{"database": "scout", "table": "v_kd", "is_view": true, "human_description_en": "where assay_method = \"SPR\", sequence_status = \"verified_in_text_or_SI\" and tier = \"Gold\" sorted by kd_log10_molar", "rows": [[44, "IL-8", "protein", "P10145", "8A-35", "GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC", "1.72e-12 M", -11.764, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.0, 7.4, "HBST running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, and 0.005% Tween 20)", null, "2'F-RNA", "2'-fluoro-pyrimidine modified", "24129312", "10.1016/j.biomaterials.2013.09.107", "| 8A-35       | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80         | 3.11 x 10 1  |", "step2c_literal_v3"], [140, "PDGF-C", "protein", "P01127", "\u03b1-PC", "CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC", "20.0 pM", -10.699, "intrinsic", "KD", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, 7.4, "HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4)", null, "DNA", "PEG", "42138517", "10.1167/iovs.67.5.36", "SPR analysis demonstrated that the \u03b1 -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM", "step2c_literal_v3"], [9, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "5.7e-11 M", -10.244, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", 298.15, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11", "step2c_literal_v3"], [3, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "8.5e-11 M", -10.071, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", 298.15, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11", "step2c_literal_v3"], [154, "thrombin", "protein", "P00734", "HD1-22", "GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT", "6.5e-10 M", -9.187, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", "bivalent fusion; poly-dA linker", "18826387", "10.1111/j.1538-7836.2008.03162.x", "HD1-22 | Thrombin | K D ( M) | 6.5 \u00b7 10 ) 10", "step2c_literal_v3"], [39, "prothrombin", "protein", "P00734", "RNAR9D-14T", "GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC", "1.4 nM", -8.854, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "Hepes-saline buffer", null, "2'F-RNA", "2' Fluorocytosine; 2' Fluorouracil", "22385910", "10.1111/j.1538-7836.2012.04679.x", "Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM", "step2c_literal_v3"], [30, "thrombin", "protein", "P00734", "HD22", "AGTCCGTGGTAGGGCAGGTTGGGGTGACT", "2.4e-09 M", -8.62, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", null, "18826387", "10.1111/j.1538-7836.2008.03162.x", "HD22 | Thrombin | K D ( M) | 2.4 \u00b7 10 ) 9", "step2c_literal_v3"], [251, "Human thrombin", "protein", "P00734", "Pse08-29", "TGACCTCTAGTGACTGATTTACGAGTC", "2.6 nM", -8.585, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", "KEEP_seq_in_figure", "SPR", null, 7.4, "PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20", null, "DNA", null, "37621412", "10.1016/j.omtn.2023.07.038", "Pse(08 - 29) | 1.33 10^6 | 3.47 10^-3 | 2.6", "step2c_literal_v3"], [16, "thrombin", "protein", "P00734", "TBA", "GGTTGGTGTGGTTGG", "2.86e-09 M", -8.544, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", "biotin at 3' end; six-carbon spacer", "16053288", "10.1021/ac0502450", "thrombin | 2.2 10 5 | 6.3 10 - 4 | 3.4 10 8 | 2.86 10 - 9", "step2c_literal_v3"], [11, "sLe X", "glycan/conjugate", "Q9NSU2", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "3.3e-09 M", -8.481, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "sLe X | 1.7 3 10 5 | 5.5 3 10 2 4 | 3.0 3 10 8 | 3.3 3 10 2 9", "step2c_literal_v3"], [156, "prothrombin", "protein", "P00734", "HD1", "GGTTGGTGTGGTTGG", "3.5e-09 M", -8.456, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", null, "18826387", "10.1111/j.1538-7836.2008.03162.x", "HD1 | Prothrombin+ phospholipids | K D ( M) | 3.5 \u00b7 10 ) 9", "step2c_literal_v3"], [320, "VEGF165", "protein", "P15692", "VEap121", "TGTGGGGGTGGACGGGCCGGGTAGA", "4.700000000000001e-09 M", -8.328, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "SPR", 293.15, 7.4, "Tris-buffered saline (TBS: 10 mM Tris-HCl, 100 mM NaCl, 5 mM KCl, pH 7.4)", null, "DNA", null, "23237717", "10.1021/ac303023d", "As the calculated K d value of VEap121 was 4.7 nM", "step2c_acs_v1"], [252, "Mouse thrombin", "protein", null, "Pse08-29", "TGACCTCTAGTGACTGATTTACGAGTC", "6.3 nM", -8.201, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", "KEEP_seq_in_figure", "SPR", null, 7.4, "PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20", null, "DNA", null, "37621412", "10.1016/j.omtn.2023.07.038", "Pse(08 - 29) | 6.72 10^5 | 4.26 10^-3 | 6.3", "step2c_literal_v3"], [28, "thrombin", "protein", "P00734", "HD1", "GGTTGGTGTGGTTGG", "7.1e-09 M", -8.149, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", null, "18826387", "10.1111/j.1538-7836.2008.03162.x", "HD1 | Thrombin | K D ( M) | 7.1 \u00b7 10 ) 9", "step2c_literal_v3"], [194, "\u03b1-thrombin", "protein", "P00734", "TBA-iT7", "GGTTGGTGTGGTTGG", "9.9 nM", -8.004, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, null, "100 mM KCl", null, "DNA", "3'-inverted thymidine at position 7", "30735210", "10.1039/c9ob00053d", "TBA-iT7 | 9.9", "step2c_literal_v3"], [17, "thrombin-HRP", "protein", null, "TBA", "GGTTGGTGTGGTTGG", "1.13e-08 M", -7.947, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", "biotin at 3' end; six-carbon spacer", "16053288", "10.1021/ac0502450", "thrombin-HRP | 6.7 10 4 | 7.6 10 - 4 | 8.7 10 7 | 1.13 10 - 8", "step2c_literal_v3"], [198, "\u03b1-thrombin", "protein", "P00734", "TBA-iT9", "GGTTGGTGTGGTTGG", "11.5 nM", -7.939, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, null, "100 mM KCl", null, "DNA", "3'-inverted thymidine at position 9", "30735210", "10.1039/c9ob00053d", "TBA-iT9 | 11.5", "step2c_literal_v3"], [196, "\u03b1-thrombin", "protein", "P00734", "TBA-G8-iT8", "GGTTGGTTTGGTTGG", "12.4 nM", -7.907, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, null, "100 mM KCl", null, "DNA", "3'-inverted thymidine at position 8", "30735210", "10.1039/c9ob00053d", "TBA-G8-iT8 | 12.4", "step2c_literal_v3"], [14, "Le A", "protein", "P00488", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "1.4e-08 M", -7.854, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Le A | 7.3 3 10 2 | 1.0 3 10 2 5 | 7.2 3 10 7 | 1.4 3 10 2 8", "step2c_literal_v3"], [193, "\u03b1-thrombin", "protein", "P00734", "TBA-iT7", "GGTTGGTGTGGTTGG", "15.9 nM", -7.799, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20", null, "DNA", "3'-inverted thymidine at position 7", "30735210", "10.1039/c9ob00053d", "TBA-iT7 | 15.9", "step2c_literal_v3"], [12, "sLe A", "glycan/conjugate", "P0C0L4", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "1.7e-08 M", -7.77, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "sLe A | 1.2 3 10 3 | 1.9 3 10 2 5 | 5.9 3 10 7 | 1.7 3 10 2 8", "step2c_literal_v3"], [107, "Mouse thrombin", "protein", null, "TBA29", "TGACCCTAGTGACTGATTTACGAGGTC", "22.0 nM", -7.658, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", "KEEP_seq_in_figure", "SPR", null, 7.4, "PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20", null, "DNA", null, "37621412", "10.1016/j.omtn.2023.07.038", "TBA29 | 2.76 10^5 | 6.07 10^-3 | 22.0", "step2c_literal_v3"], [13, "Le X", "protein", "O15496", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "2.4e-08 M", -7.62, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Le X | 6.7 3 10 2 | 1.6 3 10 2 5 | 4.1 3 10 7 | 2.4 3 10 2 8", "step2c_literal_v3"], [189, "\u03b1-thrombin", "protein", "P00734", "TBA", "GGTTGGTGTGGTTGG", "27.2 