{"database": "scout", "table": "v_kd", "is_view": true, "human_description_en": "where assay_method = \"BLI\" and tier = \"Gold\" sorted by kd_log10_molar", "rows": [[63, "CD8a", "protein", "P01732", "A8", null, "5.59 nM", -8.253, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, null, "BLI", 298.15, null, "binding buffer with 0.01% Tween 20", null, "DNA", null, "31209354", "10.1038/s41551-019-0411-6", "the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 \u00b1 0.2,  14.7 \u00b1 0.1  and  5.59 \u00b1 0.11  nM, respectively", "step2c_literal_v3"], [87, "transferrin receptor 1", "protein", "P02786", "JBA8.26", null, "6.87 nM", -8.163, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, null, "BLI", null, null, null, null, "DNA", null, "35875870", "10.1021/jacs.2c05349", "Using BLI, JBA8.26 was found to bind immobilized TfR1 with a K D of 6.87 \u00b1 0.04 nM", "step2c_literal_v3"], [92, "Okadaic Acid", "protein", "O95232", "OA-LC2-TF", null, "8.735 nM", -8.059, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "BLI", null, 7.5, "50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)", "2.0", "DNA", "terminal fixation with GC-rich sequences", "36322695", "10.1021/acs.analchem.2c02653", "The terminal-fixed OA-LC2 (OA-LC2-TF) exhibited a K d of 8.735 \u00b1 0.606 nM", "step2c_literal_v3"], [101, "thrombin", "protein", "P00734", "Uyne A - AUyne", null, "12.16 nM", -7.915, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "BLI", null, null, "buffer used for the bead-based selection, which contains Tween-20", null, "DNA", "5-ethynyl-2\u2032-deoxyuridine (Uyne); Biotin (5' end)", "37531184", "10.1021/acschembio.3c00183", "U yne A - AUyne | 12.16 \u00b1 0.02", "step2c_literal_v3"], [100, "thrombin", "protein", "P00734", "Uyne A - Uyne Uyne", null, "13.96 nM", -7.855, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "BLI", null, null, "buffer used for the bead-based selection, which contains Tween-20", null, "DNA", "5-ethynyl-2\u2032-deoxyuridine (Uyne); Biotin (5' end)", "37531184", "10.1021/acschembio.3c00183", "U yne A - U yne U yne | 13.96 \u00b1 0.03", "step2c_literal_v3"], [62, "CD8a", "protein", "P01732", "A3", null, "14.7 nM", -7.833, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, null, "BLI", 298.15, null, "binding buffer with 0.01% Tween 20", null, "DNA", null, "31209354", "10.1038/s41551-019-0411-6", "the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 \u00b1 0.2,  14.7 \u00b1 0.1  and  5.59 \u00b1 0.11  nM, respectively", "step2c_literal_v3"], [95, "Dinophysistoxin", "protein", null, "DTX-SL1-TF", null, "15.45 nM", -7.811, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "BLI", null, 7.5, "50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)", "2.0", "DNA", "terminal fixation", "36322695", "10.1021/acs.analchem.2c02653", "DTX-SL1-TF showed a K d of 15.45 \u00b1 1.92 nM", "step2c_literal_v3"], [421, "hnRNP A1", "protein", "P09651", "AS1411", "GGTGGTGGTGGTTGTGGTGGTGGTGG", "1.75e-08 M", -7.757, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "BLI", null, 7.4, "BLI buffer (20 mM phosphate buffer, 8 mM KCl, 137 mM NaCl, 0.05% surfactant P20)", null, "DNA", null, "38784467", "10.1039/d3md00752a", "for AS1411, the K d value was 17.5 nM (Fig. 6B)", "step2c_acs_v1"], [61, "CD8a", "protein", "P01732", "A1", null, "20.1 nM", -7.697, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, null, "BLI", 298.15, null, "binding buffer with 0.01% Tween 20", null, "DNA", null, "31209354", "10.1038/s41551-019-0411-6", "the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 \u00b1 0.2,  14.7 \u00b1 0.1  and  5.59 \u00b1 0.11  nM, respectively", "step2c_literal_v3"], [422, "hnRNP A1", "protein", "P09651", "TBA", "GGTTGGTGTGGTTGG", "2.1100000000000004e-08 M", -7.676, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "BLI", null, 7.4, "BLI buffer (20 mM phosphate buffer, 8 mM KCl, 137 mM NaCl, 0.05% surfactant P20)", null, "DNA", null, "38784467", "10.1039/d3md00752a", "for TBA, the K d value was 21.1 nM (Fig. 