{"database": "scout", "table": "v_kd", "is_view": true, "human_description_en": "sorted by kd_log10_molar", "rows": [[188, "PDGF-BB", "protein", "P01127", "36aApt", null, "0.036 pM", -13.444, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "ELISA", 298.0, null, null, null, "DNA", null, "28825469", "10.1021/acscombsci.6b00163", "36aApt | 0.036 \u00b1 0.012 | - 18.33", "step2c_literal_v3"], [186, "PDGF-BB", "protein", "P01127", "38aApt", null, "0.094 pM", -13.027, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "ELISA", 298.0, null, null, null, "DNA", null, "28825469", "10.1021/acscombsci.6b00163", "38aApt | 0.094 \u00b1 0.008 | - 17.76", "step2c_literal_v3"], [44, "IL-8", "protein", "P10145", "8A-35", "GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC", "1.72e-12 M", -11.764, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.0, 7.4, "HBST running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, and 0.005% Tween 20)", null, "2'F-RNA", "2'-fluoro-pyrimidine modified", "24129312", "10.1016/j.biomaterials.2013.09.107", "| 8A-35       | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80         | 3.11 x 10 1  |", "step2c_literal_v3"], [598, "human \u03b1-Thrombin", "protein", "P00734", "A1", null, "2.0 pM", -11.699, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "pending_manual_supp", null, null, null, null, null, "text", null, null, null, "31129134", "10.1016/j.ab.2019.05.012", "Also for aptamer A1 we measured with MST KD values in the pico- and nanomolar range (2 pM and 52 nM). The lowest KD value is determined with MST (shown as bar) for aptamer A1, which is 2 pM.", "elsevier_step2c"], [406, "SARS-CoV-2 spike protein (wild type)", "protein", null, "DSA1N5", null, "3e-12 M", -11.523, "avidity_multivalent", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "dot_blot", null, null, "undiluted wastewater", null, "DNA", "dimeric", "36926840", "10.1021/acssensors.2c02655", "DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B).", "step2c_acs_v1"], [621, "nucleolin", "protein", "P19338", "Cy5-AT11-B0", "TGGTGGTGGTTGGTGGTGGTGGTGGT", "3.3e-12 M", -11.481, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "31301466", "10.1016/j.ijpharm.2019.118511", "yielding K D values of 5.2 \u00d7 10 -12 and 3.3 \u00d7 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8", "elsevier_step2c"], [208, "SW480 cells", "cell/EV", "Q16520", "Apt-nanovesicle", null, "3.66 pM", -11.437, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, null, null, null, null, null, "DNA", "cholesterol; multivalent", "32049531", "10.1021/jacs.9b13782", "The dissociation constant ( K d ) value of Apt-nanovesicle against SW480 cells was found to be 3.66 \u00b1 0.34 pM (Figure 2B)", "step2c_literal_v3"], [743, "SARS-CoV-2 spike protein (wild type)", "protein", null, "DSA1N5", null, "3.9e-12 M", -11.409, "avidity_multivalent", "Kd", "Gold", "ACS", "multi_agent_verified", "pending_manual_supp", null, null, "dot_blot", null, null, "undiluted wastewater", null, "DNA", "dimeric", "36926840", "10.1021/acssensors.2c02655", "DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B).", "step2c_acs_v1"], [404, "SARS-CoV-2 pseudotyped lentivirus (omicron variant)", "protein", null, "DSA1N5", null, "4.8e-12 M", -11.319, "avidity_multivalent", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "dot_blot", null, null, "deionized water", null, "DNA", "dimeric", "36926840", "10.1021/acssensors.2c02655", "This study demonstrates that DSA1N5 has high affinity for recognizing OMPV with a K d value of 4.8 pM, which is in the same order of magnitude as that measured for the WTPV (2.1 pM) in deionized water (DI water)", "step2c_acs_v1"], [405, "SARS-CoV-2 pseudotyped lentivirus (omicron variant)", "protein", null, "DSA1N5", null, "5.1e-12 M", -11.292, "avidity_multivalent", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "dot_blot", null, null, "wastewater (diluted 50% with binding buffer)", null, "DNA", "dimeric", "36926840", "10.1021/acssensors.2c02655", "DSA1N5 preserves its binding affinity in 50% wastewater ( K d = 2.1 -4.1 pM for WTPV and 5.1 for OMPV in wastewater).", "step2c_acs_v1"], [620, "nucleolin", "protein", "P19338", "Cy5-AT11", "TGGTGGTGGTTGTTGTGGTGGTGGTGGT", "5.2e-12 M", -11.284, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "31301466", "10.1016/j.ijpharm.2019.118511", "yielding K D values of 5.2 \u00d7 10 -12 and 3.3 \u00d7 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8", "elsevier_step2c"], [184, "PDGF-BB", "protein", "P01127", "FullApt", null, "5.33 pM", -11.273, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "ELISA", 298.0, null, null, null, "DNA", null, "28825469", "10.1021/acscombsci.6b00163", "FullApt | 5.33 \u00b1 2.36 | - 15.37", "step2c_literal_v3"], [185, "PDGF-BB", "protein", "P01127", "40Apt", null, "5.92 pM", -11.228, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "ELISA", 298.0, null, null, null, "DNA", null, "28825469", "10.1021/acscombsci.6b00163", "40Apt | 5.92 \u00b1 1.13 | - 15.31", "step2c_literal_v3"], [187, "PDGF-BB", "protein", "P01127", "38bApt", null, "7.03 pM", -11.153, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "ELISA", 298.0, null, null, null, "DNA", null, "28825469", "10.1021/acscombsci.6b00163", "38bApt | 7.03 \u00b1 1.28 | - 15.21", "step2c_literal_v3"], [618, "nucleolin", "protein", "P19338", "Cy5-AT11", "TGGTGGTGGTTGTTGTGGTGGTGGTGGT", "9.1e-12 M", -11.041, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "31301466", "10.1016/j.ijpharm.2019.118511", "K D values of 9.1 \u00d7 10 -12 and 9.5 \u00d7 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4", "elsevier_step2c"], [619, "nucleolin", "protein", "P19338", "Cy5-AT11-B0", "TGGTGGTGGTTGGTGGTGGTGGTGGT", "9.5e-12 M", -11.022, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "31301466", "10.1016/j.ijpharm.2019.118511", "K D values of 9.1 \u00d7 10 -12 and 9.5 \u00d7 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4", "elsevier_step2c"], [269, "thrombin", "protein", "P00734", "HD1-12A-DAB", null, "13.1 pM", -10.883, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "filter_binding", null, null, "selection buffer", null, "DNA", null, "41053535", "10.1002/advs.202509867", "HD1-12A-DAB EXACT inhibitor bound to thrombin and prothrombin with K D s of 13.1 pm", "step2c_literal_v3"], [143, "P-selectin", "protein", "Q14242", "PF377", null, "14.0 pM", -10.854, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, null, "filter_binding", 310.15, 7.4, "SHMCK buffer", "1.0", "2'F-RNA", null, "9743465", "10.1089/oli.1.1998.8.265", "PF377 | 14", "step2c_literal_v3"], [147, "P-selectin", "protein", "Q14242", "PF377sl", null, "14.0 pM", -10.854, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, null, "filter_binding", 296.15, 7.4, "SHMCK buffer", "1.0", "2'F-RNA", null, "9743465", "10.1089/oli.1.1998.8.265", "PF377sl | 14", "step2c_literal_v3"], [142, "P-selectin", "protein", "Q14242", "PF377", null, "16.0 pM", -10.796, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, null, "filter_binding", 310.15, 7.4, "SHMCK buffer", "1.0", "2'F-RNA", null, "9743465", "10.1089/oli.1.1998.8.265", "PF377 | 16", "step2c_literal_v3"], [144, "P-selectin", "protein", "Q14242", "PF377", null, "18.0 pM", -10.745, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, null, "filter_binding", 277.15, 7.4, "SHMCK buffer", "1.0", "2'F-RNA", null, "9743465", "10.1089/oli.1.1998.8.265", "PF377 | 18", "step2c_literal_v3"], [351, "thrombin", "protein", "P00734", "Supra-TBA15/29-GO", null, "1.9e-11 M", -10.721, "avidity_multivalent", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, null, null, null, null, null, "DNA", "Graphene Oxide immobilization; poly(adenine) anchor", "31157200", "10.3389/fchem.2019.00280", "Supra-TBA15 / 29-GO prepared with GO (40 \u03bc g mL -1 ) at 60 \u25e6 C exhibited much higher binding affinity toward thrombin ( K d = 1.9 \u00d7 10 -11 M, Figure S10 , Supporting Information).", "step2c_acs_v1"], [623, "Malate Synthase", "protein", "Q8N0X4", "MS10-Trunc", "GGTGGTGGTGG", "19.0 pM", -10.721, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "abstract", null, null, null, "31704587", "10.1016/j.omtn.2019.09.026", "MS10-Trunc aptamer exhibited high af fi nity for MS (equilibrium dissociation constant [KD]  19 pM)", "elsevier_step2c"], [140, "PDGF-C", "protein", "P01127", "\u03b1-PC", "CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC", "20.0 pM", -10.699, "intrinsic", "KD", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, 7.4, "HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4)", null, "DNA", "PEG", "42138517", "10.1167/iovs.67.5.36", "SPR analysis demonstrated that the \u03b1 -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM", "step2c_literal_v3"], [209, "SW480 cells", "cell/EV", "Q16520", "Fixed Apt-nanovesicle", null, "28.06 pM", -10.552, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, null, null, null, null, null, "DNA", "cholesterol; crosslinked", "32049531", "10.1021/jacs.9b13782", "the K d value of fi xed Apt-nanovesicles to SW480 cells was increased to 28.06 \u00b1 3.31 pM (Figure 2D)", "step2c_literal_v3"], [146, "P-selectin", "protein", "Q14242", "PF377sl", null, "29.0 pM", -10.538, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, null, "filter_binding", 310.15, 7.4, "SHMCK buffer", "1.0", "2'F-RNA", null, "9743465", "10.1089/oli.1.1998.8.265", "PF377sl | 29", "step2c_literal_v3"], [319, "VEGF165", "protein", "P15692", "3R02 Bivalent", "TGTGGGGGTGGACTGGGTGGGTACCTTTTTTTTTTTGTGGGGGTGGACTGGGTGGGTACC", "3e-11 M", -10.523, "avidity_multivalent", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "23237717", "10.1021/ac303023d", "The K d value of 30 pM for 3R02 Bivalent was calculated by measuring SPR.", "step2c_acs_v1"], [669, "bevacizumab", "protein", "P31995", "A14#1", "GCGGTTGGTGGTAGTTACGTTCGC", "44.0 pM", -10.357, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "abstract", null, null, null, "35114463", "10.1016/j.bios.2022.114027", "affinity of A14#1 to bevacizumab markedly increased at pH 4.7 ( K D = 44 pM)", "elsevier_step2c"], [145, "P-selectin", "protein", "Q14242", "PF377sl", null, "46.0 pM", -10.337, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, null, "filter_binding", 310.15, 7.4, "SHMCK buffer", "1.0", "2'F-RNA", null, "9743465", "10.1089/oli.1.1998.8.265", "PF377sl | 46", "step2c_literal_v3"], [312, "thrombin", "protein", "P00734", "MP-TBA15/TBA29-T15", "GGTTGGTGTGGTTGG", "5.2e-11 M", -10.284, "avidity_multivalent", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "backfill_text_verified", null, "saturation_binding", null, 7.4, "physiological buffer (25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 5.0 mM KCl, 1.0 mM MgCl2, 1.0 mM CaCl2) containing BSA (100 \u03bcM)", null, "DNA", "thiolated; 15-mer thymidine linker", "22300379", "10.1021/la204651t", "MP-TBA15/TBA29-T15 -Au NPs provided high flexibility and an appropriate orientation and distance between TBA and TBA units for bivalent binding, allowing stronger interactions with thrombin ( K d = 5.2 \u00d7 10 -11 M; Supporting Information, Figure S3)", "step2c_acs_v1"], [148, "P-selectin", "protein", "Q14242", "PF373sl", null, "56.0 pM", -10.252, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, null, "filter_binding", 310.15, 7.4, "SHMCK buffer", "1.0", "2'F-RNA", null, "9743465", "10.1089/oli.1.1998.8.265", "PF373sl | 56", "step2c_literal_v3"], [9, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "5.7e-11 M", -10.244, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", 298.15, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11", "step2c_literal_v3"], [56, "von Willebrand factor A1-domain", "protein", "P04275", "Rn-DsDsDs-53mh", null, "61.3 pM", -10.213, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "SPR", 310.15, null, "1 \u00d7 PBS supplemented with 0.05% (w/v) Nonidet P-40", null, "DNA", "Ds (7-(2-thienyl)imidazo[4,5b]pyridine); mini-hairpin DNA", "27966933", "10.1021/jacs.6b10767", "RnDsDsDs-53mh ( K D = 61.3 pM)", "step2c_literal_v3"], [542, "Myoglobin", "protein", "P02144", "anti-Mb aptamer", null, "65.0 pM", -10.187, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "pending_manual_supp", null, null, null, null, null, "text", null, null, null, "25957831", "10.1016/j.bios.2015.04.089", "The corresponding af fi nity, K D, values calculated from the ratio between dissociation ( k d) and association ( k a ) was found to be  65 pM.", "elsevier_step2c"], [53, "von Willebrand factor A1-domain", "protein", "P04275", "Rn-DsDsDs-44", null, "74.9 pM", -10.126, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "SPR", 310.15, null, "1 \u00d7 PBS supplemented with 0.05% (w/v) Nonidet P-40", null, "DNA", "Ds (7-(2-thienyl)imidazo[4,5b]pyridine)", "27966933", "10.1021/jacs.6b10767", "Rn-DsDsDs-44 ( K D = 74.9 pM) exhibited the highest a ffi nity", "step2c_literal_v3"], [219, "CCRF-CEM cells", "cell/EV", "Q9NRR3", "CDN-sgc8", null, "0.08 nM", -10.097, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "fluorescence", null, null, "1 \u00d7 PBS, 5 mM MgCl2", "5.0", "DNA", "biotinylated", "35670775", "10.1021/acs.analchem.2c01359", "Kd=0.08\u00b10.01 nM", "step2c_literal_v3"], [3, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "8.5e-11 M", -10.071, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", 298.15, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11", "step2c_literal_v3"], [152, "PDGF-BB", "protein", "P01127", "PDGF-B aptamer", null, "0.1 nM", -10.0, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, null, "filter_binding", null, null, null, null, "DNA", "2'-fluoro; 2'-O-methyl; hexaethylene glycol spacer; inverted 3'-3' thymidine cap; 40-kd PEG conjugated", "9916931", "10.1016/S0002-9440(10)65263-7", "the binding affinity of the aptamer used in the experiments described below ( K d \u2248 0.1 nM)", "step2c_literal_v3"], [547, "ofloxacin", "protein", "Q9H015", "Q2", "ATACCAGCTTATTCAATTGCAGGGTATCTGAGGCTTGATCTACTAAATGTCGTGGGGCATTGCTATTGGCGTTGATACGTACAATCGTAATCAGTTAG", "0.11 nM", -9.959, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "26547431", "10.1016/j.bios.2015.10.069", "Their K D values were calculated at K D 1\u20444 0.11 nM ( 7 0.06) for aptamer Q2", "elsevier_step2c"], [331, "MutS", "protein", "O15457", "2-06", "ACTTCTGCCCGCCTCCTTCCTGGTAAAGTCATTAATAGGTGTGGGGTGCCGGGCATTTCGGAGACGAGATAGGCGGACACT", "1.23e-10 M", -9.91, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "25668425", "10.1021/acs.analchem.5b00171", "The best fi t was obtained at K d = 123 pM and [T]0 = 213 pM", "step2c_acs_v1"], [245, "MPO", "protein", "P05164", "MPO-16", "GTCTGGAAACGACGAGGGCCACTGATTAACGTAGTTAATTGGTCTTGTCG", "166.0 pM", -9.78, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", null, "flow_cytometry", null, null, "selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA)", "2.5", "DNA", null, "37277648", "10.1038/s41557-023-01207-z", "MPO16 revealed the highest binding affinity ( K d = 166 pM)", "step2c_literal_v3"], [149, "P-selectin", "protein", "Q14242", "PF398sl", null, "178.0 pM", -9.75, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, null, "filter_binding", 310.15, 7.4, "SHMCK buffer", "1.0", "2'F-RNA", null, "9743465", "10.1089/oli.1.1998.8.265", "PF398sl | 178", "step2c_literal_v3"], [57, "von Willebrand factor A1-domain", "protein", "P04275", "Rn-DsDs-51mh2", null, "182.0 pM", -9.74, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "SPR", 310.15, null, "1 \u00d7 PBS supplemented with 0.05% (w/v) Nonidet P-40", null, "DNA", "Ds (7-(2-thienyl)imidazo[4,5b]pyridine); mini-hairpin DNA", "27966933", "10.1021/jacs.6b10767", "Rn-DsDs-51mh2 ( K D = 182 pM)", "step2c_literal_v3"], [363, "HBcAg", "protein", null, "A-9", "AGCAGCACAGAGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCTACCGTGAA", "2.0000000000000003e-10 