{"database": "scout", "table": "v_kd", "is_view": true, "human_description_en": "where assay_method = \"MST\" and target_type = \"protein\" sorted by kd_log10_molar", "rows": [[372, "beta-conglutin", "protein", null, "11-mer", "GGTGGGGGTGG", "1.05e-09 M", -8.979, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "MST", 298.15, null, "binding buffer with 0.05% v/v Tween-20", null, "DNA", null, "33498970", "10.3390/ijms22031150", "KD values determined (Figure 6b) are very similar (11-mer: 1.05 nM", "step2c_acs_v1"], [374, "beta-conglutin", "protein", null, "TT-11-mer", "TTGGTGGGGGTGG", "1.88e-09 M", -8.726, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "MST", 298.15, null, "binding buffer with 0.05% v/v Tween-20", null, "DNA", null, "33498970", "10.3390/ijms22031150", "KD values determined (Figure 6b) are very similar (... TT-11 mer: 1.88 nM", "step2c_acs_v1"], [376, "beta-conglutin", "protein", null, "11-mer-TT", "GGTGGGGGTGGTT", "2.59e-09 M", -8.587, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "MST", 298.15, null, "binding buffer with 0.05% v/v Tween-20", null, "DNA", null, "33498970", "10.3390/ijms22031150", "KD values determined (Figure 6b) are very similar (... and 11-mer-TT: 2.59 nM)", "step2c_acs_v1"], [375, "beta-conglutin", "protein", null, "TT-11-mer-TT", "TTGGTGGGGGTGGTT", "2.71e-09 M", -8.567, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "MST", 298.15, null, "binding buffer with 0.05% v/v Tween-20", null, "DNA", null, "33498970", "10.3390/ijms22031150", "KD values determined (Figure 6b) are very similar (... TT-11-mer-TT: 2.71 nM", "step2c_acs_v1"], [76, "thrombin", "protein", "P00734", "3G", "GGTTGGTGTGGTTGG", "9.8 nM", -8.009, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 3 with Guanosine side chain", "33614235", "10.1016/j.omtn.2021.01.004", "3G | 52.9 | 9.8 \u00b1 0.6 | 3.34", "step2c_literal_v3"], [366, "trastuzumab", "protein", "Q9ULR3", "CH1S-3", null, "1.0300000000000001e-08 M", -7.987, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "MST", 298.15, null, "washing bu ff er with the addition of 0.005% Tween 20", null, "DNA", "5'-Cy5", "32516525", "10.1021/jacs.9b13370", "a ffi nity with a K d value of aptamer CH1S-3 of 10.3 nM", "step2c_acs_v1"], [69, "thrombin", "protein", "P00734", "3Leu", "GGTTGGTGTGGTTGG", "10.9 nM", -7.963, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 3 with Leucine side chain", "33614235", "10.1016/j.omtn.2021.01.004", "3Leu | 54.3 | 10.9 \u00b1 0.2 | 4.15", "step2c_literal_v3"], [77, "thrombin", "protein", "P00734", "3L", "GGTTGGTGTGGTTGG", "11.6 nM", -7.936, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 3 with Lactose side chain", "33614235", "10.1016/j.omtn.2021.01.004", "3L | 51.5 | 11.6 \u00b1 0.5 | 5.28", "step2c_literal_v3"], [70, "thrombin", "protein", "P00734", "3Ser", "GGTTGGTGTGGTTGG", "14.6 nM", -7.836, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 3 with Serine side chain", "33614235", "10.1016/j.omtn.2021.01.004", "3Ser | 51.7 | 14.6 \u00b1 0.3 | 2.51", "step2c_literal_v3"], [67, "thrombin", "protein", "P00734", "TBA", "GGTTGGTGTGGTTGG", "20.2 nM", -7.695, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", null, "33614235", "10.1016/j.omtn.2021.01.004", "TBA | 50.7 | 20.2 \u00b1 1.3 | 4.81", "step2c_literal_v3"], [84, "thrombin", "protein", "P00734", "12G", "GGTTGGTGTGGTTGG", "20.7 nM", -7.684, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 12 with Guanosine side chain", "33614235", "10.1016/j.omtn.2021.01.004", "12G | 53.4 | 20.7 \u00b1 2.8 | 2.88", "step2c_literal_v3"], [68, "thrombin", "protein", "P00734", "3Ala", "GGTTGGTGTGGTTGG", "21.4 nM", -7.67, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 3 with Alanine side