nM", -7.565, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20", null, "DNA", null, "30735210", "10.1039/c9ob00053d", "TBA | 27.2", "step2c_literal_v3"], [352, "FGFR3 K650E", "protein", null, "SU-3", "CAGAGGCTGACGTAAACAGACATTGATGGGACCCACCCTTCCGCTGGCAA", "2.82e-08 M", -7.55, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, "1 \u00d7 PBS", null, "DNA", null, "31265241", "10.1021/acscombsci.9b00059", "The predicted K D was 28.2 \u00d7 10 -9 \u00b1 19.6 \u00d7 10 -9 M( n = 5) in 1 \u00d7 PBS bu ff er, using 1:1 Langmuir binding model.", "step2c_acs_v1"], [365, "Thrombin", "protein", "P00734", "aptamer 2S", "TATGGTTGGTGTGGTTGGATA", "2.9400000000000002e-08 M", -7.532, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "SPR", null, 7.6, "PBS buffer (pH 7.6) containing 138 mM NaCl and 2.7 mM KCl", null, "DNA", null, "32268723", "10.1021/acs.analchem.0c00380", "The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 \u03bcM and 29.4 nM, respectively", "step2c_acs_v1"], [141, "PDGF-C", "protein", "P01127", "\u03b1-PC", "CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC", "33.0 nM", -7.481, "intrinsic", "KD", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, 7.4, "HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4)", null, "DNA", null, "42138517", "10.1167/iovs.67.5.36", "SPR analysis demonstrated that the \u03b1 -PC aptamer bound tightly to mouse PDGF-C with a high affinity ( KD = 33 nM", "step2c_literal_v3"], [192, "\u03b1-thrombin", "protein", "P00734", "TBA-iT3", "GGTTGGTGTGGTTGG", "33.9 nM", -7.47, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, null, "100 mM KCl", null, "DNA", "3'-inverted thymidine at position 3", "30735210", "10.1039/c9ob00053d", "TBA-iT3 | 33.9", "step2c_literal_v3"], [106, "Human thrombin", "protein", "P00734", "TBA29", "TGACCCTAGTGACTGATTTACGAGGTC", "36.9 nM", -7.433, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", "KEEP_seq_in_figure", "SPR", null, 7.4, "PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20", null, "DNA", null, "37621412", "10.1016/j.omtn.2023.07.038", "TBA29 | 1.34 10^5 | 4.94 10^-3 | 36.9", "step2c_literal_v3"], [200, "\u03b1-thrombin", "protein", "P00734", "TBA-iT12", "GGTTGGTGTGGTTGG", "37.0 nM", -7.432, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, null, "100 mM KCl", null, "DNA", "3'-inverted thymidine at position 12", "30735210", "10.1039/c9ob00053d", "TBA-iT12 | 37.0", "step2c_literal_v3"], [195, "\u03b1-thrombin", "protein", "P00734", "TBA-G8-iT8", "GGTTGGTTTGGTTGG", "37.1 nM", -7.431, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20", null, "DNA", "3'-inverted thymidine at position 8", "30735210", "10.1039/c9ob00053d", "TBA-G8-iT8 | 37.1", "step2c_literal_v3"], [112, "rmCD3 d \u03b5 -Fc", "protein", null, "CD3_Apt5", "CCTTGCCTGCTTTCACGTGTGATCCCTGCCCGT", "37.9 nM", -7.421, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "PBS and 0.005% (v/v) Tween 20, pH 7.4", null, "2'F-RNA", "2' Fluoropyrimidines", "38745854", "10.1016/j.omtn.2024.102198", "aptamer 5 was the strongest binder (37.9 nM)", "step2c_literal_v3"], [197, "\u03b1-thrombin", "protein", "P00734", "TBA-iT9", "GGTTGGTGTGGTTGG", "41.0 nM", -7.387, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20", null, "DNA", "3'-inverted thymidine at position 9", "30735210", "10.1039/c9ob00053d", "TBA-iT9 | 41.0", "step2c_literal_v3"], [190, "\u03b1-thrombin", "protein", "P00734", "TBA", "GGTTGGTGTGGTTGG", "42.7 nM", -7.37, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, null, "100 mM KCl", null, "DNA", null, "30735210", "10.1039/c9ob00053d", "TBA | 42.7", "step2c_literal_v3"], [199, "\u03b1-thrombin", "protein", "P00734", "TBA-iT12", "GGTTGGTGTGGTTGG", "46.8 