.0 nM", -7.854, "intrinsic", null, null, "24011458", "The other 3 aptamers, that is, OTC6, OTC9, and OTC16, showed higher K d values, that is, 9.5, 8.0, and 14.0 nM, respectively"], ["CD64", "protein", "lw-9", "14.03 nM", -7.853, "non_intrinsic", "flow_cytometry", 310.15, "42152987", "Kd values of aptamers lw-1, lw-9, lw-27 are 12.76 nM, 14.03 nM, and 6.676 nM respectively"], ["enrofloxacin", "protein", "Apt58", "14.19 nM", -7.848, "intrinsic", null, null, "29574118", "The obtained Kd of Apt58 and Apt6, with non-linear regression analysis, were 14.19 nM and 50.77 nM, respectively."], ["Escherichia coli O157:H7", "protein", "E. coli O157:H7-specific aptamer", "1.4400000000000002e-08 M", -7.842, "apparent_cellular", "fluorescence", 298.15, "41850902", "the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM)."], ["thrombin", "protein", "3Ser", "14.6 nM", -7.836, "intrinsic", "MST", null, "33614235", "3Ser | 51.7 | 14.6 \u00b1 0.3 | 2.51"], ["CD8a", "protein", "A3", "14.7 nM", -7.833, "intrinsic", "BLI", 298.15, "31209354", "the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 \u00b1 0.2,  14.7 \u00b1 0.1  and  5.59 \u00b1 0.11  nM, respectively"], ["Neuron specific enolase", "protein", "P-4G10T", "14.82 nM", -7.829, "intrinsic", null, null, "38091739", "The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively."], ["human immunoglobulin E", "protein", "T40-AptIgE-3'-TMR", "15.0 nM", -7.824, "non_intrinsic", "CE-LIF", 298.15, "28763192", "The K d of T40-AptIgE-3 \u2032 -TMR was about 15 nM"], ["CD20", "protein", "WB1/1.CD20.1_3S", "15.0 nM", -7.824, "non_intrinsic", "flow_cytometry", 277.15, "41079126", "WB1/1.CD20.1_3S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 3.96 | 15 \u00b1 7.4 | 14 \u00b1 8.3"], ["thrombin", "protein", "TBA15-AnBtz", "1.5000000000000002e-08 M", -7.824, "intrinsic", null, null, "37857354", "apparent dissociation constant ( K d ) of 15 nM"], ["XBP1", "protein", "R6 pool", "15.0 nM", -7.824, "intrinsic", null, null, "26874109", "dissociation equilibrium constant equal to 15 nM"], ["hexahistidine peptide", "protein", "AptHis-1", "15.0 nM", -7.824, "intrinsic", null, null, "32739349", "the Kd was as low as 15 nM (Table S1)"], ["hexahistidine peptide", "protein", "AptHis-2", "15.0 nM", -7.824, "intrinsic", null, null, "32739349", "the Kd was as low as 15 nM (Table S1)"], ["hexahistidine peptide", "protein", "AptHis-3", "15.0 nM", -7.824, "intrinsic", null, null, "32739349", "the Kd was as low as 15 nM (Table S1)"], ["THY1", "protein", "XA-A9", "15.0 nM", -7.824, "intrinsic", null, null, "33242496", "The equilibrium dissociation constants, Kd, were derived from these curves and are determined as XA-A9=15 nM"], ["Dinophysistoxin", "protein", "DTX-SL1-TF", "15.45 nM", -7.811, "intrinsic", "BLI", null, "36322695", "DTX-SL1-TF showed a K d of 15.45 \u00b1 1.92 nM"], ["human \u03b1-Thrombin", "protein", "B1", "15.7 nM", -7.804, "intrinsic", null, null, "31129134", "for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)"], ["\u03b1-thrombin", "protein", "TBA-iT7", "15.9 nM", -7.799, "non_intrinsic", "SPR", 298.15, "30735210", "TBA-iT7 | 15.9"], ["N-acetyl-5-hydroxytryptamine", "protein", "MLT-A-4F", "0.016 \u03bcM", -7.796, "intrinsic", null, null, "36925277", "for NAT very low K d value was observed i.e., 0.016 \u03bcM"], ["fibrin", "protein", "FA", "16.6 nM", -7.78, "non_intrinsic", "microscale thermophoresis", null, "33395250", "Interestingly, it was determined that FA has a higher a ffi nity toward fi brin, with the K d of 16.6 nM"], ["sLe A", "glycan/conjugate", "Clone 5", "1.7e-08 M", -7.77, "intrinsic", "SPR", null, "11178986", "sLe A | 1.2 3 10 3 | 1.9 3 10 2 5 | 5.9 3 10 7 | 1.7 3 10 2 8"], ["CD19", "protein", "WB17/17.CD19.1_3S", "17.0 nM", -7.77, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB17/17.CD19.1_3S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 3.96 | 18 \u00b1 6.4 | 17 \u00b1 5.5"], ["Progesterone", "protein", "P4G13", "1.7e-08 M", -7.77, "intrinsic", null, null, "25486123", "The dissociation constant of the best aptamer, designated as P4G13, was estimated to be 17 nM by electrochemical impedance spectroscopy (EIS) as well as fl uorometric assay."], ["VEGF-165", "protein", "bivalent construct for VEGF-165 (no linker)", "1.7e-08 M", -7.77, "avidity_multivalent", null, null, "27043498", "this bivalent construct had about 28-fold higher binding affinity ( K D = 17 nM)"], ["human \u03b1-Thrombin", "protein", "A2", "17.0 nM", -7.77, "intrinsic", null, null, "31129134", "for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)"], ["hnRNP A1", "protein", "AS1411", "1.75e-08 M", -7.757, "intrinsic", "BLI", null, "38784467", "for AS1411, the K d value was 17.5 nM (Fig. 6B)"], ["human \u03b1-Thrombin", "protein", "B3", "17.6 nM", -7.754, "intrinsic", null, null, "31129134", "for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)"], ["GTX1/4", "protein", "GO18-T-d", "17.7 nM", -7.752, "intrinsic", null, null, "26802576", "we truncated GTX1/4 aptamer and obtained the aptamer core sequence with a higher K d of 17.7 nM."], ["digoxin", "protein", "D1", "1.78e-08 M", -7.75, "intrinsic", null, null, "23021809", "Truncated (without primer binding region) D1, truncated D2 and full length D1 were bound to digoxin-BSA with Kd value of 8.2 \u00d7 10 -9 , 44 \u00d7 10 -9 and 17.8 \u00d7 10 -9 M, respectively"], ["CD19", "protein", "WB17/17.CD19.1_3S", "18.0 nM", -7.745, "non_intrinsic", "flow_cytometry", 277.15, "41079126", "WB17/17.CD19.1_3S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 3.96 | 18 \u00b1 6.4 | 17 \u00b1 5.5"], ["CD8a", "protein", "A1", "18.3 nM", -7.738, "non_intrinsic", "flow_cytometry", null, "31209354", "the A1, A3 and A8 aptamers have apparent K D values of 18.3 \u00b1 4.6, 1.9 \u00b1 0.8 and 2.4 \u00b1 0.9  nM, respectively"], ["\u03b2-conglutin", "protein", "biotinylated dUTPs aptamer", "18.5 nM", -7.733, "intrinsic", null, null, "36354481", "with a similar KD of 11.1 nM and 18.5 nM obtained for the unmodified and modified aptamer, respectively."], ["Escherichia coli O157:H7", "protein", "E. coli O157:H7-specific aptamer", "1.92e-08 M", -7.717, "apparent_cellular", "fluorescence", 298.15, "41850902", "the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM)."], ["LDL-R", "protein", "RNV-L7", "19.6 nM", -7.708, "intrinsic", null, null, "31841991", "RNV-L7 aptamer showed speci fi c binding to its LDL-R target with a binding af fi nity value of 19.6 nM."], ["CD19", "protein", "WB17/17.CD19.1_4S", "20.0 nM", -7.699, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB17/17.CD19.1_4S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 5.28 | 21 \u00b1 13 | 20 \u00b1 12"], ["hMMP-9", "protein", "F3Bomf", "2e-08 M", -7.699, "intrinsic", "SPR", 296.15, "23043415", "The K d was taken as the concentration leading to half saturation, i.e., about 20 nM."], ["hMMP-9", "protein", "F3", "2e-08 M", -7.699, "intrinsic", null, null, "23043415", "exhibits a strong a ffi nity for hMMP-9 ( K d = 20 nM)"], ["xanthylacrylamide", "protein", "XAA-1", "2e-08 M", -7.699, "intrinsic", null, null, "40261307", "The true K d of aptamer XAA-1 was calculated to be 20 nM after accounting for the competitive effect of the quencher-labeled strand"], ["CD8a", "protein", "A1", "20.1 nM", -7.697, "intrinsic", "BLI", 298.15, "31209354", "the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 \u00b1 0.2,  14.7 \u00b1 0.1  and  5.59 \u00b1 0.11  nM, respectively"], ["thrombin", "protein", "TBA", "20.2 nM", -7.695, "intrinsic", "MST", null, "33614235", "TBA | 50.7 | 20.2 \u00b1 1.3 | 4.81"], ["thrombin", "protein", "12G", "20.7 nM", -7.684, "intrinsic", "MST", null, "33614235", "12G | 53.4 | 20.7 \u00b1 2.8 | 2.88"], ["hexahistidine peptide", "protein", "AptHis-C", "20.8 nM", -7.682, "intrinsic", null, null, "32739349", "its dissociation constant was as low as 20.8 nM"], ["CD19", "protein", "WB17/17.CD19.1_4S", "21.0 nM", -7.678, "non_intrinsic", "flow_cytometry", 277.15, "41079126", "WB17/17.CD19.1_4S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 5.28 | 21 \u00b1 13 | 20 \u00b1 12"], ["hnRNP A1", "protein", "TBA", "2.1100000000000004e-08 M", -7.676, "intrinsic", "BLI", null, "38784467", "for TBA, the K d value was 21.1 nM (Fig. 6A)"], ["saxitoxin", "protein", "45e", "21.2 nM", -7.674, "intrinsic", null, null, "35324725", "aptamer 45e with a K d value of 21.2 nM"], ["thrombin", "protein", "3Ala", "21.4 nM", -7.67, "intrinsic", "MST", null, "33614235", "3Ala | 50.9 | 21.4 \u00b1 2.8 | 3.67"], ["SARS-CoV-2 spike RBD", "protein", "Aptx2-S", "2.17e-08 M", -7.664, "avidity_multivalent", "flow_cytometry", 298.15, "41498844", "compared to 21.7 nM for Aptx2-S"], ["Dinophysistoxin", "protein", "DTX-SL1", "21.75 nM", -7.663, "intrinsic", "BLI", null, "36322695", "DTX-SL1 showed the lowest K d at 21.75 \u00b1 1.42 nM"], ["CD117", "protein", "Apta02", "21.8 nM", -7.662, "intrinsic", "BLI", 298.15, "40487293", "Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 \u00b5 m, respectively ( Figure 2 a,b)."], ["SARS-CoV-2 spike trimer", "protein", "S14", "21.8 nM", -7.662, "intrinsic", null, null, "34188971", "The aptamer S14 evinced 3-fold higher affinity (KD = 21.8 nM) then S1 (KD = 68.9 nM)."], ["GTX1/4", "protein", "GO18-T-d", "21.9 nM", -7.66, "intrinsic", null, null, "26802576", "Therefore, we further removed inactive nucleotides from GO18-T-a and obtained the core aptamer sequence GO18-T-d with a K d of 21.9 nM"], ["Mouse thrombin", "protein", "TBA29", "22.0 nM", -7.658, "intrinsic", "SPR", null, "37621412", "TBA29 | 2.76 10^5 | 6.07 10^-3 | 22.0"], ["thrombin", "protein", "3Phe", "22.6 nM", -7.646, "intrinsic", "MST", null, "33614235", "3Phe | 54.3 | 22.6 \u00b1 4.8 | 3.39"], ["M2-like macrophage", "protein", "A2", "22.81 nM", -7.642, "non_intrinsic", "flow_cytometry", 277.15, "32589412", "apparent dissociation constants ( K d ) of 44.12 \u00b1 8.0 and 22.81 \u00b1 5.6 nM to M0- and M2-like macrophages, respectively"], ["HBeAg", "protein", "A-9", "2.29e-08 M", -7.64, "intrinsic", "affinity_real_time_qPCR", null, "32250595", "The measured dissociation constant ( K d) is improved by 19 times \ue0d5 from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer."], ["prometryn", "protein", "P60-1", "23.0 nM", -7.638, "intrinsic", null, null, "37453395", "The Kd value of P60-1 aptamer for prometryn was approximately 23 nM"], ["beta-conglutin", "protein", "11-mer", "2.3300000000000003e-08 M", -7.633, "intrinsic", "BLI", 303.15, "33498970", "A 2:1 heterogenous model was used to fit the data and calculate the binding affinities resulting in two different KD values of 6.95 and 23.30 nM."], ["Neuron specific enolase", "protein", "P", "23.83 nM", -7.623, "intrinsic", null, null, "38091739", "Each of them exhibited higher affinity to NSE than the parent aptamer ( K d = 23.83 nM)."], ["Le X", "protein", "Clone 5", "2.4e-08 M", -7.62, "intrinsic", "SPR", null, "11178986", "Le X | 6.7 3 10 2 | 1.6 3 10 2 5 | 4.1 3 10 7 | 2.4 3 10 2 8"], ["CD19", "protein", "WB17.CD19", "24.0 nM", -7.62, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB17.CD19 | 5'-AGAGACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGTGGCTTCTT-3' | - | N.P. | 24 \u00b1 4.1"], ["melamine", "protein", "Mel36-1", "2.4000000000000003e-08 M", -7.62, "non_intrinsic", null, 298.15, "42261635", "Mel36-1 has the most sensitive response with an apparent K d of 24 nM"], ["Cry j 2", "protein", "CJ2-06", "24.0 nM", -7.62, "intrinsic", null, null, "25083924", "Scatchard analysis based on ELONA showed that BioCJ206 exhibited a high af fi nity for Cry j 2 with a dissociation constant of 24 nM"], ["prostate-cancer-derived small extracellular vesicles", "cell/EV", "seq25", "24.02 nM", -7.619, "non_intrinsic", "SPR", null, "41646885", "The affinity of seq25 for positive selection was significantly higher than that of the other aptamers, with a KD of 24.02 nM"], ["NMP22", "protein", "NT2a", "2.4260000000000003e-08 M", -7.615, "intrinsic", "MST", null, "42173503", "The K d values were also determined using MicroScale Thermophoresis (MST), and the K d values of NT2a and NT4a were determined to be 24.26 \u00b1 10.47 and 77.29 \u00b1 25.78 nM (Figures 2d and S3)."], ["MPO", "protein", "MPO-34", "24910.0 pM", -7.604, "non_intrinsic", "flow_cytometry", null, "37277648", "MPO-34 ... K d : 24,910 pM"], ["murine OX40", "protein", "11.2", "25.0 nM", -7.602, "intrinsic", "filter_binding", null, "18635004", "11.2 | AUACCAGGAUCACAUCCUGAGGAACCCCGGCUCCCAACCU | 25 | 4"], ["murine OX40", "protein", "11.4", "25.0 nM", -7.602, "intrinsic", "filter_binding", null, "18635004", "11.4 | CUUUAAUCCUCGCACUCAGCGCGCAUCACCCUUGACAUCA | 25 | 5"], ["murine OX40", "protein", "9.3", "25.0 nM", -7.602, "intrinsic", "filter_binding", null, "18635004", "9.3 | CAAACCAGCUAUUUCCUGAGGUACCCCGGCUCUCCAUGG | 25 | 4"], ["CD20", "protein", "WB1/1.CD20.1_4S", "25.0 nM", -7.602, "non_intrinsic", "flow_cytometry", 277.15, "41079126", "WB1/1.CD20.1_4S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 5.28 | 25 \u00b1 12 | 65 \u00b1 38"], ["CD19", "protein", "WB15/17.CD19.1_3S", "25.0 nM", -7.602, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB15/17.CD19.1_3S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 3.96 | N.P. | 25 \u00b1 7.1"], ["Salmonella typhimurium", "protein", "STYP-3", "2.5000000000000002e-08 M", -7.602, "apparent_cellular", null, null, "23075417", "It was observed that the aptamer pool collected at the seventh round of selection had the highest binding a ffi nity to the bacteria ( K D = 25 nM)."], ["S-adenosylmethionine", "protein", "Bs SAM-I riboswitch", "2.5000000000000002e-08 M", -7.602, "intrinsic", null, null, "23343213", "Both \u03bc MSA values agree well with results from the in-line probing assays performed using identical buffer conditions: 25 nM K d "], ["16mer peptide from collagen XI alpha 1 chain", "protein", "D1", "25.0 nM", -7.602, "intrinsic", null, null, "34815029", "The K d values were identical (about 25 nM)"], ["16mer peptide from collagen XI alpha 1 chain", "protein", "C1", "25.0 nM", -7.602, "intrinsic", null, null, "34815029", "The K d values were identical (about 25 nM)"], ["transferrin receptor 1", "protein", "tJBA8.1", "25.11 nM", -7.6, "intrinsic", "BLI", null, "35875870", "tJBA8.1 bound the TfR1 protein with a K D value of 25.11 \u00b1 0.19 nM"], ["rmCD3 d \u03b5", "protein", "CD3_Apt1 dimer", "25.2 nM", -7.599, "non_intrinsic", "BLI", 298.15, "38745854", "The affinity of the dimeric aptamer was determined by OCTET and was 25.2 nM for Apt1 dimer"], ["Sterigmatocystin", "protein", "H Seq02", "2.53e-08 M", -7.597, "intrinsic", "ITC", null, "38175632", "The final fitting curve showed a reduced chi-squared (kcal/mol) 2 of 0.871, and the K D value was 25.3 nM."], ["human \u03b1-Thrombin", "protein", "A3", "25.5 nM", -7.593, "intrinsic", null, null, "31129134", "For BLI it was found that aptamer A3 (8 nM and 25.5 nM) is the best binder"], ["transferrin receptor 1", "protein", "tJBA8.1", "25.6 nM", -7.592, "non_intrinsic", "flow_cytometry", null, "35875870", "compared to tJBA8.1's apparent K D of 25.6 \u00b1 13.0 nM for these cells"], ["Staphylococcal enterotoxin B", "protein", "A2", "26.0 nM", -7.585, "intrinsic", null, null, "25624325", "A2 and A11 both bound with high affinity to SEB, with dissociation constants of 26 nM and 64 nM, respectively"], ["adenosine monophosphate", "protein", "AMP aptamer", "26.0 nM", -7.585, "intrinsic", null, null, "35934372", "BHQ-2-(NH2)2 binds DNA aptamer for AMP with KD = 26 nM."], ["human \u03b1-Thrombin", "protein", "A2", "26.4 nM", -7.578, "intrinsic", null, null, "31129134", "for iRIf aptamer A2 is the best (26.4 nM)"], ["Bisphenol A", "protein", "12-mer BPA aptamer", "27.05 nM", -7.568, "intrinsic", null, null, "32113141", "The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM"], ["thrombin", "protein", "3Nic", "27.1 nM", -7.567, "intrinsic", "MST", null, "33614235", "3Nic | 52.1 | 27.1 \u00b1 4.2 | 3.69"], ["thrombin", "protein", "12L", "27.2 nM", -7.565, "intrinsic", "MST", null, "33614235", "12L | 51.0 | 27.2 \u00b1 3.0 | 4.17"], ["\u03b1-thrombin", "protein", "TBA", "27.2 nM", -7.565, "non_intrinsic", "SPR", 298.15, "30735210", "TBA | 27.2"], ["MPO", "protein", "MPO-07", "27751.0 pM", -7.557, "non_intrinsic", "flow_cytometry", null, "37277648", "MPO-07 ... 27,751"], ["thrombin", "protein", "HD22 (TA-TT)", "27.8 nM", -7.556, "intrinsic", "BLI", null, "37531184", "TA - TT | 27.80 \u00b1 0.09"], ["FGFR3 K650E", "protein", "SU-3", "2.82e-08 M", -7.55, "intrinsic", "SPR", null, "31265241", "The predicted K D was 28.2 \u00d7 10 -9 \u00b1 19.6 \u00d7 10 -9 M( n = 5) in 1 \u00d7 PBS bu ff er, using 1:1 Langmuir binding model."], ["CD71", "protein", "rvCD71apt", "28.5 nM", -7.545, "non_intrinsic", "flow_cytometry", 277.15, "36149728", "rvCD71apt binds at a high affinity to both activated CD4 + and CD8 + T cells, with apparent K D around 28.5 and 35 nM, respectively (Figure 4A,B)."], ["hOX40", "protein", "9C7T", "29.0 nM", -7.538, "intrinsic", "filter_binding", 310.15, "23113766", "observed Kd of * 29nM"], ["dT35", "protein", "DCC-SSB", "2.9e-08 M", -7.538, "intrinsic", null, null, "34085169", "The second stage was fitted to a hyperbola to give a K d value of 29 nM."], ["thrombin", "protein", "3Amide", "29.2 nM", -7.535, "intrinsic", "MST", null, "33614235", "3Amide | 52.6 | 29.2 \u00b1 0.4 | 4.17"], ["Thrombin", "protein", "aptamer 2S", "2.9400000000000002e-08 M", -7.532, "intrinsic", "SPR", null, "32268723", "The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 \u03bcM and 29.4 nM, respectively"], ["verrucarin A", "protein", "Ver1_JYP", "2.9500000000000003e-08 M", -7.53, "intrinsic", "fluorescence", null, "39404132", "The novel ssDNA aptamer exhibited a binding affinity of 29.5 nM"], ["thrombin", "protein", "3Bz", "30.0 nM", -7.523, "intrinsic", "MST", null, "33614235", "3Bz | 52.3 | 30.0 \u00b1 6.6 | 4.54"], ["L-TAR RNA", "protein", "D-6-4t", "3.0000000000000004e-08 M", -7.523, "intrinsic", null, null, "23977945", "The Kd of in vitro transcribed D-6-4t for L-TAR is 30 nM"], ["Nucleolin (NCL)", "protein", "rG4-C8 (short loop)", "30.0 nM", -7.523, "intrinsic", null, null, "31325486", "The K D values for the binding interaction between the short loop (112) rG4 and its rG4-C8 complex with NCL were 309 \u00b1 45 nM and 30 \u00b1 22 nM, respectively."], ["thrombin", "protein", "12Amide", "30.6 nM", -7.514, "intrinsic", "MST", null, "33614235", "12Amide | 51.2 | 30.6 \u00b1 6.1 | 3.97"], ["Mycobacterium tuberculosis H37Rv", "protein", "NK2", "31.0 nM", -7.509, "non_intrinsic", "flow_cytometry", null, "21643749", "| NK2    | 31 \u00b1 4 |"], ["Ciprofloxacin", "protein", "R10K6", "3.1e-08 M", -7.509, "intrinsic", null, null, "30609709", "a dissociation constant (KD) for the RNA-ligand complex of 31 nM was determined."], ["Clenbuterol", "protein", "CLB-2", "3.1e-08 M", -7.509, "intrinsic", null, null, "42204903", "The ITC of the CLB2 aptamer showed a complex pattern with a fitted K d of 31 nM (Figure S4)"], ["tetrodotoxin", "protein", "A36", "32.4 nM", -7.489, "intrinsic", null, null, "40435760", "Aptamer A36, which exhibited high binding affinity (32.4 nM) and stability ( \u0394 G = 2.58 kcal/mol), was identified as the optimal TTX aptamer."], ["PDGF-C", "protein", "\u03b1-PC", "33.0 nM", -7.481, "intrinsic", "SPR", null, "42138517", "SPR analysis demonstrated that the \u03b1 -PC aptamer bound tightly to mouse PDGF-C with a high affinity ( KD = 33 nM"], ["Thrombin", "protein", "Antithrombin aptamer", "3.3000000000000004e-08 M", -7.481, "intrinsic", null, null, "31580650", "Antithrombin aptamer with KD of 33 nM was successfully isolated by four rounds of MCP-SELEX."], ["Alpha-fetoprotein", "protein", "Group I aptamer", "33.0 nM", -7.481, "intrinsic", null, null, "22166203", "The aptamer interacted with the AFP with a K D of 33 nM."], ["\u03b1-thrombin", "protein", "TBA-iT3", "33.9 nM", -7.47, "non_intrinsic", "SPR", 298.15, "30735210", "TBA-iT3 | 33.9"], ["Alpha-fetoprotein", "protein", "Group I aptamer", "33.9 nM", -7.47, "intrinsic", null, null, "22166203", "with a K D of 33.9 nM (group I RNA)"], ["human \u03b1-Thrombin", "protein", "A3", "34.6 nM", -7.461, "intrinsic", null, null, "31129134", "For SCORE (Anabel analysis) the best is B1 (9.2 nM) and the poorest A3 (34.6 nM)"], ["paramylon", "protein", "Par-15", "3.49e-08 M", -7.457, "intrinsic", "fluorescence", null, "31809034", "The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 \u00b1 2.61, 34.90 \u00b1 5.83, 64.06 \u00b1 6.72, 123.81 \u00b1 13.41, and 249.52 \u00b1 46.39 nM, respectively."], ["HNP 1-3", "protein", "6J", "35.0 nM", -7.456, "intrinsic", "ELISA", null, "38591344", "Regression analysis (Figure 4a) yielded a K d value of 35 nM"], ["Mycobacterium tuberculosis H37Rv", "protein", "NK7", "35.0 nM", -7.456, "non_intrinsic", "flow_cytometry", null, "21643749", "| NK7    | 35 \u00b1 9 |"], ["CD71", "protein", "rvCD71apt", "35.0 nM", -7.456, "non_intrinsic", "flow_cytometry", 277.15, "36149728", "rvCD71apt binds at a high affinity to both activated CD4 + and CD8 + T cells, with apparent K D around 28.5 and 35 nM, respectively (Figure 4A,B)."], ["Progesterone", "protein", "PG13", "35.0 nM", -7.456, "intrinsic", null, null, "28237255", "The full length PG13 aptamer which showed the highest af fi nity (Kd 1\u20444 35 nM)"], ["Enrofloxacin", "protein", "ENR-Apt 6", "35.08 nM", -7.455, "intrinsic", null, null, "38540931", "Figure 4A shows the non-linear fitting curve of ENR-Apt 6, with a Kd value of 35.08 nM."], ["CD71", "protein", "rvCD71apt", "35.2 nM", -7.453, "non_intrinsic", "flow_cytometry", 277.15, "36149728", "rvCD71apt binds to the same cell line with an apparent K D of around 35.2 nM (Figure 2B)."], ["Zearalenone", "protein", "M1", "35.83 nM", -7.446, "intrinsic", null, null, "38608399", "resulting in a slightly higher Kd value of 35.83 nM"], ["Ciprofloxacin", "protein", "R10K6_V11", "3.6000000000000005e-08 M", -7.444, "intrinsic", null, null, "30609709", "The determined dissociation constant of 36 nM for V11 is similar to the original full-length aptamer R10K6 (31 nM)."], ["THY1", "protein", "XA-B216", "36.0 nM", -7.444, "intrinsic", null, null, "33242496", "The equilibrium dissociation constants, Kd, were derived from these curves and are determined as ... XA-B216=36 nM"], ["Ara h1", "protein", "CB-APT1", "3.63e-08 M", -7.44, "avidity_multivalent", "MST", 298.15, "40083221", "Among them, CBAPT1 exhibited the strongest binding to Ara h1 with a K d value of 36.3 nM in aqueous solutions."], ["Human thrombin", "protein", "TBA29", "36.9 nM", -7.433, "intrinsic", "SPR", null, "37621412", "TBA29 | 1.34 10^5 | 4.94 10^-3 | 36.9"], ["\u03b1-thrombin", "protein", "TBA-iT12", "37.0 nM", -7.432, "non_intrinsic", "SPR", 298.15, "30735210", "TBA-iT12 | 37.0"], ["Ni2+", "protein", "Co-1", "3.7e-08 M", -7.432, "intrinsic", null, null, "40656531", "The corresponding true K d values were ... 