chain", "33614235", "10.1016/j.omtn.2021.01.004", "3Ala | 50.9 | 21.4 \u00b1 2.8 | 3.67", "step2c_literal_v3"], [71, "thrombin", "protein", "P00734", "3Phe", "GGTTGGTGTGGTTGG", "22.6 nM", -7.646, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 3 with Phenylalanine side chain", "33614235", "10.1016/j.omtn.2021.01.004", "3Phe | 54.3 | 22.6 \u00b1 4.8 | 3.39", "step2c_literal_v3"], [480, "NMP22", "protein", "Q14980", "NT2a", null, "2.4260000000000003e-08 M", -7.615, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "MST", null, null, null, null, "DNA", "biotin", "42173503", "10.1021/acs.analchem.6c00738", "The K d values were also determined using MicroScale Thermophoresis (MST), and the K d values of NT2a and NT4a were determined to be 24.26 \u00b1 10.47 and 77.29 \u00b1 25.78 nM (Figures 2d and S3).", "step2c_acs_v1"], [75, "thrombin", "protein", "P00734", "3Nic", "GGTTGGTGTGGTTGG", "27.1 nM", -7.567, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 3 with Nicotinamide side chain", "33614235", "10.1016/j.omtn.2021.01.004", "3Nic | 52.1 | 27.1 \u00b1 4.2 | 3.69", "step2c_literal_v3"], [85, "thrombin", "protein", "P00734", "12L", "GGTTGGTGTGGTTGG", "27.2 nM", -7.565, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 12 with Lactose side chain", "33614235", "10.1016/j.omtn.2021.01.004", "12L | 51.0 | 27.2 \u00b1 3.0 | 4.17", "step2c_literal_v3"], [72, "thrombin", "protein", "P00734", "3Amide", "GGTTGGTGTGGTTGG", "29.2 nM", -7.535, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 3 with Amide side chain", "33614235", "10.1016/j.omtn.2021.01.004", "3Amide | 52.6 | 29.2 \u00b1 0.4 | 4.17", "step2c_literal_v3"], [73, "thrombin", "protein", "P00734", "3Bz", "GGTTGGTGTGGTTGG", "30.0 nM", -7.523, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 3 with Benzyl side chain", "33614235", "10.1016/j.omtn.2021.01.004", "3Bz | 52.3 | 30.0 \u00b1 6.6 | 4.54", "step2c_literal_v3"], [83, "thrombin", "protein", "P00734", "12Amide", "GGTTGGTGTGGTTGG", "30.6 nM", -7.514, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 12 with Amide side chain", "33614235", "10.1016/j.omtn.2021.01.004", "12Amide | 51.2 | 30.6 \u00b1 6.1 | 3.97", "step2c_literal_v3"], [434, "Ara h1", "protein", "P35354", "CB-APT1", "GTGCTCGGACTCCACTTGCGCTTCATTAACCGGGTTGCTCATTTATTCA", "3.63e-08 M", -7.44, "avidity_multivalent", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "MST", 298.15, 7.2, "1 \u00d7 binding buffer", null, "DNA", null, "40083221", "10.1021/acs.analchem.5c00270", "Among them, CBAPT1 exhibited the strongest binding to Ara h1 with a K d value of 36.3 nM in aqueous solutions.", "step2c_acs_v1"], [435, "Ara h1", "protein", "P35354", "CB-APT1", "GTGCTCGGACTCCACTTGCGCTTCATTAACCGGGTTGCTCATTTATTCA", "4.5000000000000006e-08 M", -7.347, "avidity_multivalent", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "MST", 298.15, 7.2, "1 \u00d7 binding buffer with 80% w/w total peanut proteins", null, "DNA", null, "40083221", "10.1021/acs.analchem.5c00270", "Notably, a similar binding affinity was observed even in a complex matrix that contained 80% w/w total peanut proteins ( K d = 45.0 nM, Figures 3 and S5).", "step2c_acs_v1"], [78, "thrombin", "protein", "P00734", "12Ala", "GGTTGGTGTGGTTGG", "51.0 nM", -7.292, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 12 with Alanine side chain", "33614235", "10.1016/j.omtn.2021.01.004", "12Ala | 51.7 | 51.0 \u00b1 3.8 | 2.74", "step2c_literal_v3"], [79, "thrombin", "protein", "P00734", "12Trp", "GGTTGGTGTGGTTGG", "67.3 nM", -7.172, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 12 with Tryptophan side chain", "33614235", "10.1016/j.omtn.2021.01.004", "12Trp | 54.7 | 67.3 \u00b1 12.1 | 