6A)", "step2c_acs_v1"], [94, "Dinophysistoxin", "protein", null, "DTX-SL1", null, "21.75 nM", -7.663, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "BLI", null, 7.5, "50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)", "2.0", "DNA", null, "36322695", "10.1021/acs.analchem.2c02653", "DTX-SL1 showed the lowest K d at 21.75 \u00b1 1.42 nM", "step2c_literal_v3"], [128, "CD117", "protein", "P10721", "Apta02", null, "21.8 nM", -7.662, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, null, "BLI", 298.15, null, null, null, "DNA", null, "40487293", "10.1002/adfm.202425394", "Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 \u00b5 m, respectively ( Figure 2 a,b).", "step2c_literal_v3"], [373, "beta-conglutin", "protein", null, "11-mer", "GGTGGGGGTGG", "2.3300000000000003e-08 M", -7.633, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "BLI", 303.15, 7.4, "PBS, 1.5 mM MgCl2, pH 7.4, 0.1% Tween-20", null, "DNA", null, "33498970", "10.3390/ijms22031150", "A 2:1 heterogenous model was used to fit the data and calculate the binding affinities resulting in two different KD values of 6.95 and 23.30 nM.", "step2c_acs_v1"], [86, "transferrin receptor 1", "protein", "P02786", "tJBA8.1", null, "25.11 nM", -7.6, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, null, "BLI", null, null, null, null, "DNA", "biotinylated", "35875870", "10.1021/jacs.2c05349", "tJBA8.1 bound the TfR1 protein with a K D value of 25.11 \u00b1 0.19 nM", "step2c_literal_v3"], [253, "rmCD3 d \u03b5", "protein", null, "CD3_Apt1 dimer", "CCCGATTGATTCGCAATGTGCGTCCCCTCGTGCC", "25.2 nM", -7.599, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", null, "BLI", 298.15, null, "PBS +/+ buffer", null, "2'F-RNA", "dimerized via ssDNA scaffold", "38745854", "10.1016/j.omtn.2024.102198", "The affinity of the dimeric aptamer was determined by OCTET and was 25.2 nM for Apt1 dimer", "step2c_literal_v3"], [98, "thrombin", "protein", "P00734", "HD22 (TA-TT)", "AGTCCGTGGTAGGGCAGGTTGGGGTGACTGTAAACGCTCGCTTCGATCTAGTCCGTGGGGGCAGGGGGGTGACTAGCAGATATGCATCCGTAGC", "27.8 nM", -7.556, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "BLI", null, null, "buffer used for the bead-based selection, which contains Tween-20", null, "DNA", "Biotin (5' end)", "37531184", "10.1021/acschembio.3c00183", "TA - TT | 27.80 \u00b1 0.09", "step2c_literal_v3"], [99, "thrombin", "protein", "P00734", "TA-AT", null, "38.7 nM", -7.412, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "BLI", null, null, "buffer used for the bead-based selection, which contains Tween-20", null, "DNA", "Biotin (5' end)", "37531184", "10.1021/acschembio.3c00183", "TA - AT | 38.7 \u00b1 0.5", "step2c_literal_v3"], [91, "Okadaic Acid", "protein", "O95232", "OA-LC2", null, "91.13 nM", -7.04, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "BLI", null, 7.5, "50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)", "2.0", "DNA", null, "36322695", "10.1021/acs.analchem.2c02653", "OA-LC2 exhibited K d of 91.13 \u00b1 4.64 nM", "step2c_literal_v3"], [89, "Okadaic Acid", "protein", "O95232", "OA-SL2", null, "103.4 nM", -6.985, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "BLI", null, 7.5, "50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)", "2.0", "DNA", null, "36322695", "10.1021/acs.analchem.2c02653", "from OA-SL1 to OASL2, K d was lowered from 340.5 \u00b1 14.5 to 103.4 \u00b1 7.0 nM", "step2c_literal_v3"], [96, "Phosphatidylserine", "protein", "Q9UG56", "PS-LC3-TF", null, "166.2 nM", -6.779, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "BLI", null, 7.6, "150 mM NaCl and 50 mM K2HPO4 (pH 7.6)", null, "DNA", "terminal fixation", "36322695", "10.1021/acs.analchem.2c02653", "The terminal-fixed PS-LC3-TF exhibited an even lower K d at 166.2 \u00b1 10.7 nM", "step2c_literal_v3"], [254, "rmCD3 d \u03b5", "protein", null, "CD3_Apt12 dimer", "TCCCCTGTCGATATCCACCGTCTGGCCCGCATTGA", "218.0 nM", -6.662, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", null, "BLI", 298.15, null, "PBS +/+ buffer", null, "2'F-RNA", "dimerized