M", -9.699, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, null, null, null, "DNA", null, "32250595", "10.1021/acs.analchem.9b05740", "This aptamer showed strong binding to HBcAg ( K d : 0.2 nM)", "step2c_acs_v1"], [548, "ofloxacin", "protein", "Q9H015", "Q8", "ATACCAGCTTATTCAATTAGTTGTGTATTGAGGTTTGATCTAGGCATAGTCAACAGAGCACGATCGATCTGGCTTGTTCTACAATCGTAATCAGTTAG", "0.2 nM", -9.699, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "26547431", "10.1016/j.bios.2015.10.069", "K D 1\u20444 0.20 nM ( 7 0.09) for aptamer Q8", "elsevier_step2c"], [558, "OH-BDE47", "protein", null, "BDE-A-8", "GACAGCCGGGGCATCAGAGCAGCCGATTGTCTGTTGTGCC", "0.2 nM", -9.699, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "27566357", "10.1016/j.aca.2016.06.040", "The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition.", "elsevier_step2c"], [234, "MPO", "protein", "P05164", "MPO-02", "TATGCGATTTCAAAAATGTTACGATGGATATTGACATTTAAATATGTCGG", "227.0 pM", -9.644, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", null, "flow_cytometry", null, null, "selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA)", "2.5", "DNA", null, "37277648", "10.1038/s41557-023-01207-z", "MPO-02 ... 227", "step2c_literal_v3"], [307, "P-selectin", "protein", "Q14242", "PF377sl", null, "250.0 pM", -9.602, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, null, "flow_cytometry", 296.15, 7.4, "SHMCK buffer", "1.0", "2'F-RNA", null, "9743465", "10.1089/oli.1.1998.8.265", "PF377sl | 250", "step2c_literal_v3"], [639, "thrombin", "protein", "P00734", "29-mer thrombin-specific aptamer", "AGTCCGTGGTAGGGCAGGTTGGGGTGACT", "298.0 pM", -9.526, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "32570818", "10.3390/s20123442", "The n-curve analysis provided a Kd of 298 pM ( + 111 / 81 pM)", "elsevier_step2c"], [318, "VEGF165", "protein", "P15692", "3R02", "TGTGGGGGTGGACTGGGTGGGTACC", "3e-10 M", -9.523, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "23237717", "10.1021/ac303023d", "The K d value for 3R02 was 300 pM", "step2c_acs_v1"]], "truncated": false, "filtered_table_rows_count": 742, "expanded_columns": [], "expandable_columns": [], "columns": ["id", "target_name_canonical", "target_type", "target_uniprot", "aptamer_name", "aptamer_seq", "kd_reported", "kd_log10_molar", "measurement_class", "binding_constant_type", "tier", "source_origin", "verification_level", "sequence_status", "seq_source", "pi_provenance_flag", "assay_method", "assay_temperature_k", "assay_ph", "assay_buffer", "assay_cations", "aptamer_chemistry", "aptamer_modifications", "source_pmid", "doi", "verbatim_quote", "source_db"], "primary_keys": [], "units": {}, "query": {"sql": "select id, target_name_canonical, target_type, target_uniprot, aptamer_name, aptamer_seq, kd_reported, kd_log10_molar, measurement_class, binding_constant_type, tier, source_origin, verification_level, sequence_status, seq_source, pi_provenance_flag, assay_method, assay_temperature_k, assay_ph, assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications, source_pmid, doi, verbatim_quote, source_db from v_kd order by kd_log10_molar limit 51", "params": {}}, "facet_results": {"measurement_class": {"name": "measurement_class", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json", "results": [{"value": "intrinsic", "label": "intrinsic", "count": 555, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic", "selected": false}, {"value": "non_intrinsic", "label": "non_intrinsic", "count": 155, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=non_intrinsic", "selected": false}, {"value": "apparent_cellular", "label": "apparent_cellular", "count": 16, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=apparent_cellular", "selected": false}, {"value": "avidity_multivalent", "label": "avidity_multivalent", "count": 16, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=avidity_multivalent", "selected": false}], "truncated": false}, "target_type": {"name": "target_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json", "results": [{"value": "protein", "label": "protein", "count": 715, "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=protein", "selected": false}, {"value": "cell/EV", "label": "cell/EV", "count": 15, "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=cell%2FEV", "selected": false}, {"value": "glycan/conjugate", "label": "glycan/conjugate", "count": 12, "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=glycan%2Fconjugate", "selected": false}], "truncated": false}, "tier": {"name": "tier", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json", "results": [{"value": "Gold", "label": "Gold", "count": 742, "toggle_url": "https://apt-scout.org/scout/v_kd.json?tier=Gold", "selected": false}], "truncated": false}, "assay_method": {"name": "assay_method", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json", "results": [{"value": "flow_cytometry", "label": "flow_cytometry", "count": 102, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=flow_cytometry", "selected": false}, {"value": "SPR", "label": "SPR", "count": 80, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR", "selected": false}, {"value": "fluorescence", "label": "fluorescence", "count": 47, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence", "selected": false}, {"value": "MST", "label": "MST", "count": 29, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST", "selected": false}, {"value": "filter_binding", "label": "filter_binding", "count": 28, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=filter_binding", "selected": false}, {"value": "BLI", "label": "BLI", "count": 27, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI", "selected": false}, {"value": "ITC", "label": "ITC", "count": 12, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=ITC", "selected": false}, {"value": "ELISA", "label": "ELISA", "count": 11, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=ELISA", "selected": false}, {"value": "CE-LIF", "label": "CE-LIF", "count": 10, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=CE-LIF", "selected": false}, {"value": "affinity_real_time_qPCR", "label": "affinity_real_time_qPCR", "count": 8, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=affinity_real_time_qPCR", "selected": false}, {"value": "QCM", "label": "QCM", "count": 7, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=QCM", "selected": false}, {"value": "BSI", "label": "BSI", "count": 4, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BSI", "selected": false}, {"value": "dot_blot", "label": "dot_blot", "count": 4, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=dot_blot", "selected": false}, {"value": "PISA", "label": "PISA", "count": 3, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=PISA", "selected": false}, {"value": "ELONA", "label": "ELONA", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=ELONA", "selected": false}, {"value": "EMSA", "label": "EMSA", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=EMSA", "selected": false}, {"value": "FACS", "label": "FACS", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=FACS", "selected": false}, {"value": "mass_spectrometry", "label": "mass_spectrometry", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=mass_spectrometry", "selected": false}, {"value": "microcantilever", "label": "microcantilever", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=microcantilever", "selected": false}, {"value": "microscale thermophoresis", "label": "microscale