{"database": "scout", "table": "kd_measurements", "is_view": false, "human_description_en": "", "rows": [[1, "11178986", "Original pool", "sLe X -BSA", "Q9NSU2", "1.3e-07", "M", "-6.886", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00000", null, null, "intrinsic", "Original pool | 2.6 3 10 4 | 3.3 3 10 2 3 | 7.6 3 10 6 | 1.3 3 10 2 7", null, "v4", "no_single_sequence_pool", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [2, "11178986", "Selected pool", "sLe X -BSA", "Q9NSU2", "5.8e-10", "M", "-9.237", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00001", null, null, "intrinsic", "Selected pool | 2.4 3 10 5 | 1.4 3 10 2 3 | 1.7 3 10 9 | 5.8 3 10 2 10", null, "v4", "no_single_sequence_pool", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [3, "11178986", "Clone 5", "sLe X -BSA", "Q9NSU2", "8.5e-11", "M", "-10.071", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", "298.15", "1.0", "verified", "step2c_literal_v3", "r00002", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "intrinsic", "Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11", "original", "v4", "verified_in_text_or_SI", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [4, "11178986", "Clone 2", "sLe X -BSA", "Q9NSU2", "8e-10", "M", "-9.097", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00003", null, null, "intrinsic", "Clone 2 | 9.8 3 10 5 | 7.3 3 10 2 5 | 1.2 3 10 9 | 8.0 3 10 2 10", null, "v4", "pending_manual_figure", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [5, "11178986", "Clone 15", "sLe X -BSA", "Q9NSU2", "2.3e-09", "M", "-8.638", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00004", null, null, "intrinsic", "Clone 15 | 3.5 3 10 5 | 8.1 3 10 2 4 | 4.3 3 10 8 | 2.3 3 10 2 9", null, "v4", "pending_manual_figure", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [6, "11178986", "Clone 18", "sLe X -BSA", "Q9NSU2", "3.9e-09", "M", "-8.409", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00005", null, null, "intrinsic", "Clone 18 | 5.1 3 10 5 | 2.0 3 10 2 3 | 2.5 3 10 8 | 3.9 3 10 2 9", null, "v4", "pending_manual_figure", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [7, "11178986", "Clone 4", "sLe X -BSA", "Q9NSU2", "7.4e-09", "M", "-8.131", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00006", null, null, "intrinsic", "Clone 4 | 4.1 3 10 5 | 3.1 3 10 2 3 | 1.3 3 10 8 | 7.4 3 10 2 9", null, "v4", "pending_manual_figure", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [8, "11178986", "Clone 9", "sLe X -BSA", "Q9NSU2", "1e-08", "M", "-8.0", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00007", null, null, "intrinsic", "Clone 9 | 3.5 3 10 5 | 3.1 3 10 2 3 | 9.5 3 10 7 | 1.0 3 10 2 8", null, "v4", "pending_manual_figure", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [9, "11178986", "Clone 5", "sLe X -BSA", "Q9NSU2", "5.7e-11", "M", "-10.244", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", "298.15", "1.0", "verified", "step2c_literal_v3", "r00009", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "intrinsic", "sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11", "original", "v4", "verified_in_text_or_SI", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [10, "11178986", "Clone 