id,target_name_canonical,target_type,target_uniprot,aptamer_name,aptamer_seq,kd_reported,kd_log10_molar,measurement_class,binding_constant_type,tier,source_origin,verification_level,sequence_status,seq_source,pi_provenance_flag,assay_method,assay_temperature_k,assay_ph,assay_buffer,assay_cations,aptamer_chemistry,aptamer_modifications,source_pmid,doi,verbatim_quote,source_db
363,HBcAg,protein,,A-9,AGCAGCACAGAGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCTACCGTGAA,2.0000000000000003e-10 M,-9.699,intrinsic,Kd,Gold,v4,multi_agent_verified,verified_in_text_or_SI,original,,affinity_real_time_qPCR,,,,,DNA,,32250595,10.1021/acs.analchem.9b05740,This aptamer showed strong binding to HBcAg ( K d : 0.2 nM),step2c_acs_v1
358,HBeAg,protein,,EAg3-Py,TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGAGATGTTTGGTTTT,4.0000000000000007e-10 M,-9.398,intrinsic,Kd,Gold,v4,multi_agent_verified,verified_in_text_or_SI,original,,affinity_real_time_qPCR,,7.4,"1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)",,DNA,pyrrolo-dC,32250595,10.1021/acs.analchem.9b05740,The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3,step2c_acs_v1
356,HBeAg,protein,,A-9S,ACTTTTTTGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCT,1.2e-09 M,-8.921,intrinsic,Kd,Gold,v4,multi_agent_verified,verified_in_text_or_SI,original,,affinity_real_time_qPCR,,7.4,"1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)",,DNA,/5AmMC6/,32250595,10.1021/acs.analchem.9b05740,The measured dissociation constant ( K d) is improved by 19 times  from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.,step2c_acs_v1
359,HBeAg,protein,,EAg3,TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGAGATGTTTGGTTTT,1.7000000000000001e-09 M,-8.77,intrinsic,Kd,Gold,v4,multi_agent_verified,verified_in_text_or_SI,original,,affinity_real_time_qPCR,,7.4,"1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)",,DNA,,32250595,10.1021/acs.analchem.9b05740,"The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3, as compared to the K d value of 1.7 nM with the unmodi fi ed EAg3 aptamer.",step2c_acs_v1
362,HBeAg,protein,,EAg2,TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGTGTAGATTGGAAAA,9.2e-09 M,-8.036,intrinsic,Kd,Gold,v4,multi_agent_verified,verified_in_text_or_SI,original,,affinity_real_time_qPCR,,7.4,"1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)",,DNA,,32250595,10.1021/acs.analchem.9b05740,"A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1, 9.2 nM for EAg2",step2c_acs_v1
361,HBeAg,protein,,EAg1,TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGTGTAGATTGGTTTT,9.5e-09 M,-8.022,intrinsic,Kd,Gold,v4,multi_agent_verified,verified_in_text_or_SI,original,,affinity_real_time_qPCR,,7.4,"1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)",,DNA,,32250595,10.1021/acs.analchem.9b05740,"A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1",step2c_acs_v1
357,HBeAg,protein,,A-9,AGCAGCACAGAGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCTACCGTGAA,2.29e-08 M,-7.64,intrinsic,Kd,Gold,v4,multi_agent_verified,verified_in_text_or_SI,original,,affinity_real_time_qPCR,,7.4,"1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)",,DNA,,32250595,10.1021/acs.analchem.9b05740,The measured dissociation constant ( K d) is improved by 19 times  from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.,step2c_acs_v1
360,HBeAg,protein,,EAg0,TTTTTTTTGGGCGAAGACCGGGACGGGAGGATTCTGTAGATTGGTTTT,4.4200000000000005e-08 M,-7.355,intrinsic,Kd,Gold,v4,multi_agent_verified,verified_in_text_or_SI,original,,affinity_real_time_qPCR,,7.4,"1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)",,DNA,,32250595,10.1021/acs.analchem.9b05740,A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0,step2c_acs_v1