37 nM for Ni 2+"], ["human \u03b1-Thrombin", "protein", "B1", "37.0 nM", -7.432, "intrinsic", null, null, "31129134", "and the poorest B1 (37 nM)"], ["\u03b1-thrombin", "protein", "TBA-G8-iT8", "37.1 nM", -7.431, "non_intrinsic", "SPR", 298.15, "30735210", "TBA-G8-iT8 | 37.1"], ["ceftiofur", "protein", "Apt-9", "37.68 nM", -7.424, "intrinsic", null, null, "40203705", "Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were ... 37.68 nM"], ["rmCD3 d \u03b5 -Fc", "protein", "CD3_Apt5", "37.9 nM", -7.421, "intrinsic", "SPR", 298.15, "38745854", "aptamer 5 was the strongest binder (37.9 nM)"], ["Lipopolysaccharide", "protein", "B2", "38.0 nM", -7.42, "intrinsic", null, null, "22370280", "The SPR-based K d between the immobilized B2 and the LPS was found to be approximately 38 nM."], ["thrombin", "protein", "TA-AT", "38.7 nM", -7.412, "intrinsic", "BLI", null, "37531184", "TA - AT | 38.7 \u00b1 0.5"], ["methionyl-tRNA synthetase", "protein", "70mer pool", "38.8 nM", -7.411, "intrinsic", null, null, "23399565", "The dissociation constants of the selected 70 and 42mer pools to M. tuberculosis MRS were 38.8 and 51.3 nM, respectively."], ["thrombin", "protein", "LOOP", "39.0 nM", -7.409, "intrinsic", "QCM", null, "16725379", "LOOP | 3.27\u00b11.22 | 127\u00b1100 | 0.026\u00b10.018 | 39\u00b127"], ["\u03b1-thrombin", "protein", "TBA-iT9", "41.0 nM", -7.387, "non_intrinsic", "SPR", 298.15, "30735210", "TBA-iT9 | 41.0"], ["K562", "protein", "aptamer-FAM", "41.0 nM", -7.387, "non_intrinsic", null, null, "32307868", "the K d value (3.2 nM) of PAM in binding the K562 cell is one order of magnitude lower than that of the aptamer alone (41 nM)."], ["BTX-2", "protein", "BT10", "42.0 nM", -7.377, "intrinsic", null, null, "25725463", "Under these optimum conditions, we have again estimated the binding af fi nity of the BT10 aptamer and a K d value of 42 nM was obtained."], ["tobramycin", "protein", "Ap 4", "42.12 nM", -7.376, "intrinsic", null, null, "30268963", "The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively"], ["CD71", "protein", "XQ 2d", "42.34 nM", -7.373, "non_intrinsic", "flow_cytometry", null, "40156524", "aptamers (HG1-9, K d = 43.23 \u00b1 4.62 nM and XQ-2d, K d = 42.34 \u00b1 5.15 nM))"], ["saxitoxin", "protein", "STX-G4-45", "42.6 nM", -7.371, "intrinsic", null, null, "35324725", "STX-G4-45 ( K d: 42.6 nM, Table S1)"], ["\u03b1-thrombin", "protein", "TBA", "42.7 nM", -7.37, "non_intrinsic", "SPR", 298.15, "30735210", "TBA | 42.7"], ["Salmonella typhimurium", "protein", "NTri-biApt", "4.3090000000000004e-08 M", -7.366, "avidity_multivalent", "ELISA", 310.15, "37893744", "the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively"], ["CD71", "protein", "HG1-9", "43.23 nM", -7.364, "non_intrinsic", "flow_cytometry", null, "40156524", "aptamers (HG1-9, K d = 43.23 \u00b1 4.62 nM and XQ-2d, K d = 42.34 \u00b1 5.15 nM))"], ["cefquinome", "protein", "Apt-9", "43.3 nM", -7.364, "intrinsic", null, null, "40203705", "Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were ... 43.30 nM"], ["cefapirin", "protein", "Apt-9", "43.68 nM", -7.36, "intrinsic", null, null, "40203705", "Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were 43.68 nM"], ["digoxin", "protein", "D2", "4.4e-08 M", -7.357, "intrinsic", null, null, "23021809", "Truncated (without primer binding region) D1, truncated D2 and full length D1 were bound to digoxin-BSA with Kd value of 8.2 \u00d7 10 -9 , 44 \u00d7 10 -9 and 17.8 \u00d7 10 -9 M, respectively"], ["Total Phthalate Esters (TP)", "protein", "Truncated 24-mer aptamer", "44.1 nM", -7.356, "intrinsic", null, null, "33524734", "that of the truncated 24-mer aptamer was 44.1 nM"], ["M0-like macrophage", "protein", "A2", "44.12 nM", -7.355, "non_intrinsic", "flow_cytometry", 277.15, "32589412", "apparent dissociation constants ( K d ) of 44.12 \u00b1 8.0 and 22.81 \u00b1 5.6 nM to M0- and M2-like macrophages, respectively"], ["HBeAg", "protein", "EAg0", "4.4200000000000005e-08 M", -7.355, "intrinsic", "affinity_real_time_qPCR", null, "32250595", "A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0"], ["monocyte", "protein", "A2", "45.0 nM", -7.347, "non_intrinsic", "flow_cytometry", 277.15, "32589412", "aptamer A2 bound CD14 + cells (monocytes) with high speci fi city ( K d \u223c 45 \u00b1 9.1 nM)"], ["Oxytetracycline", "protein", "OTC5", "4.5000000000000006e-08 M", -7.347, "intrinsic", null, null, "35777074", "the binding was slightly enhanced when NaCl was decreased (Figure 3B, K d reached 45 nM when no NaCl was present)"], ["Ara h1", "protein", "CB-APT1", "4.5000000000000006e-08 M", -7.347, "avidity_multivalent", "MST", 298.15, "40083221", "Notably, a similar binding affinity was observed even in a complex matrix that contained 80% w/w total peanut proteins ( K d = 45.0 nM, Figures 3 and S5)."], ["\u03b1-thrombin", "protein", "TBA-iT12", "46.8 nM", -7.33, "non_intrinsic", "SPR", 298.15, "30735210", "TBA-iT12 | 46.8"], ["Zearalenone", "protein", "A2", "47.1 nM", -7.327, "intrinsic", null, null, "38608399", "The GO method showed that the Kd value for A2 was 47.1 nM"], ["Human thrombin", "protein", "M08s", "47.2 nM", -7.326, "intrinsic", "SPR", null, "37621412", "M08s | 7.04 10^5 | 3.33 10^-2 | 47.2"], ["ASPH", "protein", "AP-Cell 1", "4.751e-08 M", -7.323, "apparent_cellular", "flow_cytometry", null, "36959438", "three proper oligomers, AP-Cell 1, AP-Cell 2, and AP-Cell 3 with reasonable dissociation constants ( K d ) of 47.51, 39.38, and 65.23 nM, respectively, were achieved."], ["sCD80", "protein", "CD80-16", "47.69 nM", -7.322, "intrinsic", null, null, "37816286", "CD80-4 and CD80-16 aptamers showed the lowest K d values of 200.5 nM and 47.69 nM, respectively"], ["ODAM", "protein", "OD64", "4.771e-08 M", -7.321, "intrinsic", "SPR", null, "33455205", "the obtained OD64 and OD35 (aptamer cognate pair) presented high a ffi nity and excellent speci fi city, along with dissociation constants ( K d ) of 47.71 nM (OD64)"], ["tobramycin", "protein", "Ap 3", "47.79 nM", -7.321, "intrinsic", null, null, "30268963", "The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively"], ["ODAM", "protein", "OD64", "47.71 nM", -7.321, "intrinsic", null, null, "30396019", "From this dose-dependency curves, the Kd values of OD64 and OD35, estimated by adopting non-linear regression analysis, were 47.71 nM and 51.36 nM, for OD64 and OD35, respectively."], ["Mycobacterium tuberculosis H37Rv", "protein", "NK1", "48.0 nM", -7.319, "non_intrinsic", "flow_cytometry", null, "21643749", "| NK1     | 48 \u00b1 13 |"], ["CD71", "protein", "ATL", "48.17 nM", -7.317, "non_intrinsic", "flow_cytometry", 277.15, "41412185", "K(pH 6.5) = 48.17 \u00b1 2.70 nM"], ["Immunoglobulin E", "protein", "IgE37-T10-FAM (no MgCl2)", "49.0 nM", -7.31, "intrinsic", null, null, "32498825", "Without MgCl2 in the binding buffer, the K d of IgE37-T10-FAM increased to 49 nM"], ["SEC1", "protein", "C36.2", "49.43 nM", -7.306, "intrinsic", null, null, "25053102", "The Kd values are 49.43 \u00b1 11.76, 65.14 \u00b1 11.64 and 154.9 \u00b1 45.67 nM, respectively."], ["lysozyme", "protein", "lysozyme-binding aptamer", "49.5 nM", -7.305, "intrinsic", null, null, "21616496", "average ligand-site dissociation constant ( k d ) of 49.5 nM \u00b1 8.3 nM"], ["murine OX40", "protein", "11.8", "50.0 nM", -7.301, "intrinsic", "filter_binding", null, "18635004", "11.8 | AUACCAGCGAAUAACUCGCUGAGGAACCCGACUCACAAA | 50 | 1"], ["human immunoglobulin E", "protein", "AptIgE-3'-TMR", "50.0 nM", -7.301, "non_intrinsic", "CE-LIF", 298.15, "28763192", "The apparent K d of AptIgE-3 \u2032 -TMR was about 50 nM"], ["CD20", "protein", "WB1/1.CD20.1_2S", "50.0 nM", -7.301, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB1/1.CD20.1_2S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 2.64 | 53 \u00b1 40 | 50 \u00b1 2.3"], ["CD19", "protein", "WB15.CD19", "50.0 nM", -7.301, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB15.CD19 | 5'-AGAGACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGTGGCTTCTT-3' | - | N.P. | 50 \u00b1 9.1"], ["HAP 1b", "protein", "Aptamer 21", "5.0000000000000004e-08 M", -7.301, "intrinsic", null, null, "21899290", "A high-affinity RNA aptamer (K d  = 50 nM) was efficiently identified by SELEX against a heteroaryl dihydropyrimidine structure"], ["Ochratoxin A", "protein", "OBA36", "5.0000000000000004e-08 M", -7.301, "intrinsic", null, null, "35442665", "OBA36 binds OTA with a dissociation constant ( K d) down to \u223c 50 nM"], ["human prothrombin", "protein", "thrombin aptamer", "50.0 nM", -7.301, "intrinsic", null, null, "21700444", "the thrombin aptamer does bind prothrombin but with a lower KD (50 nM versus 2 nM for thrombin)"], ["17 \u03b2 -estradiol", "protein", "E2 aptamer", "50.0 nM", -7.301, "intrinsic", null, null, "24594593", "Kd was determined to be 50 nM."], ["HSV-1 gD", "protein", "DApt", "50.0 nM", -7.301, "intrinsic", null, null, "29246315", "Our 45-nt-long DNA aptamer showed high af fi nity for HSV-1 gD (binding af fi nity constant [Kd] = 50 nM)"], ["enrofloxacin", "protein", "Apt6", "50.77 nM", -7.294, "intrinsic", null, null, "29574118", "The obtained Kd of Apt58 and Apt6, with non-linear regression analysis, were 14.19 nM and 50.77 nM, respectively."], ["thrombin", "protein", "12Ala", "51.0 nM", -7.292, "intrinsic", "MST", null, "33614235", "12Ala | 51.7 | 51.0 \u00b1 3.8 | 2.74"], ["kanamycin", "protein", "KAN8-1", "5.1e-08 M", -7.292, "intrinsic", null, null, "41914599", "Its top sequence, named KAN8 -1, shows a K d of 51 nM at pH 7.5 for kanamycin as measured by isothermal titration calorimetry"], ["adenosine monophosphate", "protein", "AMP aptamer", "51.0 nM", -7.292, "intrinsic", null, null, "35934372", "KD of BHQ-2-(NH2)2-AMP aptamer complex was 51 nM"], ["methionyl-tRNA synthetase", "protein", "42mer pool", "51.3 nM", -7.29, "intrinsic", null, null, "23399565", "The dissociation constants of the selected 70 and 42mer pools to M. tuberculosis MRS were 38.8 and 51.3 nM, respectively."], ["Zearalenone", "protein", "M2", "51.31 nM", -7.29, "intrinsic", null, null, "38608399", "However, the fluorescence-measured Kd value was 51.31 nM"], ["ODAM", "protein", "OD35", "5.1360000000000005e-08 M", -7.289, "intrinsic", "SPR", null, "33455205", "the obtained OD64 and OD35 (aptamer cognate pair) presented high a ffi nity and excellent speci fi city, along with dissociation constants ( K d ) of 47.71 nM (OD64) and 51.36 nM (OD35)."], ["ODAM", "protein", "OD35", "51.36 nM", -7.289, "intrinsic", null, null, "30396019", "From this dose-dependency curves, the Kd values of OD64 and OD35, estimated by adopting non-linear regression analysis, were 47.71 nM and 51.36 nM, for OD64 and OD35, respectively."], ["human \u03b1-Thrombin", "protein", "A1", "52.0 nM", -7.284, "intrinsic", null, null, "31129134", "Also for aptamer A1 we measured with MST KD values in the pico- and nanomolar range (2 pM and 52 nM)."], ["tobramycin", "protein", "Ap 1", "52.37 