5", "BSA", "O95870", "1e-07", "M", "-7.0", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00010", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "intrinsic", "BSA | 2.2 3 10 4 | 2.3 3 10 2 3 | 9.9 3 10 6 | 1.0 3 10 2 7", "original", "v4", "verified_in_text_or_SI", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [11, "11178986", "Clone 5", "sLe X", "Q9NSU2", "3.3e-09", "M", "-8.481", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00011", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "intrinsic", "sLe X | 1.7 3 10 5 | 5.5 3 10 2 4 | 3.0 3 10 8 | 3.3 3 10 2 9", "original", "v4", "verified_in_text_or_SI", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [12, "11178986", "Clone 5", "sLe A", "P0C0L4", "1.7e-08", "M", "-7.77", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00012", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "intrinsic", "sLe A | 1.2 3 10 3 | 1.9 3 10 2 5 | 5.9 3 10 7 | 1.7 3 10 2 8", "original", "v4", "verified_in_text_or_SI", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [13, "11178986", "Clone 5", "Le X", "O15496", "2.4e-08", "M", "-7.62", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00013", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "intrinsic", "Le X | 6.7 3 10 2 | 1.6 3 10 2 5 | 4.1 3 10 7 | 2.4 3 10 2 8", "original", "v4", "verified_in_text_or_SI", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [14, "11178986", "Clone 5", "Le A", "P00488", "1.4e-08", "M", "-7.854", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00014", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "intrinsic", "Le A | 7.3 3 10 2 | 1.0 3 10 2 5 | 7.2 3 10 7 | 1.4 3 10 2 8", "original", "v4", "verified_in_text_or_SI", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [15, "11178986", "Clone 5", "Lactose", "P00709", "2.9e-07", "M", "-6.538", "Kd", "RNA", null, "SPR", "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00015", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "intrinsic", "Lactose | 6.3 3 10 2 | 1.8 3 10 2 4 | 3.4 3 10 6 | 2.9 3 10 2 7", "original", "v4", "verified_in_text_or_SI", "KEEP_seq_in_figure", "True", "10.1006/bbrc.2001.4327"], [16, "16053288", "TBA", "thrombin", "P00734", "2.86e-09", "M", "-8.544", "Kd", "DNA", "biotin at 3' end; six-carbon spacer", "SPR", null, null, null, null, "verified", "step2c_literal_v3", "r00024", "GGTTGGTGTGGTTGG", "5'-GGTTGGTGTGGTTGG-3'", "intrinsic", "thrombin | 2.2 10 5 | 6.3 10 - 4 | 3.4 10 8 | 2.86 10 - 9", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1021/ac0502450"], [17, "16053288", "TBA", "thrombin-HRP", null, "1.13e-08", "M", "-7.947", "Kd", "DNA", "biotin at 3' end; six-carbon spacer", "SPR", null, null, null, null, "verified", "step2c_literal_v3", "r00025", "GGTTGGTGTGGTTGG", "5'-GGTTGGTGTGGTTGG-3'", "intrinsic", "thrombin-HRP | 6.7 10 4 | 7.6 10 - 4 | 8.7 10 7 | 1.13 10 - 8", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1021/ac0502450"], [18, "16725379", "APTA", "thrombin", "P00734", "88.0", "nM", "-7.056", "Kd", "DNA", "biotin at 3' end", "QCM", "140 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM MgCl2, 20 mM TRIS, pH 7.4", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00050", "GGGTTTTCACTTTTGTGGGTTGGACGGGATGG", "3'-GGG TTT TCA CTT TTG TGG GTT GGA CGG GAT GG-5'", "intrinsic", "APTA | 0.97\u00b10.45 | 86\u00b173 | 0.011\u00b10.006 | 