via ssDNA scaffold", "38745854", "10.1016/j.omtn.2024.102198", "218 nM for Apt12 dimer", "step2c_literal_v3"], [90, "Okadaic Acid", "protein", "O95232", "OA-SL3", null, "234.4 nM", -6.63, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "BLI", null, 7.5, "50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)", "2.0", "DNA", null, "36322695", "10.1021/acs.analchem.2c02653", "When OA-SL1 was tripled to get the chimera OA-SL3, K d rose to 234.4 \u00b1 15.6 nM", "step2c_literal_v3"], [93, "Dinophysistoxin", "protein", null, "anti-DTX parent aptamer", null, "778.1 nM", -6.109, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "BLI", null, 7.5, "50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)", "2.0", "DNA", null, "36322695", "10.1021/acs.analchem.2c02653", "antiDTX parent aptamer ( K d = 778.1 \u00b1 73.5 nM)", "step2c_literal_v3"], [129, "CD117", "protein", "P10721", "Apta04", null, "1100.0 nM", -5.959, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, null, "BLI", 298.15, null, null, null, "DNA", null, "40487293", "10.1002/adfm.202425394", "Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 \u00b5 m, respectively ( Figure 2 a,b).", "step2c_literal_v3"], [131, "CD123", "protein", "O75794", "Apta25", null, "1.16 \u00b5M", -5.936, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, null, "BLI", 298.15, null, null, null, "DNA", null, "40487293", "10.1002/adfm.202425394", "BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 \u00b5 m for ZW25 and 15.6 \u00b5 m for CY30 (Figure S2, Supporting Information).", "step2c_literal_v3"], [88, "Okadaic Acid", "protein", "O95232", "anti-OA parent aptamer", null, "1402.0 nM", -5.853, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "BLI", null, 7.5, "50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)", "2.0", "DNA", null, "36322695", "10.1021/acs.analchem.2c02653", "anti-OA aptamer with high affinity from its parent aptamer ( K d = 1402 \u00b1 58 nM, Figure 1a)", "step2c_literal_v3"], [130, "CD123", "protein", "O75794", "Apta30", null, "15.6 \u00b5M", -4.807, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, null, "BLI", 298.15, null, null, null, "DNA", null, "40487293", "10.1002/adfm.202425394", "BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 \u00b5 m for ZW25 and 15.6 \u00b5 m for CY30 (Figure S2, Supporting Information).", "step2c_literal_v3"]], "truncated": false, "filtered_table_rows_count": 27, "expanded_columns": [], "expandable_columns": [], "columns": ["id", "target_name_canonical", "target_type", "target_uniprot", "aptamer_name", "aptamer_seq", "kd_reported", "kd_log10_molar", "measurement_class", "binding_constant_type", "tier", "source_origin", "verification_level", "sequence_status", "seq_source", "pi_provenance_flag", "assay_method", "assay_temperature_k", "assay_ph", "assay_buffer", "assay_cations", "aptamer_chemistry", "aptamer_modifications", "source_pmid", "doi", "verbatim_quote", "source_db"], "primary_keys": [], "units": {}, "query": {"sql": "select id, target_name_canonical, target_type, target_uniprot, aptamer_name, aptamer_seq, kd_reported, kd_log10_molar, measurement_class, binding_constant_type, tier, source_origin, verification_level, sequence_status, seq_source, pi_provenance_flag, assay_method, assay_temperature_k, assay_ph, assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications, source_pmid, doi, verbatim_quote, source_db from v_kd where \"assay_method\" = :p0 and \"tier\" = :p1 order by kd_log10_molar limit 51", "params": {"p0": "BLI", "p1": "Gold"}}, "facet_results": {"measurement_class": {"name": "measurement_class", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=BLI&tier=Gold", "results": [{"value": "intrinsic", "label": "intrinsic", "count": 25, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&measurement_class=intrinsic", "selected": false}, {"value": "non_intrinsic", "label": "non_intrinsic", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&measurement_class=non_intrinsic", "selected": false}], "truncated": false}, "target_type": {"name": "target_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=BLI&tier=Gold", "results": [{"value": "protein", "label": "protein", "count": 27, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&target_type=protein", "selected": false}], "truncated": false}, "tier": {"name": "tier", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=BLI&tier=Gold", "results": [{"value": "Gold", "label": "Gold", "count": 27, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI", "selected": true}], "truncated": false}, "assay_method": {"name": "assay_method", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=BLI&tier=Gold", "results": [{"value": "BLI", "label": "BLI", "count": 27, "toggle_url": "https://apt-scout.org/scout/v_kd.json?tier=Gold", "selected": true}], "truncated": false}, "binding_constant_type": {"name": "binding_constant_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=BLI&tier=Gold", "results": [{"value": "Kd", "label": "Kd", "count": 27, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&binding_constant_type=Kd", "selected": false}], "truncated": false}, "verification_level": {"name": "verification_level", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=BLI&tier=Gold", "results": [{"value": "extraction_verified", "label": "extraction_verified", "count": 24, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&verification_level=extraction_verified", "selected": false}, {"value": "multi_agent_verified", "label": "multi_agent_verified", "count": 3, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&verification_level=multi_agent_verified", "selected": false}], "truncated": false}, "sequence_status": {"name": "sequence_status", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=BLI&tier=Gold", "results": [{"value": "pending_manual_supp", "label": "pending_manual_supp", "count": 12, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&sequence_status=pending_manual_supp", "selected": false}, {"value": "pending_supp_oa", "label": "pending_supp_oa", "count": 9, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&sequence_status=pending_supp_oa", "selected": false}, {"value": "verified_in_text_or_SI", "label": "verified_in_text_or_SI", "count": 6, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&sequence_status=verified_in_text_or_SI", "selected": false}], "truncated": false}}, "suggested_facets": [{"name": "target_name_canonical", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&_facet=target_name_canonical"}, {"name": "target_uniprot", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&_facet=target_uniprot"}, {"name": "seq_source", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&_facet=seq_source"}, {"name": "assay_temperature_k", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&_facet=assay_temperature_k"}, {"name": "assay_ph", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&_facet=assay_ph"}, {"name": "assay_buffer", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&_facet=assay_buffer"}, {"name": "aptamer_chemistry", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&_facet=aptamer_chemistry"}, {"name": "aptamer_modifications", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&_facet=aptamer_modifications"}, {"name": "source_pmid", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&_facet=source_pmid"}, {"name": "doi", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&_facet=doi"}, {"name": "verbatim_quote", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&_facet=verbatim_quote"}, {"name": "source_db", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=BLI&tier=Gold&_facet=source_db"}], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 87.12112996727228, "source": "apt-scout automated curation pipeline (E. Dohi, NCNP) \u2014 values harvested from public databases; raw source stored per target", "source_url": "https://apt-scout.org", "license": "CC BY 4.0", "license_url": "https://creativecommons.org/licenses/by/4.0/"}