nM", -7.281, "intrinsic", null, null, "30268963", "Compared with Ap 1 (Kd =52.37nM), the a ffi nity of the aptamer maintains and slightly increases with the removing of the redundant sequence."], ["CD20", "protein", "WB1/1.CD20.1_2S", "53.0 nM", -7.276, "non_intrinsic", "flow_cytometry", 277.15, "41079126", "WB1/1.CD20.1_2S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 2.64 | 53 \u00b1 40 | 50 \u00b1 2.3"], ["BHQ-2-(NH(NH)NH2)2", "protein", "AMP aptamer", "53.0 nM", -7.276, "intrinsic", null, null, "35934372", "Incubation of the aptamer with AMP decreased KD down to 53 nM"], ["CD8", "protein", "CD8AP17s-Stemloop2", "53.04 nM", -7.275, "non_intrinsic", "flow_cytometry", 277.15, "23791505", "Kd=53.04 nM"], ["A\u03b242 oligomer", "protein", "A\u03b2-Apt", "5.33e-08 M", -7.273, "intrinsic", "SPR", 298.15, "35019631", "suggesting that the binding a ffi nity of A \u03b2 -Apt with A \u03b2 42 oligomer ( K d = 53.3 nM) was stronger than that of A \u03b2 -Apt with A \u03b2 42 monomer."], ["Ochratoxin A", "protein", "OBA33", "5.4e-08 M", -7.268, "intrinsic", null, null, "35442665", "The binding a ffi nity of OBA33 is 54 nM for OTA"], ["HSV-1 gD", "protein", "DApt", "53.92 nM", -7.268, "intrinsic", null, null, "29246315", "a nonlinear regression analysis of the determined values was plotted to give a speci fi c Kd of 53.92 nM (Figure 1C)."], ["Thyroid-Stimulating Hormone Receptor (TSHR)", "protein", "TSHRly-1c", "54.37 nM", -7.265, "non_intrinsic", "flow_cytometry", null, "40588369", "As shown in Figure 4E, the apparent equilibrium dissociation constant ( K d) of TSHRly-1c was determined to be 54.37 \u00b1 8.22 nM."], ["tobramycin", "protein", "Ap 2", "54.58 nM", -7.263, "intrinsic", null, null, "30268963", "The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively"], ["Mycobacterium tuberculosis H37Rv", "protein", "NK20", "55.0 nM", -7.26, "non_intrinsic", "flow_cytometry", null, "21643749", "| NK20    | 55 \u00b1 16 |"], ["CD19", "protein", "WB17/17.CD19.1_1S", "56.0 nM", -7.252, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB17/17.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 530 \u00b1 1278 | 56 \u00b1 49"], ["Surface Antigen 1", "protein", "SOK11", "56.66 nM", -7.247, "intrinsic", null, null, "40288708", "SOK11 (56.66 nM, R 2 = 0.8128)"], ["ofloxacin", "protein", "Q1", "56.9 nM", -7.245, "intrinsic", null, null, "26547431", "Aptamer Q1 was found to have an af fi nity constant of K D 1\u20444 56.9 nM ( 7 11.3)"], ["\u03b1-thrombin", "protein", "TBA-iT3", "57.3 nM", -7.242, "non_intrinsic", "SPR", 298.15, "30735210", "TBA-iT3 | 57.3"], ["Salmonella typhimurium", "protein", "NTri-monoApt", "5.7320000000000006e-08 M", -7.242, "apparent_cellular", "ELISA", 310.15, "37893744", "the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively"], ["PTK7", "protein", "Sgc8c-Si6", "5.7230000000000004e-08 M", -7.242, "apparent_cellular", "flow_cytometry", 277.15, "40415219", "Sgc8c-Si6 maintained strong binding affinity ( K d = 57.23 nM)"], ["CD63", "protein", "CD63 Aptamer", "5.8e-08 M", -7.237, "intrinsic", "SPR", null, "26500145", "The equilibrium constant of the aptamer immobilized via 3 0 end was found to be KD = 5.8 -10  8 M."], ["t-Bu Hoechst dye", "protein", "Aptamer II", "58.2 nM", -7.235, "intrinsic", null, null, "38613867", "The Aptamer II sequence has a fluorescence-determined KD of 58.2 nM (Table 2)"], ["CD20", "protein", "WB1.CD20.1", "59.0 nM", -7.229, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB1.CD20.1 | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | - | N.P. | 59 \u00b1 19"], ["Rat beta-crosslaps", "protein", "BC2", "59.0 nM", -7.229, "intrinsic", null, null, "33379043", "The BC1 and BC2 aptamers show high affinity in the nanomolar range, 69 and 59 nM, respectively"], ["Rat osteocalcin", "protein", "OC2", "59.0 nM", -7.229, "intrinsic", null, null, "33379043", "The high-affinity aptamers of OC and BC showed the Kd values of 59 and 55 nM respectively."], ["melamine", "protein", "Mel36-1", "6.000000000000001e-08 M", -7.222, "intrinsic", null, null, "42261635", "The highest affinity aptamers exhibited a dissociation constant ( K d) of \u223c 60 nM"], ["adenosine monophosphate", "protein", "AMP aptamer", "60.0 nM", -7.222, "intrinsic", null, null, "35934372", "KD in saturated AMP concentration (500 \u03bc M) was 60 nM"], ["prothrombin", "protein", "ARC-183", "60.7 nM", -7.217, "intrinsic", "SPR", 298.15, "22385910", "Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM and ARC-183 = 60.7 nM)"], ["prothrombin", "protein", "HD1-22", "6.1e-08 M", -7.215, "intrinsic", "SPR", null, "18826387", "HD1-22 | Prothrombin | K D ( M) | 6.1 \u00b7 10 ) 8"], ["Tau", "protein", "Apt", "62.5 nM", -7.204, "intrinsic", "SPR", 298.15, "41034513", "Surface plasmon resonance (SPR) assay revealed that Apt could specifically bind to Tau proteins with high affinity (dissociation constant = 62.5 \u00b1 1.1 nM)"], ["Pb2+", "protein", "TBA-4PI[T3]", "6.300000000000001e-08 M", -7.201, "intrinsic", null, 298.15, "34543022", "a titration of Pb(NO3)2 to 1 \u03bc M TBA-4PI[T3] provided an apparent dissociate constant ( K d) of 63 nM"], ["A\u03b242 monomer", "protein", "A\u03b2-Apt", "6.34e-08 M", -7.198, "intrinsic", "SPR", 298.15, "35019631", "It was evaluated that A \u03b2 -Apt showed the ability to bind A \u03b2 42 with a K d of 63.4 nM."], ["SipA", "protein", "Apt17", "63.4 nM", -7.198, "intrinsic", null, null, "31953175", "Apt17 displayed Kd values of 114.9 and 63.4 nM at 27 \u00b0C and 37 \u00b0C, respectively"], ["Staphylococcal enterotoxin B", "protein", "A11", "64.0 nM", -7.194, "intrinsic", null, null, "25624325", "A2 and A11 both bound with high affinity to SEB, with dissociation constants of 26 nM and 64 nM, respectively"], ["paramylon", "protein", "Par-18", "6.406e-08 M", -7.193, "intrinsic", "fluorescence", null, "31809034", "The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 \u00b1 2.61, 34.90 \u00b1 5.83, 64.06 \u00b1 6.72, 123.81 \u00b1 13.41, and 249.52 \u00b1 46.39 nM, respectively."], ["CD20", "protein", "WB1/1.CD20.1_4S", "65.0 nM", -7.187, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB1/1.CD20.1_4S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 5.28 | 25 \u00b1 12 | 65 \u00b1 38"], ["ASPH", "protein", "AP-Cell 3", "6.523000000000001e-08 M", -7.186, "apparent_cellular", "flow_cytometry", null, "36959438", "three proper oligomers, AP-Cell 1, AP-Cell 2, and AP-Cell 3 with reasonable dissociation constants ( K d ) of 47.51, 39.38, and 65.23 nM, respectively, were achieved."], ["Total Phthalate Esters (TP)", "protein", "Parental 39-mer aptamer", "65.7 nM", -7.182, "intrinsic", null, null, "33524734", "Compared with the Kd (TP) of 65.7 nM for the parental 39-mer aptamer"], ["prothrombin", "protein", "HD1-22", "6.7e-08 M", -7.174, "non_intrinsic", "SPR", null, "18826387", "HD1-22 | Prothrombin+ phospholipids | K D ( M) | 6.7 \u00b7 10 ) 8"], ["thrombin", "protein", "12Trp", "67.3 nM", -7.172, "intrinsic", "MST", null, "33614235", "12Trp | 54.7 | 67.3 \u00b1 12.1 | 3.12"], ["SARS-CoV-2 spike trimer", "protein", "S1", "68.9 nM", -7.162, "intrinsic", null, null, "34188971", "The aptamer S14 evinced 3-fold higher affinity (KD = 21.8 nM) then S1 (KD = 68.9 nM)."], ["Rat beta-crosslaps", "protein", "BC1", "69.0 nM", -7.161, "intrinsic", null, null, "33379043", "The BC1 and BC2 aptamers show high affinity in the nanomolar range, 69 and 59 nM, respectively"], ["chlorpromazine", "protein", "CHL-3", "69.8 nM", -7.156, "intrinsic", null, null, "36049339", "The Kd value of CHL-3 is 69.8 nM."], ["RA-FLSs", "protein", "SAPT8", "71.2 nM", -7.148, "non_intrinsic", "flow_cytometry", 310.15, "39237134", "The equilibrium dissociation constants (Kd) of SAPT4 and SAPT8 with RA-FLSs were 101.7 \u00b1 29.6 and 71.2 \u00b1 15.0 nM, respectively ( fi gure 1H)."], ["thrombin", "protein", "12Leu", "72.2 nM", -7.141, "intrinsic", "MST", null, "33614235", "12Leu | 53.6 | 72.2 \u00b1 0.9 | 4.14"], ["Nampt", "protein", "no. 19", "72.52 nM", -7.14, "intrinsic", null, null, "22704839", "dissociation constant ( Kd ) was calculated to be 72.52 nM for the no. 19 aptamer"], ["SCAF4", "protein", "PTf-SRiApt", "0.073 \u00b5M", -7.137, "intrinsic", "fluorescence", null, "40574704", "0.073 \u00b1 0.003 \u00b5 m for PTf -SRiApt"], ["CD20", "protein", "WB1-CD20", "73.0 nM", -7.137, "non_intrinsic", "flow_cytometry", 298.15, "35829681", "The apparent affinities of WB1-CD20 and WB2-CD20 were calculated as 73 nM and 163 nM at 25\u00b0C, respectively"], ["Fok I", "protein", "F6#71", "74.0 nM", -7.131, "intrinsic", null, null, "27899266", "dissociation constants of F6#8 and #71 were 82 nM and 74 nM, respectively"], ["HFIXa", "protein", "Seq 5", "74.07 nM", -7.13, "intrinsic", "ITC", 298.15, "38776649", "Seq 5- | 7.4 | 0.921 | 13.5 | 74.07 | 209.1 | 565 | 40.43"], ["alkaline phosphatase", "protein", "ALP binding aptamer", "7.49e-08 M", -7.126, "intrinsic", "PISA", null, "30827094", "From the response -dose curve (Figure 3A), the dissociation constant ( K d ) for aptamermodi fi ed array was estimated by the logistic function fi tting to be 7.49 \u00d7 10 -8 M"], ["neomycin-B", "protein", "NEO7A", "75.0 nM", -7.125, "intrinsic", null, null, "23535583", "NEO7A bound neomycin-B with a Kd of 75 nM in buffer A"], ["gonyautoxin 1/4", "protein", "GO18-T-d", "75.63 nM", -7.121, "intrinsic", null, null, "33294137", "Corresponding Kd values of GO18-T-d and tGO18-T-d, determined by the average of 8 independent measurements, were 75.63 nM and 3.60 nM, respectively."], ["Co2+", "protein", "Co-1", "7.6e-08 M", -7.119, "intrinsic", null, null, "40656531", "The corresponding true K d values were ... 