88\u00b152", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1016/j.bioelechem.2006.03.012"], [19, "16725379", "LOOP", "thrombin", "P00734", "39.0", "nM", "-7.409", "Kd", "DNA", "biotin at 3' end", "QCM", "140 mM NaCl, 5 mM KCl, 1 mM CaCl2, 1 mM MgCl2, 20 mM TRIS, pH 7.4", "7.4", null, "1.0", "verified", "step2c_literal_v3", "r00051", "GGTTGGTGTGGTTGGCAACC", "5'-GGT TGGTGTGGTTGGCAACC-3'", "intrinsic", "LOOP | 3.27\u00b11.22 | 127\u00b1100 | 0.026\u00b10.018 | 39\u00b127", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1016/j.bioelechem.2006.03.012"], [20, "18318508", "Thrombin Binding Aptamer", "K+", "Q9UJ71", "5000.0", "nM", "-5.301", "Kd", "DNA", null, "mass_spectrometry", "25% MeOH and 0.50% NH4OH (v/v)", null, "298.15", null, "verified", "step2c_literal_v3", "r00065", "GGTTGGTGTGGTTGG", "GGT TGG TGT GGT TGG", "intrinsic", "the Kd determined from the bestfit curve is 5000 ( 1000 nM for the interaction of TBA and K +", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1021/ac701903w"], [21, "18318508", "Thrombin Binding Aptamer", "Sr2+", "P31213", "240.0", "nM", "-6.62", "Kd", "DNA", null, "mass_spectrometry", "25% MeOH and 0.50% NH4OH (v/v)", null, "298.15", null, "verified", "step2c_literal_v3", "r00066", "GGTTGGTGTGGTTGG", "GGT TGG TGT GGT TGG", "intrinsic", "the Kd determined from the best-fit curve is 240 ( 50 nM for the interaction of TBA and Sr 2 +", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1021/ac701903w"], [22, "18635004", "9.8", "murine OX40", null, "8.0", "nM", "-8.097", "Kd", "RNA", "2'F-pyrimidine", "filter_binding", "20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2", "7.4", null, null, "verified", "step2c_literal_v3", "r00068", "GGGAGGACGATGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCACAGACGACTCGCTGAGGATCCGAGA", "GGGAGGACGATGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCACAGA CGACTCGCTGAGGATCCGAGA", "intrinsic", "Aptamer 9.8 was chosen for further study, since it had the highest affinity for the OX40 fusion protein.", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1016/j.chembiol.2008.05.016"], [23, "18635004", "11.2", "murine OX40", null, "25.0", "nM", "-7.602", "Kd", "RNA", "2'F-pyrimidine", "filter_binding", "20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2", "7.4", null, null, "verified", "step2c_literal_v3", "r00069", "GGGAGGACGATGCGGGAUACCAGGAUCACAUCCUGAGGAACCCCGGCUCCCAACCUAGACGACTCGCTGAGGATCCGAGA", "GGGAGGACGATGCGGGAUACCAGGAUCACAUCCUGAGGAACCCCGGCUCCCAACCUAGA CGACTCGCTGAGGATCCGAGA", "intrinsic", "11.2 | AUACCAGGAUCACAUCCUGAGGAACCCCGGCUCCCAACCU | 25 | 4", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1016/j.chembiol.2008.05.016"], [24, "18635004", "11.4", "murine OX40", null, "25.0", "nM", "-7.602", "Kd", "RNA", "2'F-pyrimidine", "filter_binding", "20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2", "7.4", null, null, "verified", "step2c_literal_v3", "r00070", "GGGAGGACGATGCGGACUUUAAUCCUCGCACUCAGCGCGCAUCACCCUUGACAUCAAGACGACTCGCTGAGGATCCGAGA", "GGGAGGACGATGCGGACUUUAAUCCUCGCACUCAGCGCGCAUCACCCUUGACAUCAAGA CGACTCGCTGAGGATCCGAGA", "intrinsic", "11.4 | CUUUAAUCCUCGCACUCAGCGCGCAUCACCCUUGACAUCA | 25 | 5", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1016/j.chembiol.2008.05.016"], [25, "18635004", "9.3", "murine