nM", -7.33, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20", null, "DNA", "3'-inverted thymidine at position 12", "30735210", "10.1039/c9ob00053d", "TBA-iT12 | 46.8", "step2c_literal_v3"], [104, "Human thrombin", "protein", "P00734", "M08s", "ACTGGAGATCACTGACTAAATGCTCCAG", "47.2 nM", -7.326, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", "KEEP_seq_in_figure", "SPR", null, 7.4, "PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20", null, "DNA", null, "37621412", "10.1016/j.omtn.2023.07.038", "M08s | 7.04 10^5 | 3.33 10^-2 | 47.2", "step2c_literal_v3"], [383, "A\u03b242 oligomer", "protein", null, "A\u03b2-Apt", "CGGTGGGGGACCAGTACAAAAGTGGGTAGGGCGGGTTGGAAAA", "5.33e-08 M", -7.273, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "1 \u00d7 BB: 150 mM NaCl, 10 mM Tris -HCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, pH 7.4", null, "DNA", null, "35019631", "10.1021/acsabm.0c00996", "suggesting that the binding a ffi nity of A \u03b2 -Apt with A \u03b2 42 oligomer ( K d = 53.3 nM) was stronger than that of A \u03b2 -Apt with A \u03b2 42 monomer.", "step2c_acs_v1"], [191, "\u03b1-thrombin", "protein", "P00734", "TBA-iT3", "GGTTGGTGTGGTTGG", "57.3 nM", -7.242, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20", null, "DNA", "3'-inverted thymidine at position 3", "30735210", "10.1039/c9ob00053d", "TBA-iT3 | 57.3", "step2c_literal_v3"], [51, "CD63", "protein", "P08962", "CD63 Aptamer", "ACCACCCCACCTCGCTCCCGTGACACTAATGCTACTC", "5.8e-08 M", -7.237, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, "HEPES buffer (10 mM HEPES, 150 mM NaCl)", null, "DNA", "5' amine; 3' thiol; iSpC3 spacer; 3' thio modifier", "26500145", "10.1016/j.ymeth.2015.10.012", "The equilibrium constant of the aptamer immobilized via 3 0 end was found to be KD = 5.8 -10  8 M.", "step2c_literal_v3"], [40, "prothrombin", "protein", "P00734", "ARC-183", "GGTTGGTGTGGTTGG", "60.7 nM", -7.217, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "Hepes-saline buffer", null, "DNA", null, "22385910", "10.1111/j.1538-7836.2012.04679.x", "Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM and ARC-183 = 60.7 nM)", "step2c_literal_v3"], [27, "prothrombin", "protein", "P00734", "HD1-22", "GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT", "6.1e-08 M", -7.215, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", "bivalent fusion; poly-dA linker", "18826387", "10.1111/j.1538-7836.2008.03162.x", "HD1-22 | Prothrombin | K D ( M) | 6.1 \u00b7 10 ) 8", "step2c_literal_v3"], [382, "A\u03b242 monomer", "protein", "P12821", "A\u03b2-Apt", "CGGTGGGGGACCAGTACAAAAGTGGGTAGGGCGGGTTGGAAAA", "6.34e-08 M", -7.198, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "1 \u00d7 BB: 150 mM NaCl, 10 mM Tris -HCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, pH 7.4", null, "DNA", null, "35019631", "10.1021/acsabm.0c00996", "It was evaluated that A \u03b2 -Apt showed the ability to bind A \u03b2 42 with a K d of 63.4 nM.", "step2c_acs_v1"], [155, "prothrombin", "protein", "P00734", "HD1-22", "GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT", "6.7e-08 M", -7.174, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", "bivalent fusion; poly-dA linker", "18826387", "10.1111/j.1538-7836.2008.03162.x", "HD1-22 | Prothrombin+ phospholipids | K D ( M) | 6.7 \u00b7 10 ) 8", "step2c_literal_v3"], [29, "prothrombin", "protein", "P00734", "HD1", "GGTTGGTGTGGTTGG", "7.8e-08 M", -7.108, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", null, "18826387", "10.1111/j.1538-7836.2008.03162.x", "HD1 | Prothrombin | K D ( M) | 7.8 \u00b7 10 ) 8", "step2c_literal_v3"], [386, "patulin", "protein", null, "PAT C3", "CGAAATCGCGTCCAGTGTTGGGGCGTGCTTATCCTTACACGATTTACCTGAAACGCACCGTACTGAACTACGGCGAGGTC", "8.2e-08 