76 nM for Co 2+"], ["PAUF", "protein", "P12FR2", "77.0 nM", -7.114, "intrinsic", null, null, "21963224", "the equilibrium dissociation constant calculated from the relation of KD = kd / ka was 77 nM"], ["prothrombin", "protein", "HD1", "7.8e-08 M", -7.108, "intrinsic", "SPR", null, "18826387", "HD1 | Prothrombin | K D ( M) | 7.8 \u00b7 10 ) 8"], ["hemagglutinin (HA) protein of H1N1 influenza virus (A/Puerto Rico/8/1934)", "protein", "aptamer 1", "78.0 nM", -7.108, "intrinsic", "fluorescence", 310.15, "26904922", "As it showed a higher binding affinity for HA protein (Kd = 78 -1nM), aptamer 1 was tested"], ["kanamycin", "protein", "Ky2", "78.8 nM", -7.103, "intrinsic", null, null, "21530479", "The dissociation constants ( K d [kanamycin] = 78.8 nM"], ["kanamycin", "protein", "Ky2", "78.8 nM", -7.103, "intrinsic", null, null, "28259207", "The dissociation constants (Kd [kanamycin] = 78.8 nM"], ["Plasmodium falciparum glutamate dehydrogenase", "protein", "NG3", "79.0 nM", -7.102, "intrinsic", null, null, "29909195", "A thiolated ssDNA aptamer (NG3) that binds speci fi cally to Pf GDH antigen with high a ffi nity (K d= 79 nM) was used to develop the aptasensor."], ["BCMA", "protein", "apt69.T", "79.4 nM", -7.1, "non_intrinsic", "qRT-PCR", 310.15, "31778956", "with an apparent dissociation constant (KD = 79.4 nM) (Figure 2C)"], ["lysozyme", "protein", "lysozyme-binding aptamer", "80.0 nM", -7.097, "intrinsic", null, null, "21616496", "average dissociation constant ( k d ) was 80.0nM \u00b1 14nM"], ["MUP13", "protein", "Apt-1.4", "80.0 nM", -7.097, "intrinsic", null, null, "35026634", "The equilibrium dissociation constants ( KD ) were 180 \u00b1 80 nM for Apt-2.5 and 80 \u00b1 44 nM for Apt-1.4."], ["CD19", "protein", "WB17.CD19.1", "81.0 nM", -7.092, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB17.CD19.1 | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | - | N.P. | 81 \u00b1 16"], ["patulin", "protein", "PAT C3", "8.2e-08 M", -7.086, "intrinsic", "SPR", null, "35546052", "PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 \u00d7 10 -8 and 1.9 \u00d7 10 -7 M, respectively"], ["Oxytetracycline", "protein", "OTC5", "8.2e-08 M", -7.086, "intrinsic", null, null, "35777074", "In a buffer containing 300 mM NaCl and 10 mM MgCl2, the fitted K d value was 82 nM (Figure 3B, black trace)"], ["Fok I", "protein", "F6#8", "82.0 nM", -7.086, "intrinsic", null, null, "27899266", "dissociation constants of F6#8 and #71 were 82 nM and 74 nM, respectively"], ["CD20", "protein", "WB1/1.CD20.1_1S", "83.0 nM", -7.081, "non_intrinsic", "flow_cytometry", 277.15, "41079126", "WB1/1.CD20.1_1S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 1.32 | 83 \u00b1 58 | inconclusive"], ["Neuron specific enolase", "protein", "NSE-Apt5-5BioTEG", "83.0 nM", -7.081, "intrinsic", null, null, "35495513", "Through kinetic analysis, the binding rate constant and dissociation rate constant were determined to be 1.21 -10 4 Ms 1 and 1.004 -10 3 s 1 , respectively... Though this SPR analysis, the dissociation constant ( K d) was determined to be about 83 nM"], ["Staphylococcal enterotoxin B", "protein", "PEGA11", "83.5 nM", -7.078, "intrinsic", null, null, "25624325", "PEGA11 had a dissociation constant of 83.5 nM in selection buffer"], ["kanamycin B", "protein", "Ky2", "84.5 nM", -7.073, "intrinsic", null, null, "21530479", "K d [kanamycin B] = 84.5 nM"], ["kanamycin B", "protein", "Ky2", "84.5 nM", -7.073, "intrinsic", null, null, "28259207", "Kd [kanamycin B] = 84.5 nM"], ["kanamycin", "protein", "Kana2", "85.6 nM", -7.068, "intrinsic", null, null, "21530479", "The K d values of Kana2 and Ky2 as determined by fluorescence measurement were 85.6 and 78.8 nM, respectively"], ["thrombin", "protein", "12Ser", "86.6 nM", -7.062, "intrinsic", "MST", null, "33614235", "12Ser | 52.0 | 86.6 \u00b1 4.5 | 2.34"], ["CD20", "protein", "WB1.CD20", "87.0 nM", -7.06, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB1.CD20 | 5'-AGAGACCCTGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTTGCTTCTTGGACACGGTGGCTTCTT-3' | - | N.P. | 87 \u00b1 24"], ["Zearalenone", "protein", "Z100", "87.22 nM", -7.059, "intrinsic", null, null, "38608399", "Moreover, the Kd value of Z100 measured by the GO method was found to be 87.22 nM"], ["thrombin", "protein", "APTA", "88.0 nM", -7.056, "intrinsic", "QCM", null, "16725379", "APTA | 0.97\u00b10.45 | 86\u00b173 | 0.011\u00b10.006 | 88\u00b152"], ["fibrinogen", "protein", "FA", "89.6 nM", -7.048, "intrinsic", "microscale thermophoresis", null, "33395250", "The K d calculated for the fi brinogen target was 89.6 nM"], ["HspX", "protein", "H63 SL-2 M6", "9e-08 M", -7.046, "intrinsic", null, null, "30205966", "H63 SL-2 M6 displayed a speci fi c and high a ffi nity interaction with HspX (Kd \u223c 9.0 \u00d7 10 -8 M)."], ["Zearalenone", "protein", "A1", "90.25 nM", -7.045, "intrinsic", null, null, "38608399", "The Kd value was 90.25 nM as determined by the GO method"], ["Immunoglobulin E", "protein", "IgE37-T10-FAM (5-bp truncated)", "90.5 nM", -7.043, "intrinsic", null, null, "32498825", "When 4-base pairs and 5-base pairs were truncated from the stem, the K ds of the aptamers increased to 11.4 nM and 90.5 nM, respectively."], ["N-acetylneuraminic acid", "protein", "Neu5Ac aptamer", "91.0 nM", -7.041, "intrinsic", "ITC", 310.15, "37217750", "To validate ARPLA, we first determined the binding affinity ( K d ) of the Neu5Ac aptamer by isothermal titration calorimetry (ITC) as 91 nM (Extended Data Fig. 2a,b)"], ["mouse IL-2", "protein", "M20", "91.0 nM", -7.041, "intrinsic", null, null, "35756119", "The results indicated that the af fi nity of the M20 aptamer was greater than the M15, and its predicted Kd was 91 nM"], ["Okadaic Acid", "protein", "OA-LC2", "91.13 nM", -7.04, "intrinsic", "BLI", null, "36322695", "OA-LC2 exhibited K d of 91.13 \u00b1 4.64 nM"], ["rmCD3 d \u03b5 -Fc", "protein", "CD3_Apt1", "91.3 nM", -7.04, "intrinsic", "SPR", 298.15, "38745854", "aptamer 1 (91.3 nM)"], ["6'-sialyllactose", "protein", "Apt9-1", "9.175000000000001e-08 M", -7.037, "intrinsic", "fluorescence", 298.15, "36700646", "A 35 nt truncated aptamer Apt9-1 ( K d = 91.75 nM) with higher affinity than Apt9 was finally obtained."], ["BHQ-2-(NH(NH)NH2)2", "protein", "AMP aptamer", "92.0 nM", -7.036, "intrinsic", null, null, "35934372", "BHQ-2-(NH(NH)NH2)2 had lower affinity to the aptamer in the low salt buffer. KD was 92 nM"], ["17 \u03b2 -estradiol", "protein", "HEV1", "9.276e-08 M", -7.033, "intrinsic", "MST", null, "38276613", "the dissociation constant (KD value) is 92.76 \u00b1 66.02 nM as calculated by the calculation function that comes with the system."], ["Mycobacterium tuberculosis H37Rv", "protein", "NK10", "95.0 nM", -7.022, "non_intrinsic", "flow_cytometry", null, "21643749", "| NK10    | 95 \u00b1 28 |"], ["Gymnodimine-A", "protein", "G48nop", "95.3 nM", -7.021, "intrinsic", null, null, "35324692", "The resulting K D value of G48nop (95.30 nM) was about one third of that of G48 (288 nM)"], ["EpCAM", "protein", "SYL3C", "9.700000000000001e-08 M", -7.013, "apparent_cellular", null, null, "36856721", "SYL3C can bind to SW480 cells (EpCAM+) with a K d of 97 nM"], ["thrombin", "protein", "TBA15", "97.0 nM", -7.013, "intrinsic", null, null, "23850569", "A K D value of 97 nM  1 nM was determined for the TBA/Thr complex in the MST assay"], ["Oxytetracycline", "protein", "OTC5", "9.8e-08 M", -7.009, "intrinsic", null, null, "35777074", "we fitted the peak fluorescence to obtain a K d of 98 nM (Figure 4B)"], ["neomycin", "protein", "NAN-NEO", "98.101 nM", -7.008, "intrinsic", null, null, "22321384", "Using the LineweaverBurk equation (Equation 1), we calculated the dissociation constant (Kd) to be 98.101 nM (Figure 5, B )."], ["thrombin", "protein", "12Phe", "99.1 nM", -7.004, "intrinsic", "MST", null, "33614235", "12Phe | 54.3 | 99.1 \u00b1 6.3 | 4.07"], ["BSA", "glycan/conjugate", "Clone 5", "1e-07 M", -7.0, "intrinsic", "SPR", null, "11178986", "BSA | 2.2 3 10 4 | 2.3 3 10 2 3 | 9.9 3 10 6 | 1.0 3 10 2 7"], ["human \u03b1-thrombin", "protein", "Apt15", "100.0 nM", -7.0, "non_intrinsic", null, null, "28763192", "One 15-mer DNA aptamer (5 \u2032 -GGT TGG TGT GGT TGG-3 \u2032 , denoted as Apt15 here) binds to the fi brinogen-binding site of human \u03b1 -thrombin with a K d around 100 nM."], ["D-TAR RNA", "protein", "L-6-4t", "1.0000000000000001e-07 M", -7.0, "intrinsic", null, null, "23977945", "the K d  of the L-aptamer for D-TAR RNA is 100 nM"], ["Bisphenol A", "protein", "BPA-specific aptamer", "1.0000000000000001e-07 M", -7.0, "intrinsic", null, null, "25329684", "the K d value for free BPA binding to the BPA aptamer was determined experimentally using MST to be \u223c 100 nM"], ["Thrombin", "protein", "TBA15", "1e-07 M", -7.0, "intrinsic", null, null, "26643617", "K d of free TBA15 (~1 \u00d7 10 -7 M)"], ["human \u03b2-defensin 2", "protein", "U gu1", "100.0 nM", -7.0, "intrinsic", null, null, "32067984", "Besides, clone U gu1 bound somewhat poorly to HBD-2 ( K d = 100 nM, Fig. S2)."], ["RA-FLSs", "protein", "SAPT4", "101.7 nM", -6.993, "non_intrinsic", "flow_cytometry", 310.15, "39237134", "The equilibrium dissociation constants (Kd) of SAPT4 and SAPT8 with RA-FLSs were 101.7 \u00b1 29.6 and 71.2 \u00b1 15.0 nM, respectively ( fi gure 1H)."], ["CD9", "protein", "CD9-26", "101.96 nM", -6.992, "intrinsic", "fluorescence", 277.15, "37585601", "CD9-26 | 5 \u2032 -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG TGC GCA CTA GAG CAG GTA CGG TGT CA-3 \u2032 | - 8.92"], ["human \u03b1-Thrombin", "protein", "A3", "101.9 nM", -6.992, "intrinsic", null, null, "31129134", "and as poorest binder aptamer A3 (101.9 nM)."], ["tobramycin", "protein", "Ky2", "103.0 nM", -6.987, "intrinsic", null, null, "21530479", "and K d [tobramycin] = 103 nM)"], ["tobramycin", "protein", "Ky2", "103.0 nM", -6.987, "intrinsic", null, null, "28259207", "and Kd [tobramycin] = 103nM"], ["Okadaic Acid", "protein", "OA-SL2", "103.4 nM", -6.985, "intrinsic", "BLI", null, "36322695", "from OA-SL1 to OASL2, K d was lowered from 340.5 \u00b1 14.5 to 103.4 \u00b1 7.0 nM"], ["aflatoxin B2", "protein", "A50-T26-TMR", "105.0 nM", -6.979, "intrinsic", null, null, "30086944", "the K d for AFB2 was determined to be 105 nM in our study."], ["Mycobacterium tuberculosis H37Rv", "protein", "NK8", "107.0 nM", -6.971, "non_intrinsic", "flow_cytometry", null, "21643749", "| NK8      | 107 \u00b1 44 |"], ["luteolin", "protein", "LUT#28", "107.0 nM", -6.971, "intrinsic", null, null, "29524380", "The value of Kd for LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively."], ["luteolin", "protein", "LUT#3", "109.0 nM", -6.963, "intrinsic", null, null, "29524380", "The value of Kd for LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively."], ["domoic acid", "protein", "C1-d", "1.09e-07 M", -6.963, "intrinsic", null, null, "36421085", "Biolayer interferometry assay illustrated that C1-d possessed a K on (1/Ms) value of 2.94 \u00d7 10 5 , a K dis (1/s) value of 5.13 \u00d7 10 -2 , and a K D (M) value of 1.09 \u00d7 10 -7  M in the interaction with DA."], ["thrombin", "protein", "HD1", "110.0 nM", -6.959, "intrinsic", "filter_binding", null, "41053535", "HD1 binds both thrombin (K D = 110 nm)"], ["BHQ-2-(NH2)2", "protein", "off-target DNA hairpin", "110.0 nM", -6.959, "intrinsic", null, null, "35934372", "KD of the complex between BHQ-2-(NH2)2 and off-target DNA hairpin ... was twice higher, 110 nM"], ["PA toxin", "protein", "Apt11", "1.1200000000000001e-07 M", -6.951, "intrinsic", null, null, "20136122", "The aptamer was developed in-house by capillary electrophoresis systematic evolution of ligands by exponential enrichment (CE-SELEX) and had a dissociation constant (K d ) of 112 nM."], ["polysialic acid", "protein", "Apt3", "114.0 nM", -6.943, "intrinsic", null, null, "35151974", "The K d value of candidate Apt3 is the lowest among all the tested candidate aptamer sequences, which is 114.0 nM"], ["trisialic acid", "protein", "Apt3", "114.0 nM", -6.943, "intrinsic", null, null, "40545079", "aptamer Apt3 ( K d = 114.0 nM)"], ["CD19", "protein", "WB15.CD19.1", "117.0 nM", -6.932, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB15.CD19.1 | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | - | N.P. | 117 \u00b1 28"], ["human \u03b1-Thrombin", "protein", "A3", "117.8 nM", -6.929, "intrinsic", null, null, "31129134", "and the poorest binder is A3 (117.8 nM)."], ["Moraxella osloensis", "protein", "MO9", "1.1890000000000001e-07 M", -6.925, "apparent_cellular", "fluorescence", null, "41784024", "high-a ffi nity aptamer (K d = 118.9 nM)"], ["SCAF4", "protein", "PT1/2-SRiApt", "0.121 \u00b5M", -6.917, "intrinsic", "fluorescence", null, "40574704", "0.121 \u00b1 0.054 \u00b5 m for PT1/2 -SRiApt"], ["SIRT2", "protein", "Apt 45", "1.233e-07 M", -6.909, "intrinsic", "fluorescence", 310.15, "40200675", "selected Apt 45 ( K d = 123.3 nM) to fabricate the 'turn-on' fluorescent biosensor"], ["CD19", "protein", "WB15/15.CD19.1_1S", "125.0 nM", -6.903, "non_intrinsic", "flow_cytometry", 277.15, "41079126", "WB15/15.