OX40", null, "25.0", "nM", "-7.602", "Kd", "RNA", "2'F-pyrimidine", "filter_binding", "20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2", "7.4", null, null, "verified", "step2c_literal_v3", "r00071", "GGGAGGACGATGCGGACAAACCAGCUAUUUCCUGAGGUACCCCGGCUCUCCAUGGAGACGACTCGCTGAGGATCCGAGA", "GGGAGGACGATGCGGACAAACCAGCUAUUUCCUGAGGUACCCCGGCUCUCCAUGGAGA CGACTCGCTGAGGATCCGAGA", "intrinsic", "9.3 | CAAACCAGCUAUUUCCUGAGGUACCCCGGCUCUCCAUGG | 25 | 4", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1016/j.chembiol.2008.05.016"], [26, "18635004", "11.8", "murine OX40", null, "50.0", "nM", "-7.301", "Kd", "RNA", "2'F-pyrimidine", "filter_binding", "20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2", "7.4", null, null, "verified", "step2c_literal_v3", "r00072", "GGGAGGACGATGCGGAUACCAGCGAAUAACUCGCUGAGGAACCCGACUCACAAAAGACGACTCGCTGAGGATCCGAGA", "GGGAGGACGATGCGGAUACCAGCGAAUAACUCGCUGAGGAACCCGACUCACAAAAGA CGACTCGCTGAGGATCCGAGA", "intrinsic", "11.8 | AUACCAGCGAAUAACUCGCUGAGGAACCCGACUCACAAA | 50 | 1", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1016/j.chembiol.2008.05.016"], [27, "18826387", "HD1-22", "prothrombin", "P00734", "6.1e-08", "M", "-7.215", "Kd", "DNA", "bivalent fusion; poly-dA linker", "SPR", null, null, null, null, "verified", "step2c_literal_v3", "r00079", "GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT", "5\u2032-GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT-3\u2032", "intrinsic", "HD1-22 | Prothrombin | K D ( M) | 6.1 \u00b7 10 ) 8", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1111/j.1538-7836.2008.03162.x"], [28, "18826387", "HD1", "thrombin", "P00734", "7.1e-09", "M", "-8.149", "Kd", "DNA", null, "SPR", null, null, null, null, "verified", "step2c_literal_v3", "r00081", "GGTTGGTGTGGTTGG", "5\u2032-GGTTGGTGTGGTTGG-3\u2032", "intrinsic", "HD1 | Thrombin | K D ( M) | 7.1 \u00b7 10 ) 9", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1111/j.1538-7836.2008.03162.x"], [29, "18826387", "HD1", "prothrombin", "P00734", "7.8e-08", "M", "-7.108", "Kd", "DNA", null, "SPR", null, null, null, null, "verified", "step2c_literal_v3", "r00082", "GGTTGGTGTGGTTGG", "5\u2032-GGTTGGTGTGGTTGG-3\u2032", "intrinsic", "HD1 | Prothrombin | K D ( M) | 7.8 \u00b7 10 ) 8", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1111/j.1538-7836.2008.03162.x"], [30, "18826387", "HD22", "thrombin", "P00734", "2.4e-09", "M", "-8.62", "Kd", "DNA", null, "SPR", null, null, null, null, "verified", "step2c_literal_v3", "r00084", "AGTCCGTGGTAGGGCAGGTTGGGGTGACT", "5\u2032-AGTCCGTGGTAGGGCAGGTTGGGGTGACT-3\u2032", "intrinsic", "HD22 | Thrombin | K D ( M) | 2.4 \u00b7 10 ) 9", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1111/j.1538-7836.2008.03162.x"], [31, "19422452", "ARC1779", "VWF A1-domain", "P04275", "2.0", "nM", "-8.699", "Kd", "DNA/RNA", "2'-O-methyl; phosphorothioate; inverted deoxythymidine; 20-kDa PEG conjugation", "filter_binding", "Dulbecco's PBS containing 0.1 mg mL-1 BSA", null, "298.15", null, "verified", "step2c_literal_v3", "r00088", null, null, "intrinsic", "This resulted in a final aptamer (ARC1779) that is a 40-nucleotide modified DNA/RNA oligonucleotide with a K D of 2 nM for the A1-domain.", null, "v4", "pending_manual_figure", null, "True", "10.1111/j.1538-7836.2009.03459.x"], [32, "22032342", "Bock", "human \u03b1-thrombin", "P00734", "5.96", "nM", "-8.225", "Kd", "DNA", null, "BSI", "50 