thermophoresis", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=microscale+thermophoresis", "selected": false}, {"value": "ALISA", "label": "ALISA", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=ALISA", "selected": false}, {"value": "DPV", "label": "DPV", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=DPV", "selected": false}, {"value": "ELAA", "label": "ELAA", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=ELAA", "selected": false}, {"value": "NECEEM", "label": "NECEEM", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=NECEEM", "selected": false}, {"value": "qPCR", "label": "qPCR", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=qPCR", "selected": false}, {"value": "qRT-PCR", "label": "qRT-PCR", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=qRT-PCR", "selected": false}, {"value": "saturation_binding", "label": "saturation_binding", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=saturation_binding", "selected": false}], "truncated": false}, "binding_constant_type": {"name": "binding_constant_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json", "results": [{"value": "Kd", "label": "Kd", "count": 739, "toggle_url": "https://apt-scout.org/scout/v_kd.json?binding_constant_type=Kd", "selected": false}, {"value": "KD", "label": "KD", "count": 3, "toggle_url": "https://apt-scout.org/scout/v_kd.json?binding_constant_type=KD", "selected": false}], "truncated": false}, "verification_level": {"name": "verification_level", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json", "results": [{"value": "extraction_verified", "label": "extraction_verified", "count": 561, "toggle_url": "https://apt-scout.org/scout/v_kd.json?verification_level=extraction_verified", "selected": false}, {"value": "multi_agent_verified", "label": "multi_agent_verified", "count": 181, "toggle_url": "https://apt-scout.org/scout/v_kd.json?verification_level=multi_agent_verified", "selected": false}], "truncated": false}, "sequence_status": {"name": "sequence_status", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json", "results": [{"value": "verified_in_text_or_SI", "label": "verified_in_text_or_SI", "count": 435, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI", "selected": false}, {"value": "pending_manual_supp", "label": "pending_manual_supp", "count": 207, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=pending_manual_supp", "selected": false}, {"value": "pending_supp_oa", "label": "pending_supp_oa", "count": 49, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=pending_supp_oa", "selected": false}, {"value": "pending_manual_figure", "label": "pending_manual_figure", "count": 45, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=pending_manual_figure", "selected": false}, {"value": "no_single_sequence_pool", "label": "no_single_sequence_pool", "count": 6, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=no_single_sequence_pool", "selected": false}], "truncated": false}}, "suggested_facets": [{"name": "source_origin", "toggle_url": "https://apt-scout.org/scout/v_kd.json?_facet=source_origin"}, {"name": "seq_source", "toggle_url": "https://apt-scout.org/scout/v_kd.json?_facet=seq_source"}, {"name": "pi_provenance_flag", "toggle_url": "https://apt-scout.org/scout/v_kd.json?_facet=pi_provenance_flag"}, {"name": "assay_temperature_k", "toggle_url": "https://apt-scout.org/scout/v_kd.json?_facet=assay_temperature_k"}, {"name": "assay_ph", "toggle_url": "https://apt-scout.org/scout/v_kd.json?_facet=assay_ph"}, {"name": "assay_cations", "toggle_url": "https://apt-scout.org/scout/v_kd.json?_facet=assay_cations"}, {"name": "aptamer_chemistry", "toggle_url": "https://apt-scout.org/scout/v_kd.json?_facet=aptamer_chemistry"}, {"name": "source_db", "toggle_url": "https://apt-scout.org/scout/v_kd.json?_facet=source_db"}], "next": "50", "next_url": "https://apt-scout.org/scout/v_kd.json?_next=50", "private": false, "allow_execute_sql": true, "query_ms": 70.57666685432196, "source": "apt-scout automated curation pipeline (E. Dohi, NCNP) \u2014 values harvested from public databases; raw source stored per target", "source_url": "https://apt-scout.org", "license": "CC BY 4.0", "license_url": "https://creativecommons.org/licenses/by/4.0/"}