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 125 \u00b1 68 | 11 \u00b1 6.1"], ["Netilmicin", "protein", "APT-21", "126.0 nM", -6.9, "intrinsic", null, null, "35752088", "Intriguingly, the Kd value in the experiment (Fig. 4B) is 126.0 nM"], ["thrombin", "protein", "A4", "127.0 nM", -6.896, "intrinsic", null, null, "23850569", "The K D value determined for A4 (127 nM  1.4 nM) was very close to that of TBA15"], ["human \u03b1-Thrombin", "protein", "A1", "129.8 nM", -6.887, "intrinsic", null, null, "31129134", "for iRIf aptamer A2 is the best (26.4 nM) and aptamer A1 the poorest (129.8 nM)"], ["sLe X -BSA", "glycan/conjugate", "Original pool", "1.3e-07 M", -6.886, "intrinsic", "SPR", null, "11178986", "Original pool | 2.6 3 10 4 | 3.3 3 10 2 3 | 7.6 3 10 6 | 1.3 3 10 2 7"], ["H-Thr", "protein", "Seq-1", "136.0 nM", -6.866, "intrinsic", null, null, "31103164", "The good af fi nity of Seq-1 (Fig. S2) with 136 nM and Apt-29 with 199 nM were obtained"], ["saxitoxin", "protein", "75a", "136.0 nM", -6.866, "intrinsic", null, null, "35324725", "aptamer 75a with a K d value of 136 nM"], ["CD25", "protein", "Apt70", "138.6 nM", -6.858, "intrinsic", null, null, "29055191", "Using non-linear regression analysis, the Kd of Apt51 and Apt70 aptamers were found to be 13.4 nM and 138.6 nM, respectively"], ["guanine", "protein", "R10G2", "1.4e-07 M", -6.854, "intrinsic", null, null, "38194356", "In our R10G2 aptamer, a K d of 140 nM guanine was achieved"], ["SW480 cells", "cell/EV", "SYL3C", "142.5 nM", -6.846, "non_intrinsic", null, null, "32049531", "monovalent SYL3C aptamer ( K d = 142.50 \u00b1 20.55 nM, Figure 2A)"], ["Oxytetracycline", "protein", "OTC5", "1.47e-07 M", -6.833, "intrinsic", null, 298.15, "35777074", "a representative sequence named OTC5 had a dissociation constant of 147 nM measured by isothermal titration calorimetry."], ["AP65", "protein", "AP65_A1", "1.48e-07 M", -6.83, "intrinsic", null, null, "29972299", "The resulting K D was 148 nM"], ["6'-sialyllactose", "protein", "Apt9", "1.5230000000000003e-07 M", -6.817, "intrinsic", "fluorescence", 298.15, "36700646", "The ssDNA aptamer Apt9 ( K d = 152.3 nM) with a length of 79 nucleotides (nt) was demonstrated as the optimal aptamer candidate"], ["Surface Antigen 1", "protein", "SOK10", "152.9 nM", -6.816, "intrinsic", null, null, "40288708", "SOK10 (152.9 nM, R 2 = 0.7217)"], ["CD19", "protein", "WB15-CD19", "153.0 nM", -6.815, "non_intrinsic", "flow_cytometry", 298.15, "35829681", "At 25 \u00b0C, WB15-CD19 showed an apparent affinity of 153 nM"], ["progastrin-releasing peptide (31-98)", "protein", "ProGRP-48-5BioTEG", "153.0 nM", -6.815, "intrinsic", null, null, "35495513", "The dissociation constant ( K d) of ProGRP31-98 to aptamer was calculated to be 153 nM"], ["D-TAR RNA", "protein", "L-6-4t", "1.6e-07 M", -6.796, "intrinsic", null, null, "23977945", "The L-6-4t aptamer has somewhat reduced affinity for D-TAR RNA under the low-salt conditions (K d  = 160 nM)"], ["Hen egg white lysozyme", "protein", "DNA analog a2", "161.0 nM", -6.793, "intrinsic", null, null, "21167858", "The aptamerlysozyme equilibrium dissociation constant of 161 \u00b1 16nM agrees reasonably well with the Kd from fluorescence anisotropy (467 \u00b1 140nM). The overall free energy and enthalpy changes are -9.32 \u00b1 0.06kcal/mol and 2.2 \u00b1 1.0 kcal/mol, respectively."], ["CD20", "protein", "WB2-CD20", "163.0 nM", -6.788, "non_intrinsic", "flow_cytometry", 298.15, "35829681", "The apparent affinities of WB1-CD20 and WB2-CD20 were calculated as 73 nM and 163 nM at 25\u00b0C, respectively"], ["thrombin", "protein", "3NB", "163.5 nM", -6.786, "intrinsic", "MST", null, "33614235", "3NB | 51.7 | 163.5 \u00b1 3.5 | 3.82"], ["Phosphatidylserine", "protein", "PS-LC3-TF", "166.2 nM", -6.779, "intrinsic", "BLI", null, "36322695", "The terminal-fixed PS-LC3-TF exhibited an even lower K d at 166.2 \u00b1 10.7 nM"], ["xanthylacrylamide", "protein", "XAA-1", "1.6800000000000002e-07 M", -6.775, "intrinsic", null, null, "40261307", "an apparent K d value of 168 nM was obtained"], ["CD19", "protein", "WB15/17.CD19.1_2S", "173.0 nM", -6.762, "non_intrinsic", "flow_cytometry", 277.15, "41079126", "WB15/17.CD19.1_2S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 2.64 | 173 \u00b1 82 | inconclusive"], ["Tramadol hydrochloride", "protein", "Apt39", "178.4 nM", -6.749, "intrinsic", null, null, "33965888", "the Kd of Apt39 was measured to be 178.4 nM"], ["CD19", "protein", "WB15/17.CD19.1_1S", "183.0 nM", -6.738, "non_intrinsic", "flow_cytometry", 277.15, "41079126", "WB15/17.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 183 \u00b1 140 | inconclusive"], ["CD19", "protein", "WB17-CD19", "187.0 nM", -6.728, "non_intrinsic", "flow_cytometry", 298.15, "35829681", "and WB17-CD19 showed an apparent affinity of 187 nM (Figure S12A-B)."], ["patulin", "protein", "PAT C4", "1.9e-07 M", -6.721, "intrinsic", "SPR", null, "35546052", "PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 \u00d7 10 -8 and 1.9 \u00d7 10 -7 M, respectively"], ["Sc3+", "protein", "Sc-1", "1.9200000000000003e-07 M", -6.717, "intrinsic", null, null, "39743479", "obtained an apparent K d value of 192 nM"], ["Netilmicin", "protein", "APT-21", "194.1 nM", -6.712, "intrinsic", null, null, "35752088", "APT-21 bound to NET with high affinity (Kd = 194.1 nM)"], ["CD20", "protein", "WB1.CD20.2", "196.0 nM", -6.708, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB1.CD20.2 | 5'-TGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACAC-3' | - | N.P. | 196 \u00b1 117"], ["streptomycin", "protein", "STR1", "199.1 nM", -6.701, "intrinsic", null, null, "23601877", "the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively."], ["H-Thr", "protein", "Apt-29", "199.0 nM", -6.701, "intrinsic", null, null, "31103164", "The good af fi nity of Seq-1 (Fig. S2) with 136 nM and Apt-29 with 199 nM were obtained"], ["malachite green", "protein", "MGA", "200.0 nM", -6.699, "intrinsic", null, null, "27591602", "Based on the fl uorescence enhancement of MG, the initial dissociation constant ( K d) is determined to be 200 nM as seen in Figs. 2A and B"], ["sCD80", "protein", "CD80-4", "200.5 nM", -6.698, "intrinsic", null, null, "37816286", "CD80-4 and CD80-16 aptamers showed the lowest K d values of 200.5 nM and 47.69 nM, respectively"], ["bilirubin", "protein", "Brb7", "2.03e-07 M", -6.693, "intrinsic", null, null, "40669049", "The tightest binding bilirubin aptamer has a K d value of 203 nM based on ITC"], ["rmCD3 d \u03b5 -Fc", "protein", "CD3_Apt12", "206.0 nM", -6.686, "intrinsic", "SPR", 298.15, "38745854", "aptamer 12 (206 nM)"], ["AP65", "protein", "AP65_A1", "2.09e-07 M", -6.68, "intrinsic", null, null, "29972299", "K D of 209 nM was obtained"], ["saxitoxin", "protein", "STX-R-75", "209.4 nM", -6.679, "intrinsic", null, null, "35324725", "STX-R-75 ( K d: 209.4 nM, Table S1)"], ["di-2-ethylhexyl phthalate", "protein", "PT01 aptamer", "213.0 nM", -6.672, "intrinsic", null, null, "30189334", "The dissociation constant, Kd, of the PT01 aptamer was calculated as 213.0 nM using Eq. (1)."], ["CD8", "protein", "CD8AP17s-Stemloop1", "217.0 nM", -6.664, "non_intrinsic", "flow_cytometry", 277.15, "23791505", "Kd=217.0 nM"], ["rmCD3 d \u03b5", "protein", "CD3_Apt12 dimer", "218.0 nM", -6.662, "non_intrinsic", "BLI", 298.15, "38745854", "218 nM for Apt12 dimer"], ["rhGH", "protein", "rhGH-specific aptamer", "218.0 nM", -6.662, "intrinsic", null, null, "19500672", "the affinity constant was K D = 218 nM rhGH"], ["Cd2+", "protein", "probe", "2.2e-07 M", -6.658, "intrinsic", null, null, "32618180", "the disassociation constant ( K D) between Cd 2+ and its aptamer were calculated to be 96 M -1 S -1 , 2.11 \u00d7 10 -5 S -1 , and 220 nM, respectively"], ["streptomycin", "protein", "STR3", "221.3 nM", -6.655, "intrinsic", null, null, "23601877", "the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively."], ["SCAF4", "protein", "PT1/3-SRiApt", "0.223 \u00b5M", -6.652, "intrinsic", "fluorescence", null, "40574704", "0.223 \u00b1 0.030 \u00b5 m for PT 1/3 -SRiApt"], ["xanthylacrylamide", "protein", "XAA-1", "2.2400000000000002e-07 M", -6.65, "intrinsic", null, null, "40261307", "Using the ThT assay, an apparent K d of 224 nM was obtained for XAA-1"], ["benzovindiflupyr", "protein", "Apt.BZF01", "2.2650000000000002e-07 M", -6.645, "intrinsic", "fluorescence", null, "41614999", "corrected KDs of 226.5 nM (Apt.BZF01)"], ["human \u03b1-thrombin", "protein", "T25-Apt15-3'-TMR", "228.0 nM", -6.642, "non_intrinsic", "CE-LIF", 298.15, "28763192", "The apparent K d values of T25-Apt15-3 \u2032 -TMR and 5 \u2032 -TMR-T25-Apt15 were estimated as 228 nM and 8.8 nM, respectively"], ["Adenosine", "protein", "Ade1301b", "2.3000000000000002e-07 M", -6.638, "intrinsic", null, null, "36947745", "Ade1301b showed an even lower K d of 230 nM"], ["aflatoxin M1", "protein", "A50-T26-TMR", "230.0 nM", -6.638, "intrinsic", null, null, "30086944", "The aptamer showed almost the same FA responses to AFM1 and AFM2, with K ds to be 230 nM and 302 nM, respectively."], ["urea", "protein", "U38", "232.0 nM", -6.635, "intrinsic", null, null, "26002019", "isolate a urea speci fi c DNA aptamer with a dissociation constant ( K d) of 232 nM"], ["Okadaic Acid", "protein", "OA-SL3", "234.4 nM", -6.63, "intrinsic", "BLI", null, "36322695", "When OA-SL1 was tripled to get the chimera OA-SL3, K d rose to 234.4 \u00b1 15.6 nM"], ["urea", "protein", "U38", "238.0 nM", -6.623, "intrinsic", null, null, "26002019", "The K d of aptamer was calculated to be 238 nM"], ["Sr2+", "protein", "Thrombin Binding Aptamer", "240.0 nM", -6.62, "intrinsic", "mass_spectrometry", 298.15, "18318508", "the Kd determined from the best-fit curve is 240 ( 50 nM for the interaction of TBA and Sr 2 +"], ["Zika NS1", "protein", "10 (truncated)", "2.4000000000000003e-07 M", -6.62, "intrinsic", null, null, "29120623", "comparable binding affinities (24 and 45 pM for 100-nt and 41-nt 2 , and 134 and 240 nM for 100-nt and 54-nt 10 , respectively)"], ["dT20", "protein", "DCC-SSB", "2.4000000000000003e-07 M", -6.62, "intrinsic", null, 293.15, "34085169", "Titrations of dT 27 and dT20 at low concentrations of DCCSSB gave smaller fluorescence changes, and the data were fit to give single K d values of 43 and 240 nM, respectively"], ["cortisol", "protein", "CSS.3", "2.4000000000000003e-07 M", -6.62, "intrinsic", null, null, "38270529", "Our own internal work confirmed that CSS.3 had the best binding affinity in binding buffer with a K D of 240 nM"], ["kanamycin", "protein", "Apt 1/Apt 2 (split aptamers)", "247.0 nM", -6.607, "intrinsic", null, null, "35316405", "With the (GlcN)5 added in the binding buffer, the Kd was measured to be 247 nM"], ["Ni2+", "protein", "Ni-4", "2.5700000000000004e-07 M", -6.59, "intrinsic", null, null, "40656531", "and 257 nM for Ni 2+ in the same titration"], ["rHuEPOa", "protein", "813", "260.0 nM", -6.585, "intrinsic", null, null, "20971648", "The K d values of sequences of 807, 813, and 850 were 82 \u00b1 32 nM, 260 \u00b1 117 nM, and 590 \u00b1 354 nM, respectively"], ["Tetracycline", "protein", "OTC5", "2.6400000000000003e-07 