mM TRIS buffer (pH 7.5) containing 100 mM NaCl and 1 mM MgCl2", "7.5", "283.15", "1.0", "verified", "step2c_literal_v3", "r00158", "GGTTGGTGTGGTTGG", "5'-GGTTGGTGTGGTTGG-3'", "intrinsic", "Bock - thrombin | 1.4 - 6.2 nM 19 | 5.96 ( 0.57 nM", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1021/ac202823m"], [33, "22032342", "Bock", "Tasset - thrombin complex", null, "0.87", "nM", "-9.06", "Kd", "DNA", null, "BSI", "50 mM TRIS buffer (pH 7.5) containing 100 mM NaCl and 1 mM MgCl2", "7.5", "283.15", "1.0", "verified", "step2c_literal_v3", "r00159", "GGTTGGTGTGGTTGG", "5'-GGTTGGTGTGGTTGG-3'", "intrinsic", "Bock - [Tasset complex] | not available | 0.87 ( 0.18 nM", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1021/ac202823m"], [34, "22032342", "Tasset", "human \u03b1-thrombin", "P00734", "3.84", "nM", "-8.416", "Kd", "DNA", null, "BSI", "50 mM TRIS buffer (pH 7.5) containing 100 mM NaCl and 1 mM MgCl2", "7.5", "283.15", "1.0", "verified", "step2c_literal_v3", "r00160", "CAGTCCGTGGTAGGGCAGGTTGGGGTGACTTCGTGGAA", "5'-CAGTCCGTGGTAGGGCAGGTTGGGG TGACTTCGTGGAA-3'", "intrinsic", "Tasset - thrombin | 0.5 - 1.0 nM 14 | 3.84 ( 0.68 nM", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1021/ac202823m"], [35, "22032342", "Tasset", "Bock - thrombin complex", "Q86YV9", "1.9", "nM", "-8.721", "Kd", "DNA", null, "BSI", "50 mM TRIS buffer (pH 7.5) containing 100 mM NaCl and 1 mM MgCl2", "7.5", "283.15", "1.0", "verified", "step2c_literal_v3", "r00161", "CAGTCCGTGGTAGGGCAGGTTGGGGTGACTTCGTGGAA", "5'-CAGTCCGTGGTAGGGCAGGTTGGGG TGACTTCGTGGAA-3'", "intrinsic", "Tasset - [Bock complex] | not available | 1.9 ( 0.2 nM", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1021/ac202823m"], [36, "22282665", "cl.42", "IL4R\u03b1", null, "14.0", "nM", "-7.854", "Kd", "RNA", "2'-fluoro-pyrimidines; biotin-conjugated tetranucleotide at 3' terminus", "FACS", null, null, null, null, "verified", "step2c_literal_v3", "r00164", "TCCCCAACACATTGTCAGCCAAAACGCGAACGAAACCCCG", null, "intrinsic", "The calculated K d (14 nM, Fig. 2D) was within the range of anti -IL4R a antibodies", "backfill_text_verified", "v4", "verified_in_text_or_SI", null, "True", "10.1158/0008-5472.CAN-11-2772"], [37, "22385910", "RNAR9D-14T", "prothrombin", "P00734", "10.0", "nM", "-8.0", "Kd", "2'F-RNA", "2' Fluorocytosine; 2' Fluorouracil", "filter_binding", "Hepes-saline buffer with 0.01% BSA", "7.4", "310.15", null, "verified", "step2c_literal_v3", "r00210", "GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC", "5'-GG(2'F-C)GG(2'F-U)(2'F-C)GA(2'F-U)(2'F-C)A(2'F-C)A(2'F-C)AG(2'F-U)(2'F-U)(2'F-C)AAA(2'F-C)G(2'F-U)AA(2'F-U)AAG(2'F-C)(2'F-C)AA(2'F-U)G(2'F-U)A(2'F-C)GAGG(2'F-C)AGA(2'F-C)GA(2'F-C)(2'F-U)(2'F-C)G(2'F-C)(2'F-C)-3'", "intrinsic", "Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM)", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1111/j.1538-7836.2012.04679.x"], [38, "22385910", "RNAR9D-14T", "alpha-thrombin", "P05154", "1.0", "nM", "-9.0", "Kd", "2'F-RNA", "2' Fluorocytosine; 2' Fluorouracil", "filter_binding", "Hepes-saline buffer with 