{"database": "scout", "table": "v_kd", "is_view": true, "human_description_en": "where assay_method = \"SPR\" and verification_level = \"extraction_verified\" sorted by kd_log10_molar", "rows": [[44, "IL-8", "protein", "P10145", "8A-35", "GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC", "1.72e-12 M", -11.764, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.0, 7.4, "HBST running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, and 0.005% Tween 20)", null, "2'F-RNA", "2'-fluoro-pyrimidine modified", "24129312", "10.1016/j.biomaterials.2013.09.107", "| 8A-35       | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80         | 3.11 x 10 1  |", "step2c_literal_v3"], [140, "PDGF-C", "protein", "P01127", "\u03b1-PC", "CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC", "20.0 pM", -10.699, "intrinsic", "KD", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, 7.4, "HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4)", null, "DNA", "PEG", "42138517", "10.1167/iovs.67.5.36", "SPR analysis demonstrated that the \u03b1 -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM", "step2c_literal_v3"], [9, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "5.7e-11 M", -10.244, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", 298.15, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11", "step2c_literal_v3"], [56, "von Willebrand factor A1-domain", "protein", "P04275", "Rn-DsDsDs-53mh", null, "61.3 pM", -10.213, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "SPR", 310.15, null, "1 \u00d7 PBS supplemented with 0.05% (w/v) Nonidet P-40", null, "DNA", "Ds (7-(2-thienyl)imidazo[4,5b]pyridine); mini-hairpin DNA", "27966933", "10.1021/jacs.6b10767", "RnDsDsDs-53mh ( K D = 61.3 pM)", "step2c_literal_v3"], [53, "von Willebrand factor A1-domain", "protein", "P04275", "Rn-DsDsDs-44", null, "74.9 pM", -10.126, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "SPR", 310.15, null, "1 \u00d7 PBS supplemented with 0.05% (w/v) