{"database": "scout", "table": "kd_measurements", "rows": [[46, "24434496", "M55", "thrombospondin-1", "P07996", "0.5", "\u03bcM", "-6.301", "Kd", "DNA", "5'-NH2; 5'-8-carbon PEG spacer; 3'-dT", "ELISA", "PBS", null, null, null, "verified", "step2c_literal_v3", "r00301", "ATACCAGCTTATTCAATTCCCAAATTGCCACCACTTACAGCATGATAACATACTACATCTTTTCATCAAGATAGTAAGTGCAATCT", "5'-ATA CCA GCT TAT TCA ATT CCC AAA TTG CCA CCA CTT ACA GCA TGA TAA CAT ACT ACA TCT TTT CAT CAA GAT AGT AAG TGC AAT CT-3'", "intrinsic", "The K D value of the aptamer M55 binding to thrombospondin-1 was determined as 0.5 7 0.2 \u03bc M", "original", "v4", "verified_in_text_or_SI", null, "True", "10.1016/j.bios.2013.12.012"]], "columns": ["id", "source_pmid", "aptamer_name", "target_name_canonical", "target_uniprot", "kd_value", "kd_unit", "kd_log10_molar", "binding_constant_type", "aptamer_chemistry", "aptamer_modifications", "assay_method", "assay_buffer", "assay_ph", "assay_temperature_k", "assay_cations", "verification_status", "source_db", "source_record_id", "aptamer_seq", "aptamer_seq_raw", "measurement_class", "verbatim_quote", "seq_source", "tier", "sequence_status", "pi_provenance_flag", "include_in_gold", "doi"], "primary_keys": ["id"], "primary_key_values": ["46"], "units": {}, "query_ms": 0.9187040850520134, "source": "apt-scout automated curation pipeline (E. Dohi, NCNP) \u2014 values harvested from public databases; raw source stored per target", "source_url": "https://apt-scout.org", "license": "CC BY 4.0", "license_url": "https://creativecommons.org/licenses/by/4.0/"}