0.01% BSA", "7.4", "310.15", null, "verified", "step2c_literal_v3", "r00211", "GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC", "5'-GG(2'F-C)GG(2'F-U)(2'F-C)GA(2'F-U)(2'F-C)A(2'F-C)A(2'F-C)AG(2'F-U)(2'F-U)(2'F-C)AAA(2'F-C)G(2'F-U)AA(2'F-U)AAG(2'F-C)(2'F-C)AA(2'F-U)G(2'F-U)A(2'F-C)GAGG(2'F-C)AGA(2'F-C)GA(2'F-C)(2'F-U)(2'F-C)G(2'F-C)(2'F-C)-3'", "intrinsic", "Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) and \u03b1-thrombin (apparent Kd =1 nM)", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1111/j.1538-7836.2012.04679.x"], [39, "22385910", "RNAR9D-14T", "prothrombin", "P00734", "1.4", "nM", "-8.854", "Kd", "2'F-RNA", "2' Fluorocytosine; 2' Fluorouracil", "SPR", "Hepes-saline buffer", "7.4", "298.15", null, "verified", "step2c_literal_v3", "r00212", "GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC", "5'-GG(2'F-C)GG(2'F-U)(2'F-C)GA(2'F-U)(2'F-C)A(2'F-C)A(2'F-C)AG(2'F-U)(2'F-U)(2'F-C)AAA(2'F-C)G(2'F-U)AA(2'F-U)AAG(2'F-C)(2'F-C)AA(2'F-U)G(2'F-U)A(2'F-C)GAGG(2'F-C)AGA(2'F-C)GA(2'F-C)(2'F-U)(2'F-C)G(2'F-C)(2'F-C)-3'", "intrinsic", "Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1111/j.1538-7836.2012.04679.x"], [40, "22385910", "ARC-183", "prothrombin", "P00734", "60.7", "nM", "-7.217", "Kd", "DNA", null, "SPR", "Hepes-saline buffer", "7.4", "298.15", null, "verified", "step2c_literal_v3", "r00213", "GGTTGGTGTGGTTGG", "5'-GGTTGGTGTGGTTGG-3'", "intrinsic", "Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM and ARC-183 = 60.7 nM)", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1111/j.1538-7836.2012.04679.x"], [41, "23113766", "9C7", "hOX40", null, "1.7", "nM", "-8.77", "Kd", "2'F-RNA", null, "filter_binding", "selection buffer F (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2, and 0.01% BSA)", "7.5", "310.15", null, "verified", "step2c_literal_v3", "r00229", "GGGAGGACGATGCGGAAAAAAGAACACUUCCGAUUAGGGCCCACCCUAACGGCCGCAGACGACTCGCCCGA", "5'-GGGAGGACGATGCGG-AAAAAAGAACAC-UUCCGAUUAGGGCCCACCCUAACGGC-CG-CAGACGACTCGCCCGA-3'", "intrinsic", "9C7 | 11 | 1.7", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1089/nat.2012.0388"], [42, "23113766", "11F11", "hOX40", null, "10.0", "nM", "-8.0", "Kd", "2'F-RNA", null, "filter_binding", "selection buffer F (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2, and 0.01% BSA)", "7.5", "310.15", null, "verified", "step2c_literal_v3", "r00230", "GGGAGGACGATGCGGAACGGGACCACCCAUGCCAGGGGACCACCUCAGGCAGCGCCAGACGAC", "5'-GGGAGGACGATGCGG-AACGG-GACCACCCAUGCC-AGGGGACCACCUCA-GGCAGCGC-CAGACGAC-3'", "intrinsic", "11F11 | 8 | 10", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1089/nat.2012.0388"], [43, "23113766", "9C7T", "hOX40", null, "29.0", "nM", "-7.538", "Kd", "2'F-RNA", "5'-biotin", "filter_binding", "selection buffer F (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2, and 0.01% BSA)", "7.5", "310.15", null, "verified", "step2c_literal_v3", "r00232", "GGGGGAATTCTAATACGACTCACTATAGGGATGCGGAAAAAAGAACACT", null, "intrinsic", "observed Kd of * 29nM", "backfill_text_verified", "v4", "verified_in_text_or_SI", null, "True", "10.1089/nat.2012.0388"], [44, "24129312", "8A-35", "IL-8", "P10145", "1.72e-12", "M", "-11.764", "Kd", "2'F-RNA", "2'-fluoro-pyrimidine modified", "SPR", "HBST running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, and 0.005% Tween 20)", "7.4", "298.0", null, "verified", "step2c_literal_v3", "r00292", "GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC", "5'-GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC-3'", "intrinsic", "| 