M", -7.086, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, "PBS", null, "DNA", "5' biotin", "35546052", "10.1021/acs.jafc.2c01591", "PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 \u00d7 10 -8 and 1.9 \u00d7 10 -7 M, respectively", "step2c_acs_v1"], [110, "rmCD3 d \u03b5 -Fc", "protein", null, "CD3_Apt1", "CCCGATTGATTCGCAATGTGCGTCCCCTCGTGCC", "91.3 nM", -7.04, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "PBS and 0.005% (v/v) Tween 20, pH 7.4", null, "2'F-RNA", "2' Fluoropyrimidines", "38745854", "10.1016/j.omtn.2024.102198", "aptamer 1 (91.3 nM)", "step2c_literal_v3"], [10, "BSA", "glycan/conjugate", "O95870", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "1e-07 M", -7.0, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "BSA | 2.2 3 10 4 | 2.3 3 10 2 3 | 9.9 3 10 6 | 1.0 3 10 2 7", "step2c_literal_v3"], [387, "patulin", "protein", null, "PAT C4", "CGAAATCGCGTCCAGTGTTGCCGATCTCCGTATCTTTCCTGTTGTTGGTTAGAGATTAGGTACTGAACTACGGCGAGGTC", "1.9e-07 M", -6.721, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, "PBS", null, "DNA", "5' biotin", "35546052", "10.1021/acs.jafc.2c01591", "PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 \u00d7 10 -8 and 1.9 \u00d7 10 -7 M, respectively", "step2c_acs_v1"], [113, "rmCD3 d \u03b5 -Fc", "protein", null, "CD3_Apt12", "TCCCCTGTCGATATCCACCGTCTGGCCCGCATTGA", "206.0 nM", -6.686, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "PBS and 0.005% (v/v) Tween 20, pH 7.4", null, "2'F-RNA", "2' Fluoropyrimidines", "38745854", "10.1016/j.omtn.2024.102198", "aptamer 12 (206 nM)", "step2c_literal_v3"], [15, "Lactose", "protein", "P00709", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "2.9e-07 M", -6.538, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Lactose | 6.3 3 10 2 | 1.8 3 10 2 4 | 3.4 3 10 6 | 2.9 3 10 2 7", "step2c_literal_v3"]], "truncated": false, "filtered_table_rows_count": 54, "expanded_columns": [], "expandable_columns": [], "columns": ["id", "target_name_canonical", "target_type", "target_uniprot", "aptamer_name", "aptamer_seq", "kd_reported", "kd_log10_molar", "measurement_class", "binding_constant_type", "tier", "source_origin", "verification_level", "sequence_status", "seq_source", "pi_provenance_flag", "assay_method", "assay_temperature_k", "assay_ph", "assay_buffer", "assay_cations", "aptamer_chemistry", "aptamer_modifications", "source_pmid", "doi", "verbatim_quote", "source_db"], "primary_keys": [], "units": {}, "query": {"sql": "select id, target_name_canonical, target_type, target_uniprot, aptamer_name, aptamer_seq, kd_reported, kd_log10_molar, measurement_class, binding_constant_type, tier, source_origin, verification_level, sequence_status, seq_source, pi_provenance_flag, assay_method, assay_temperature_k, assay_ph, assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications, source_pmid, doi, verbatim_quote, source_db from v_kd where \"assay_method\" = :p0 and \"sequence_status\" = :p1 and \"tier\" = :p2 order by kd_log10_molar limit 51", "params": {"p0": "SPR", "p1": "verified_in_text_or_SI", "p2": "Gold"}}, "facet_results": {"measurement_class": {"name": "measurement_class", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold", "results": [{"value": "intrinsic", "label": "intrinsic", "count": 37, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&measurement_class=intrinsic", "selected": false}, {"value": "non_intrinsic", "label": "non_intrinsic", "count": 17, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&measurement_class=non_intrinsic", "selected": false}], "truncated": false}, "target_type": {"name": "target_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold", "results": [{"value": "protein", "label": "protein", "count": 49, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&target_type=protein", "selected": false}, {"value": "glycan/conjugate", "label": "glycan/conjugate", "count": 5, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&target_type=glycan%2Fconjugate", "selected": false}], "truncated": false}, "tier": {"name": "tier", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold", "results": [{"value": "Gold", "label": "Gold", "count": 54, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI", "selected": true}], "truncated": false}, "assay_method": {"name": "assay_method", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold", "results": [{"value": "SPR", "label": "SPR", "count": 54, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&tier=Gold", "selected": true}], "truncated": false}, "binding_constant_type": {"name": "binding_constant_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold", "results": [{"value": "Kd", "label": "Kd", "count": 52, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&binding_constant_type=Kd", "selected": false}, {"value": "KD", "label": "KD", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&binding_constant_type=KD", "selected": false}], "truncated": false}, "verification_level": {"name": "verification_level", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold", "results": [{"value": "extraction_verified", "label": "extraction_verified", "count": 46, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&verification_level=extraction_verified", "selected": false}, {"value": "multi_agent_verified", "label": "multi_agent_verified", "count": 8, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&verification_level=multi_agent_verified", "selected": false}], "truncated": false}, "sequence_status": {"name": "sequence_status", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold", "results": [{"value": "verified_in_text_or_SI", "label": "verified_in_text_or_SI", "count": 54, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&tier=Gold", "selected": true}], "truncated": false}}, "suggested_facets": [{"name": "target_name_canonical", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=target_name_canonical"}, {"name": "target_uniprot", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=target_uniprot"}, {"name": "aptamer_name", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=aptamer_name"}, {"name": "aptamer_seq", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=aptamer_seq"}, {"name": "seq_source", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=seq_source"}, {"name": "assay_temperature_k", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=assay_temperature_k"}, {"name": "assay_ph", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=assay_ph"}, {"name": "assay_buffer", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=assay_buffer"}, {"name": "aptamer_chemistry", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=aptamer_chemistry"}, {"name": "aptamer_modifications", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=aptamer_modifications"}, {"name": "source_pmid", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=source_pmid"}, {"name": "doi", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=doi"}, {"name": "source_db", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=source_db"}], "next": "50", "next_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&sequence_status=verified_in_text_or_SI&tier=Gold&_next=50", "private": false, "allow_execute_sql": true, "query_ms": 896.6055591590703, "source": "apt-scout automated curation pipeline (E. Dohi, NCNP) \u2014 values harvested from public databases; raw source stored per target", "source_url": "https://apt-scout.org", "license": "CC BY 4.0", "license_url": "https://creativecommons.org/licenses/by/4.0/"}