M", -6.578, "intrinsic", null, null, "35777074", "they also showed a similar fluorescence enhancement with a K d of 264 nM TC"], ["streptomycin", "protein", "STR6", "272.0 nM", -6.565, "intrinsic", null, null, "23601877", "the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively."], ["5-Methoxytryptamine", "protein", "MLT-C-1F", "0.274 \u03bcM", -6.562, "intrinsic", null, null, "36925277", "For L-TRP and 5-MT very low K d were observed i.e., 0.324 \u03bcM and 0.274 \u03bcM respectively"], ["human \u03b1-Thrombin", "protein", "A1", "279.0 nM", -6.554, "intrinsic", null, null, "31129134", "Whereas the highest value was determined with iRIf for aptamer A1, which is 279 nM."], ["trisialic acid", "protein", "Apt3-1", "282.7 nM", -6.549, "intrinsic", null, null, "40545079", "Apt3 -1 ( K d = 282.7 nM)"], ["VEGF165", "protein", "no. 529", "2.8800000000000004e-07 M", -6.541, "intrinsic", null, null, "36215718", "The K D values of 524, 64, and 529, were 36.3, 79.3, and 288 nM, respectively."], ["Lactose", "protein", "Clone 5", "2.9e-07 M", -6.538, "intrinsic", "SPR", null, "11178986", "Lactose | 6.3 3 10 2 | 1.8 3 10 2 4 | 3.4 3 10 6 | 2.9 3 10 2 7"], ["CD9", "protein", "CD9-28", "289.67 nM", -6.538, "intrinsic", "fluorescence", 277.15, "37585601", "CD9-28 | 5 \u2032 -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG GGC GCA CTA GAG CAG GTA CGG TGT CA-3 \u2032 | - 8.80"], ["prothrombin", "protein", "HD1-12A-DAB", "296.0 nM", -6.529, "non_intrinsic", "filter_binding", null, "41053535", "and prothrombin with K D s of 13.1 pm and 296 nm"], ["Sc3+", "protein", "Sc-1b", "3.0200000000000003e-07 M", -6.52, "intrinsic", null, null, "39743479", "its K d (302 nM) was comparable to that of Sc-1"], ["aflatoxin M2", "protein", "A50-T26-TMR", "302.0 nM", -6.52, "intrinsic", null, null, "30086944", "The aptamer showed almost the same FA responses to AFM1 and AFM2, with K ds to be 230 nM and 302 nM, respectively."], ["kanamycin", "protein", "Apt 1/Apt 2 (split aptamers)", "304.0 nM", -6.517, "intrinsic", null, null, "35316405", "The split aptamers exhibited high affinity towards the kanamycin, with an Kd of 304 nM."], ["CD20", "protein", "WB1.CD20.3", "309.0 nM", -6.51, "non_intrinsic", "flow_cytometry", 310.15, "41079126", "WB1.CD20.3 | 5'-TGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | - | N.P. | 309 \u00b1 100"], ["SW620", "protein", "XL-33-1", "3.22e-07 M", -6.492, "apparent_cellular", null, null, "25867099", "Binding affinity of XL-33-1 against SW620 at 37 \u00b0 C was found to be 322 nM."], ["streptomycin", "protein", "STR12", "340.64 nM", -6.468, "intrinsic", null, null, "23601877", "the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively."], ["CD19", "protein", "WB15/15.CD19.1_2S", "356.0 nM", -6.449, "non_intrinsic", "flow_cytometry", 277.15, "41079126", "WB15/15.CD19.1_2S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 2.64 | 356 \u00b1 534 | 9.5 \u00b1 5.0"], ["serotonin", "protein", "Serotonin Aptamer", "3.6000000000000005e-07 M", -6.444, "intrinsic", null, null, "36704862", "The steady-state binding responses were fitted to the affinity model in eq 1, as shown in Figure 3B, which yielded a K d of 360 nM."], ["Hen egg white lysozyme", "protein", "DNA analog a1", "378.0 nM", -6.423, "intrinsic", null, null, "21167858", "The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 \u25e6 C are 378nM, 467nM and 573nM, respectively."], ["benzylpenicillin", "protein", "BBA1", "383.4 nM", -6.416, "intrinsic", null, null, "28522308", "a Kd of 383.4 nM (dissociation constant) was determined."], ["benzylpenicillin", "protein", "BBA1", "383.4 nM", -6.416, "intrinsic", null, null, "33184760", "a Kd of 383.4 nM (dissociation constant) was determined."], ["bilirubin", "protein", "Bvd4", "3.9e-07 M", -6.409, "intrinsic", null, null, "40669049", "We then performed a careful bilirubin titration (Figure S3A), and a clear binding was observed with an apparent K d of 390 nM bilirubin (Figure S3B)."], ["dT20", "protein", "DCC-SSB", "3.96e-07 M", -6.402, "intrinsic", null, 293.15, "34085169", "With dT20, the intercept suggests a dissociation rate constant of 49 s -1 , producing a value of 396 nM for the equilibrium dissociation constant"], ["biliverdin", "protein", "Bvd4", "4.0999999999999994e-07 M", -6.387, "intrinsic", "fluorescence", null, "40669049", "Titration of biliverdin into 1 \u03bcM Bvd4 aptamer led to an approximate 90% fluorescence drop (Figure 3A), and the fitted dissociation constant ( K d ) was 0.41 \u03bcM"], ["H-6 cells", "cell/EV", "Apta25", "0.42 \u00b5M", -6.377, "non_intrinsic", "flow_cytometry", 310.15, "40487293", "H-6 cells showed binding with Apta25 ( K D value-0.42 \u00b1 0.093 \u00b5 m)"], ["theophylline", "protein", "\u0394TCT8-4 theophylline-binding aptamer", "4.2e-07 M", -6.377, "intrinsic", null, null, "41248478", "Analysis of the SPR dose -response data gave a binding affinity of 420 nM."], ["rmCD3 d \u03b5 -Fc", "protein", "CD3_Apt3", "430.0 nM", -6.367, "intrinsic", "SPR", 298.15, "38745854", "aptamer 3 (430 nM)"], ["Kringle 5", "protein", "KG-4", "432.0 nM", -6.365, "intrinsic", null, null, "37149949", "The preferred aptamer KG-4, which demonstrated a low dissociation constant ( K d) of ~ 432 nM"], ["mannose-capped lipoarabinomannan", "protein", "ZXL1", "436.3 nM", -6.36, "intrinsic", "ELONA", 310.15, "24572295", "The K d of 436.3 \u00b1 37.84 nM was established as described in the Methods section."], ["Uric Acid", "protein", "Apt2", "4.61e-07 M", -6.336, "intrinsic", null, null, "42095518", "Microscale thermophoresis (MST) analysis yielded a Kd value of 461 nM for Apt2"], ["Hen egg white lysozyme", "protein", "DNA analog a2", "467.0 nM", -6.331, "intrinsic", null, null, "21167858", "The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 \u25e6 C are 378nM, 467nM and 573nM, respectively."], ["Muscovy duck parvovirus", "protein", "Apt-10", "467.0 nM", -6.331, "intrinsic", null, null, "28917743", "the ssDNA aptamer Apt-10, which specifically bound to MDPV with high affinity ( Kd = 467 nM) was successfully screened"], ["Fe2+", "protein", "Co-1", "4.68e-07 M", -6.33, "intrinsic", null, null, "40656531", "The corresponding true K d values were ... 468 nM for Fe 2+"], ["SCAF4", "protein", "SRiApt", "0.469 \u00b5M", -6.329, "intrinsic", "fluorescence", null, "40574704", "The binding affinities (K D ) were determined to be 0.469 \u00b1 0.010 \u00b5 m for unmodified SRiApt"], ["Bisphenol A", "protein", "63-mer BPA aptamer", "491.69 nM", -6.308, "intrinsic", null, null, "32113141", "The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM"], ["CD9", "protein", "CD9-08", "494.37 nM", -6.306, "non_intrinsic", "fluorescence", 277.15, "37585601", "CD9-08 | 5 \u2032 -TGA CAC CGT ACC TGC TCT AGT GCG CAC TGA ACG ATC CTG CGT CAA GTT CAA GGT TGT GAA GCA CGC CAA GGG ACT AT-3 \u2032 | - 11.71"], ["Mouse thrombin", "protein", "M08s", "495.0 nM", -6.305, "intrinsic", "SPR", null, "37621412", "M08s | 3.56 10^5 | 1.76 10^-1 | 495"], ["thrombospondin-1", "protein", "M55", "0.5 \u03bcM", -6.301, "intrinsic", "ELISA", null, "24434496", "The K D value of the aptamer M55 binding to thrombospondin-1 was determined as 0.5 7 0.2 \u03bc M"], ["adenine", "protein", "R10A4", "5.000000000000001e-07 M", -6.301, "intrinsic", null, null, "38194356", "our R10A4 aptamer has a comparable K d of 500 nM"], ["CD19", "protein", "WB17/17.CD19.1_1S", "530.0 nM", -6.276, "non_intrinsic", "flow_cytometry", 277.15, "41079126", "WB17/17.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 530 \u00b1 1278 | 56 \u00b1 49"], ["mannose-capped lipoarabinomannan", "protein", "12th-round ssDNA pool", "537.5 nM", -6.27, "non_intrinsic", "ELONA", 310.15, "24572295", "The dissociation constant ( K d values) of the 12th-round pool was determined to be 537.5 \u00b1 69.98 nM"], ["Clenbuterol", "protein", "CLB-1", "5.61e-07 M", -6.251, "intrinsic", null, null, "42204903", "the apparent K d was 561 nM (Figure 3B)"], ["Hen egg white lysozyme", "protein", "DNA analog a3", "573.0 nM", -6.242, "intrinsic", null, null, "21167858", "The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 \u25e6 C are 378nM, 467nM and 573nM, respectively."], ["mouse IL-2", "protein", "M15", "600.0 nM", -6.222, "intrinsic", null, null, "35756119", "The calculation of the dissociation constant predicted 91 and 600 nM Kd for M20 and M15, respectively"], ["K-1 cells", "cell/EV", "Apta30", "0.66 \u00b5M", -6.18, "non_intrinsic", "flow_cytometry", 310.15, "40487293", "Apta30 ( K D -0.66 \u00b1 0.12 \u00b5 m)"], ["human \u03b2-defensin 2", "protein", "A ad1-2", "676.0 nM", -6.17, "intrinsic", null, null, "32067984", "a clone with a truncation at the 3 \u02b9 terminal (A ad1 -2 , 58mer, Fig. 4a) was found to bind more weakly to HBD-2 ( K d = 676 nM, Fig. 4b)."], ["CD71", "protein", "ATL", "696.7 nM", -6.157, "non_intrinsic", "flow_cytometry", 277.15, "41412185", "K(pH 7.5)= 696.7 \u00b1 68.03 nM"], ["HER3", "protein", "HBR", "700.0 nM", -6.155, "intrinsic", null, null, "33770580", "The dissociation constant ( K D) of HBR was calculated from the resulting BLI sensorgrams was 700 nM."], ["Alternariol", "protein", "AOH 6C", "701.0 nM", -6.154, "intrinsic", null, null, "34655971", "The apparent KD of AOH 6C, B-2-3 and T-23 were 701 nM, 445 nM and 274 nM, respectively"], ["Co2+", "protein", "Co-1", "7.310000000000001e-07 M", -6.136, "intrinsic", null, null, "40656531", "the Co-1 aptamer has a K d of 731 nM for Co 2+"], ["Dinophysistoxin", "protein", "anti-DTX parent aptamer", "778.1 nM", -6.109, "intrinsic", "BLI", null, "36322695", "antiDTX parent aptamer ( K d = 778.1 \u00b1 73.5 nM)"], ["IL4R\u03b1", "protein", "cl.42", "788.0 nM", -6.103, "non_intrinsic", "FACS", 310.15, "22282665", "with an apparent K d of 788 nM (Supplementary Fig. S3B)"], ["EpCAM", "protein", "TD05", "7.92e-07 M", -6.101, "apparent_cellular", null, null, "36856721", "TD05's K d value is 792 nM"], ["Clenbuterol", "protein", "CLB-1", "7.98e-07 M", -6.098, "intrinsic", null, null, "42204903", "CLB binding was preserved in the absence of Mg 2+ ( K d 798 nM)"], ["Clenbuterol", "protein", "CLB-1", "8.850000000000001e-07 M", -6.053, "intrinsic", null, null, "42204903", "ITC showed that the CLB-1 aptamer has a K d of 885 nM (Figure 3D)... The enthalpy ( \u0394 H = -24.9 kcal mol -1 ) and entropy ( \u0394 S = -55.9 cal K -1 mol -1 )"], ["Co2+", "protein", "Ni-4", "9.01e-07 M", -6.045, "intrinsic", null, null, "40656531", "Ni-4 exhibited a K d of 901 nM for Co 2+"], ["prothrombin", "protein", "HD1", "992.0 nM", -6.003, "intrinsic", "filter_binding", null, "41053535", "and prothrombin (K D = 992 nm)"], ["Thrombin", "protein", "aptamer 1S", "1.08e-06 M", -5.967, "intrinsic", "SPR", null, "32268723", "The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 \u03bcM and 29.4 nM, respectively"], ["CD117", "protein", "Apta04", "1100.0 nM", -5.959, "intrinsic", "BLI", 298.15, "40487293", "Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 \u00b5 m, respectively ( Figure 2 a,b)."], ["H-6 cells", "cell/EV", "Apta30", "1.107 \u00b5M", -5.956, "non_intrinsic", "flow_cytometry", 310.15, "40487293", "H-6 cells showed binding with ... Apta30 ( K D -1.107 \u00b1 0.208 \u00b5 m)"], ["CD123", "protein", "Apta25", "1.16 \u00b5M", -5.936, "intrinsic", "BLI", 