8A-35       | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80         | 3.11 x 10 1  |", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1016/j.biomaterials.2013.09.107"], [45, "24129312", "8A-30", "IL-8", "P10145", "1.22e-06", "M", "-5.914", "Kd", "2'F-RNA", "2'-fluoro-pyrimidine modified", "SPR", "HBST running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, and 0.005% Tween 20)", "7.4", "298.0", null, "verified", "step2c_literal_v3", "r00294", "GGGUUAUCAUUCCAUUUAGUGUUAUGAUAA", "5'-GGGUUAUCAUUCCAUUUAGUGUUAUGAUAA-3'", "intrinsic", "| 8A-30       | 1.32 x 10 6 | 1.62         | 1.22 x 10 -6  | 4.62 x 10 -5 | 1.06 x 10 -3 |", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1016/j.biomaterials.2013.09.107"], [46, "24434496", "M55", "thrombospondin-1", "P07996", "0.5", "\u03bcM", "-6.301", "Kd", "DNA", "5'-NH2; 5'-8-carbon PEG spacer; 3'-dT", "ELISA", "PBS", null, null, null, "verified", "step2c_literal_v3", "r00301", "ATACCAGCTTATTCAATTCCCAAATTGCCACCACTTACAGCATGATAACATACTACATCTTTTCATCAAGATAGTAAGTGCAATCT", "5'-ATA CCA GCT TAT TCA ATT CCC AAA TTG CCA CCA CTT ACA GCA TGA TAA CAT ACT ACA TCT TTT CAT CAA GAT AGT AAG TGC AAT CT-3'", "intrinsic", "The K D value of the aptamer M55 binding to thrombospondin-1 was determined as 0.5 7 0.2 \u03bc M", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1016/j.bios.2013.12.012"], [47, "24566984", "Gint4.T", "PDGFR \u03b2", "P09619", "9.6", "nM", "-8.018", "Kd", "2'F-RNA", "2'-fluoropyrimidine; nuclease-resistant", "filter_binding", null, null, null, null, "verified", "step2c_literal_v3", "r00304", "UGUCGUGGGGCAUCGAGUAAAUGCAAUUCGACA", "5\u2032 UGUCGUGGGGCAUCGAGUAAAUGCAAUU CGACA3\u2032", "intrinsic", "This aptamer is able to specifically bind to the human PDGFR \u03b2 ectodomain (Kd: 9.6 nM)", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1038/mt.2013.300"], [48, "24572295", "ZXL1", "mannose-capped lipoarabinomannan", null, "436.3", "nM", "-6.36", "Kd", "DNA", "biotin-labeled", "ELONA", "phosphate-buffered saline", null, "310.15", null, "verified", "step2c_literal_v3", "r00306", null, null, "intrinsic", "The K d of 436.3 \u00b1 37.84 nM was established as described in the Methods section.", null, "v4", "pending_manual_supp", null, "True", "10.1038/mt.2014.31"], [49, "24723743", "PDGF-specific aptamer", "PDGF-BB", "P01127", "1.2e-09", "M", "-8.921", "Kd", "DNA", "3'-3'-linked thymidine nucleotide ([3'T]); thiolated 5'-end", "microcantilever", "PBSM buffer (10.1 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, and 1 mM MgCl2, pH 7.4)", "7.4", "292.15", "1.0", "verified", "step2c_literal_v3", "r00312", null, null, "intrinsic", "K d , as shown in Fig. 10, decreased from approximately 12 \u00d7 10 -10 M to 5 \u00d7 10 -10 M as the temperature changed from 19 to 37 \u25e6 C.", null, "v4", "pending_manual_figure", null, "True", "10.1016/j.snb.2012.02.045"], [50, "24723743", "PDGF-specific aptamer", "PDGF-BB", "P01127", "5e-10", "M", "-9.301", "Kd", "DNA", "3'-3'-linked thymidine nucleotide ([3'T]); thiolated 5'-end", "microcantilever", "PBSM buffer (10.1 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, and 1 mM MgCl2, pH 7.4)", "7.4", "310.15", "1.0", "verified", "step2c_literal_v3", "r00313", null, null, "intrinsic", "K d , as shown in Fig. 10, decreased from approximately 