3.12", "step2c_literal_v3"], [80, "thrombin", "protein", "P00734", "12Leu", "GGTTGGTGTGGTTGG", "72.2 nM", -7.141, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 12 with Leucine side chain", "33614235", "10.1016/j.omtn.2021.01.004", "12Leu | 53.6 | 72.2 \u00b1 0.9 | 4.14", "step2c_literal_v3"], [81, "thrombin", "protein", "P00734", "12Ser", "GGTTGGTGTGGTTGG", "86.6 nM", -7.062, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 12 with Serine side chain", "33614235", "10.1016/j.omtn.2021.01.004", "12Ser | 52.0 | 86.6 \u00b1 4.5 | 2.34", "step2c_literal_v3"], [420, "17 \u03b2 -estradiol", "protein", "P42167", "HEV1", null, "9.276e-08 M", -7.033, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "MST", null, 7.6, "20 mM Tris (pH 7.6), 300 mM NaCl, 5 mM MgCl2, 0.01% Tween 20", null, "DNA", null, "38276613", "10.3390/molecules29020535", "the dissociation constant (KD value) is 92.76 \u00b1 66.02 nM as calculated by the calculation function that comes with the system.", "step2c_acs_v1"], [82, "thrombin", "protein", "P00734", "12Phe", "GGTTGGTGTGGTTGG", "99.1 nM", -7.004, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 12 with Phenylalanine side chain", "33614235", "10.1016/j.omtn.2021.01.004", "12Phe | 54.3 | 99.1 \u00b1 6.3 | 4.07", "step2c_literal_v3"], [74, "thrombin", "protein", "P00734", "3NB", "GGTTGGTGTGGTTGG", "163.5 nM", -6.786, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "MST", null, 7.4, "10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20", null, "DNA", "N3-modified T at position 3 with Nitrobenzyl side chain", "33614235", "10.1016/j.omtn.2021.01.004", "3NB | 51.7 | 163.5 \u00b1 3.5 | 3.82", "step2c_literal_v3"], [121, "CTNNA1", "protein", "P35221", "EA2", null, "2.07 \u00b5M", -5.684, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, null, "MST", null, null, null, null, "DNA", "biotinylated", "40265971", "10.1002/advs.202411930", "The K d values (2.07 \u00b1 0.60 \u00b5 M) obtained from MST assay (Figure 2l) further corroborated the specific binding between CTNNA1 and EA2.", "step2c_literal_v3"]], "truncated": false, "filtered_table_rows_count": 29, "expanded_columns": [], "expandable_columns": [], "columns": ["id", "target_name_canonical", "target_type", "target_uniprot", "aptamer_name", "aptamer_seq", "kd_reported", "kd_log10_molar", "measurement_class", "binding_constant_type", "tier", "source_origin", "verification_level", "sequence_status", "seq_source", "pi_provenance_flag", "assay_method", "assay_temperature_k", "assay_ph", "assay_buffer", "assay_cations", "aptamer_chemistry", "aptamer_modifications", "source_pmid", "doi", "verbatim_quote", "source_db"], "primary_keys": [], "units": {}, "query": {"sql": "select id, target_name_canonical, target_type, target_uniprot, aptamer_name, aptamer_seq, kd_reported, kd_log10_molar, measurement_class, binding_constant_type, tier, source_origin, verification_level, sequence_status, seq_source, pi_provenance_flag, assay_method, assay_temperature_k, assay_ph, assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications, source_pmid, doi, verbatim_quote, source_db from v_kd where \"assay_method\" = :p0 and \"target_type\" = :p1 order by kd_log10_molar limit 51", "params": {"p0": "MST", "p1": "protein"}}, "facet_results": {"measurement_class": {"name": "measurement_class", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=MST&target_type=protein", "results": [{"value": "intrinsic", "label": "intrinsic", "count": 27, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&measurement_class=intrinsic", "selected": false}, {"value": "avidity_multivalent", "label": "avidity_multivalent", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&measurement_class=avidity_multivalent", "selected": false}], "truncated": false}, "target_type": {"name": "target_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=MST&target_type=protein", "results": [{"value": "protein", "label": "protein", "count": 29, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST", "selected": true}], "truncated": false}, "tier": {"name": "tier", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=MST&target_type=protein", "results": [{"value": "Gold", "label": "Gold", "count": 29, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&tier=Gold", "selected": false}], "truncated": false}, "assay_method": {"name": "assay_method", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=MST&target_type=protein", "results": [{"value": "MST", "label": "MST", "count": 29, "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=protein", "selected": true}], "truncated": false}, "binding_constant_type": {"name": "binding_constant_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=MST&target_type=protein", "results": [{"value": "Kd", "label": "Kd", "count": 29, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&binding_constant_type=Kd", "selected": false}], "truncated": false}, "verification_level": {"name": "verification_level", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=MST&target_type=protein", "results": [{"value": "extraction_verified", "label": "extraction_verified", "count": 20, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&verification_level=extraction_verified", "selected": false}, {"value": "multi_agent_verified", "label": "multi_agent_verified", "count": 9, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&verification_level=multi_agent_verified", "selected": false}], "truncated": false}, "sequence_status": {"name": "sequence_status", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=MST&target_type=protein", "results": [{"value": "verified_in_text_or_SI", "label": "verified_in_text_or_SI", "count": 25, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&sequence_status=verified_in_text_or_SI", "selected": false}, {"value": "pending_manual_supp", "label": "pending_manual_supp", "count": 3, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&sequence_status=pending_manual_supp", "selected": false}, {"value": "pending_supp_oa", "label": "pending_supp_oa", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&sequence_status=pending_supp_oa", "selected": false}], "truncated": false}}, "suggested_facets": [{"name": "target_name_canonical", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&_facet=target_name_canonical"}, {"name": "target_uniprot", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&_facet=target_uniprot"}, {"name": "aptamer_name", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&_facet=aptamer_name"}, {"name": "aptamer_seq", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&_facet=aptamer_seq"}, {"name": "assay_ph", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&_facet=assay_ph"}, {"name": "assay_buffer", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&_facet=assay_buffer"}, {"name": "source_pmid", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&_facet=source_pmid"}, {"name": "doi", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&_facet=doi"}, {"name": "source_db", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=MST&target_type=protein&_facet=source_db"}], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 166.30268190056086, "source": "apt-scout automated curation pipeline (E. Dohi, NCNP) \u2014 values harvested from public databases; raw source stored per target", "source_url": "https://apt-scout.org", "license": "CC BY 4.0", "license_url": "https://creativecommons.org/licenses/by/4.0/"}