298.15, "40487293", "BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 \u00b5 m for ZW25 and 15.6 \u00b5 m for CY30 (Figure S2, Supporting Information)."], ["Bisphenol A", "protein", "23-mer BPA aptamer", "1190.61 nM", -5.924, "intrinsic", null, null, "32113141", "The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM"], ["CD20", "protein", "Aptamer 2", "1.2 \u03bcM", -5.921, "intrinsic", "ITC", 298.15, "39004051", "| 2 | 1.2 \u00b1 0.2 | 1.49 \u00b1 0.01 | > mM | N/D |"], ["IL-8", "protein", "8A-30", "1.22e-06 M", -5.914, "intrinsic", "SPR", 298.0, "24129312", "| 8A-30       | 1.32 x 10 6 | 1.62         | 1.22 x 10 -6  | 4.62 x 10 -5 | 1.06 x 10 -3 |"], ["K-1 cells", "cell/EV", "Apta25", "1.358 \u00b5M", -5.867, "non_intrinsic", "flow_cytometry", 310.15, "40487293", "Apta25 ( K D value-1.358 \u00b1 0.201 \u00b5 m)"], ["bilirubin", "protein", "Brb7", "1.4e-06 M", -5.854, "intrinsic", "fluorescence", null, "40669049", "After titrating bilirubin into 1.0 \u03bcM Brb7 aptamer, the saturation fluorescence decrease reached 99% (Figure 6A) and its K d was fitted to be 1.4 \u03bcM"], ["Okadaic Acid", "protein", "anti-OA parent aptamer", "1402.0 nM", -5.853, "intrinsic", "BLI", null, "36322695", "anti-OA aptamer with high affinity from its parent aptamer ( K d = 1402 \u00b1 58 nM, Figure 1a)"], ["amikacin", "protein", "Aptamer A1", "1.5e-06 M", -5.824, "intrinsic", "ITC", 298.15, "36453647", "Aptamer A1 binds 7-fold stronger to amikacin with a K d  value of 1.5 \u03bcM"], ["domoic acid", "protein", "C1-s", "1.5e-06 M", -5.824, "intrinsic", null, null, "36421085", "BLI results showed that the affinity of C1-s ( K D value, 1.50 \u00d7 10 -6 M) and C1 for DAwas at an equivalent level."], ["thrombin", "protein", "TBA15", "1690.0 nM", -5.772, "intrinsic", null, null, "23850569", "The addition of 10% blood plasma to the working buffer changed the K D values significantly ( K D TBA 1\u20444 1690 nM  15 nM"], ["ESAT6/CFP10 fusion protein", "protein", "Aptamer 3 (core 21-nt)", "1.81e-06 M", -5.742, "intrinsic", null, null, "40359808", "retaining only the core 21-nucleotide sequence at the 5 \u2032 end results in a dramatic reduction of the K d value to 1.81E-6"], ["K-1 cells", "cell/EV", "Apta02", "1.821 \u00b5M", -5.74, "non_intrinsic", "flow_cytometry", 310.15, "40487293", "Apta02 ( K D value-1.821 \u00b1 0.117 \u00b5 m)"], ["K-1 cells", "cell/EV", "Apta04", "1.867 \u00b5M", -5.729, "non_intrinsic", "flow_cytometry", 310.15, "40487293", "Apta04 ( K D value-1.867 \u00b1 0.19 \u00b5 m)"], ["cRNA", "protein", "CRP-specific RNA aptamer", "1.98 \u03bcM", -5.703, "intrinsic", null, null, "22365749", "Binding kinetics as determined by incubating different target concentrations against constant number of aptamers immobilized on sensor surface showed the K d values of 1.98 and 2.4 \u03bcM for cRNA and CRP, respectively."], ["biliverdin", "protein", "Bvd1", "2e-06 M", -5.699, "intrinsic", "fluorescence", null, "40669049", "The same trend was also observed for the Bvd1 aptamer (Figure S1), and the fitted K d was 2.0 \u03bcM."], ["CTNNA1", "protein", "EA2", "2.07 \u00b5M", -5.684, "intrinsic", "MST", null, "40265971", "The K d values (2.07 \u00b1 0.60 \u00b5 M) obtained from MST assay (Figure 2l) further corroborated the specific binding between CTNNA1 and EA2."], ["verrucarin A", "protein", "14_Ver1", "2.2e-06 M", -5.658, "intrinsic", "fluorescence", null, "39404132", "The binding test demonstrated that the decrease in fluorescence was correlated with increasing verrucarin A concentration with K D = 2.2 \u03bcM."], ["verrucarin A", "protein", "Ver1_JYP (C32G mutant)", "2.2999999999999996e-06 M", -5.638, "intrinsic", "fluorescence", null, "39404132", "guanine with both functional groups exhibited partially recovered binding activity ( K D = 2.3 \u03bcM)."], ["C-reactive protein", "protein", "CRP-specific RNA aptamer", "2.4 \u03bcM", -5.62, "intrinsic", null, null, "22365749", "Binding kinetics as determined by incubating different target concentrations against constant number of aptamers immobilized on sensor surface showed the K d values of 1.98 and 2.4 \u03bcM for cRNA and CRP, respectively."], ["hemin", "protein", "Sequence D", "2.9 \u03bcM", -5.538, "intrinsic", "fluorescence", null, "40368877", "Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 \u03bc M for sequences C and D, respectively."], ["thrombin", "protein", "A4", "3040.0 nM", -5.517, "intrinsic", null, null, "23850569", "K D A4 1\u20444 3040 nM  65 nM"], ["swine C5a", "protein", "S1", "4.0 \u03bcM", -5.398, "intrinsic", null, null, "30336124", "Aptamer S1 bound specifically to swine C5a with a dissociation constant of 4 \u03bcM as measured by surface plasmon resonance (SPR)."], ["Brevetoxin-2", "protein", "Bap5", "4.83 uM", -5.316, "intrinsic", null, null, "28058132", "The Kd value for the binding between the Bap5 aptamer and BTX-2 was 4.83 uM"], ["H-9 cells", "cell/EV", "Apta02", "4.93 \u00b5M", -5.307, "non_intrinsic", "flow_cytometry", 310.15, "40487293", "H-9 cells showed binding with Apta02 ( K D value-4.93 \u00b1 0.367 \u00b5 m)"], ["K+", "protein", "Thrombin Binding Aptamer", "5000.0 nM", -5.301, "intrinsic", "mass_spectrometry", 298.15, "18318508", "the Kd determined from the bestfit curve is 5000 ( 1000 nM for the interaction of TBA and K +"], ["H-9 cells", "cell/EV", "Apta04", "5.402 \u00b5M", -5.267, "non_intrinsic", "flow_cytometry", 310.15, "40487293", "H-9 cells showed binding with ... Apta04 ( K D value-5.402 \u00b1 0.795 \u00b5 m)"], ["CD20", "protein", "Aptamer 2-f1", "5.5 \u03bcM", -5.26, "intrinsic", "ITC", 298.15, "39004051", "| 2-f1 | 5.5 \u00b1 1.3 | 1.46 \u00b1 0.03 | > mM | N/D |"], ["CD20", "protein", "Aptamer 1", "6.4 \u03bcM", -5.194, "intrinsic", "ITC", 298.15, "39004051", "| 1 | 6.4 \u00b1 1.0 | 0.86 \u00b1 0.01 | N/D | N/D |"], ["hemin", "protein", "Sequence C", "8.3 \u03bcM", -5.081, "intrinsic", "fluorescence", null, "40368877", "Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 \u03bc M for sequences C and D, respectively."], ["CD20", "protein", "Aptamer 1-f1", "9.0 \u03bcM", -5.046, "intrinsic", "ITC", 298.15, "39004051", "| 1-f1 | 9.0 \u00b1 2.4 | 0.98 \u00b1 0.02 | > mM | N/D |"], ["P-selectin", "protein", "NX244", "9000000.0 pM", -5.046, "intrinsic", "filter_binding", 310.15, "9743465", "NX244 | 9 X 106"], ["bilirubin", "protein", "Brb9", "9e-06 M", -5.046, "intrinsic", "fluorescence", null, "40669049", "The same trend was also observed in the Brb9 aptamer (Figure S4), which showed a K d of 9.0 \u03bcM."], ["amikacin", "protein", "Aptamer A", "9.999999999999999e-06 M", -5.0, "intrinsic", null, null, "36453647", "native Aptamer A, which has a K d  value of 10 \u03bcM"], ["Patulin", "protein", "PTL-1", "1.2499999999999999e-05 M", -4.903, "intrinsic", "ITC", 298.15, "41473783", "The measured K d from ITC value was 12.5 \u03bcM"], ["CD123", "protein", "Apta30", "15.6 \u00b5M", -4.807, "intrinsic", "BLI", 298.15, "40487293", "BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 \u00b5 m for ZW25 and 15.6 \u00b5 m for CY30 (Figure S2, Supporting Information)."], ["Patulin", "protein", "PTL-1", "1.8399999999999997e-05 M", -4.735, "intrinsic", "fluorescence", null, "41473783", "yielding an apparent K d of 18.4 \u03bcM"], ["CD20", "protein", "Aptamer 1-f2", "18.9 \u03bcM", -4.724, "intrinsic", "ITC", 298.15, "39004051", "| 1-f2 | 18.9 \u00b1 3.3 | 1.07 \u00b1 0.03 | > mM | N/D |"], ["dehydroepiandrosterone sulfate", "protein", "DHEAS aptamer (stem, Rp)", "32.03 \u03bcM", -4.494, "intrinsic", "fluorescence", null, "40368877", "Values calculated are 32.03 \u03bc M for stem Rp"], ["dehydroepiandrosterone sulfate", "protein", "DHEAS aptamer (loop, Rp)", "33.28 \u03bcM", -4.478, "intrinsic", "fluorescence", null, "40368877", "33.28 \u03bc M for loop Rp"], ["dehydroepiandrosterone sulfate", "protein", "DHEAS aptamer (stem, Sp)", "36.57 \u03bcM", -4.437, "intrinsic", "fluorescence", null, "40368877", "36.57 \u03bc M for stem Sp"], ["patulin", "protein", "PAT Rep", "4e-05 M", -4.398, "intrinsic", "SPR", null, "35546052", "PAT Rep showed a K D value of 4.0 \u00d7 10 -5 M"], ["Patulin", "protein", "PAT-6", "4.8e-05 M", -4.319, "intrinsic", "fluorescence", null, "41473783", "PAT-6 has weaker binding affinities ( Kd = 48 \u03bcM by ThT, Fig. 4S)"], ["thiamethoxam", "protein", "Thi-5R-18", "4.935e-05 M", -4.307, "intrinsic", null, null, "36831921", "According to the ITC results (Figure 5), the Kd value was 4.935 \u00d7 10 -5 Mfor Thi-5R-18 combined with the target to release heat"], ["dehydroepiandrosterone sulfate", "protein", "DHEAS aptamer (loop, Sp)", "59.62 \u03bcM", -4.225, "intrinsic", "fluorescence", null, "40368877", "59.62 \u03bc M for loop Sp"], ["YRLFRK", "protein", "BC 007", "86.7 \u03bcM", -4.062, "intrinsic", null, null, "33163683", "followed by YRLFRK with Kd = 86.7 \u03bcM"], ["L-lactate", "protein", "D-Lac1103", "8.999999999999999e-05 M", -4.046, "intrinsic", "fluorescence", null, "41779931", "The true K d for D-Lac1103 was calculated to be 0.09 mM for L-lactate"], ["L-lactate", "protein", "Lac2059", "0.00011 M", -3.959, "intrinsic", "ITC", 298.15, "41779931", "The K d from ITC was determined to be 0.11 mM"], ["L-lactate", "protein", "Lac201", "0.0009000000000000001 M", -3.046, "intrinsic", "fluorescence", 296.15, "41779931", "the fitted K d was 0.9 mM (Figure 5C, black line)"], ["D-lactate", "protein", "D-Lac1103", "0.0025 M", -2.602, "intrinsic", "fluorescence", 295.15, "41779931", "In addition, the apparent K d values for D-Lac1103 are 0.46 mMfor L-lactate and 2.5 mM for D-lactate"], ["Tris(hydroxymethyl)aminomethane", "protein", "Tris aptamer", "0.0026000000000000003 M", -2.585, "intrinsic", "fluorescence", null, "40905906", "ThT yielded K d values changed modestly from 1.6 to 2.6 mM"], ["L-lactate", "protein", "Lac2059", "0.0033 M", -2.481, "intrinsic", "fluorescence", 296.15, "41779931", "The fitted K d was 3.3 mM for this 2AP-labeled aptamer"], ["L-lactate", "protein", "Lac201", "0.0043 M", -2.367, "intrinsic", "fluorescence", 296.15, "41779931", "although the obtained K d (4.3 mM) was about 5-fold higher than that obtained using Mg 2+ ."], ["acrylamide", "protein", "AA-1", "0.0047 M", -2.328, "intrinsic", "fluorescence", null, "40261307", "Similarly, the AA-1 aptamer exhibited a true K d value of 4.7 mM via the strand-displacement assay"], ["acrylamide", "protein", "AA-1", "0.0105 M", -1.979, "intrinsic", "fluorescence", null, "40261307", "the fitted K d value was 10.5 mM"]], "truncated": false, "columns": ["target_name_canonical", "target_type", "aptamer_name", "kd_reported", "kd_log10_molar", "measurement_class", "assay_method", "assay_temperature_k", "source_pmid", "verbatim_quote"], "query": {"sql": "SELECT target_name_canonical, target_type, aptamer_name, kd_reported, kd_log10_molar, measurement_class, assay_method, assay_temperature_k, source_pmid, verbatim_quote FROM v_kd ORDER BY kd_log10_molar ASC", "params": {}}, "error": null, "private": false, "allow_execute_sql": true, "query_ms": 10.317672975361347, "source": "apt-scout automated curation pipeline (E. Dohi, NCNP) \u2014 values harvested from public databases; raw source stored per target", "source_url": "https://apt-scout.org", "license": "CC BY 4.0", "license_url": "https://creativecommons.org/licenses/by/4.0/"}