12 \u00d7 10 -10 M to 5 \u00d7 10 -10 M as the temperature changed from 19 to 37 \u25e6 C.", null, "v4", "pending_manual_figure", null, "True", "10.1016/j.snb.2012.02.045"]], "truncated": false, "filtered_table_rows_count": 743, "expanded_columns": [], "expandable_columns": [], "columns": ["id", "source_pmid", "aptamer_name", "target_name_canonical", "target_uniprot", "kd_value", "kd_unit", "kd_log10_molar", "binding_constant_type", "aptamer_chemistry", "aptamer_modifications", "assay_method", "assay_buffer", "assay_ph", "assay_temperature_k", "assay_cations", "verification_status", "source_db", "source_record_id", "aptamer_seq", "aptamer_seq_raw", "measurement_class", "verbatim_quote", "seq_source", "tier", "sequence_status", "pi_provenance_flag", "include_in_gold", "doi"], "primary_keys": ["id"], "units": {}, "query": {"sql": "select id, source_pmid, aptamer_name, target_name_canonical, target_uniprot, kd_value, kd_unit, kd_log10_molar, binding_constant_type, aptamer_chemistry, aptamer_modifications, assay_method, assay_buffer, assay_ph, assay_temperature_k, assay_cations, verification_status, source_db, source_record_id, aptamer_seq, aptamer_seq_raw, measurement_class, verbatim_quote, seq_source, tier, sequence_status, pi_provenance_flag, include_in_gold, doi from kd_measurements order by id limit 51", "params": {}}, "facet_results": {}, "suggested_facets": [{"name": "kd_unit", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=kd_unit"}, {"name": "binding_constant_type", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=binding_constant_type"}, {"name": "aptamer_chemistry", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=aptamer_chemistry"}, {"name": "assay_method", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=assay_method"}, {"name": "assay_ph", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=assay_ph"}, {"name": "assay_temperature_k", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=assay_temperature_k"}, {"name": "assay_cations", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=assay_cations"}, {"name": "verification_status", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=verification_status"}, {"name": "source_db", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=source_db"}, {"name": "measurement_class", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=measurement_class"}, {"name": "seq_source", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=seq_source"}, {"name": "tier", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=tier"}, {"name": "sequence_status", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=sequence_status"}, {"name": "pi_provenance_flag", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=pi_provenance_flag"}, {"name": "include_in_gold", "toggle_url": "https://apt-scout.org/scout/kd_measurements.json?_facet=include_in_gold"}], "next": "50", "next_url": "https://apt-scout.org/scout/kd_measurements.json?_next=50", "private": false, "allow_execute_sql": true, "query_ms": 43.09214325621724, "source": "apt-scout automated curation pipeline (E. Dohi, NCNP) \u2014 values harvested from public databases; raw source stored per target", "source_url": "https://apt-scout.org", "license": "CC BY 4.0", "license_url": "https://creativecommons.org/licenses/by/4.0/"}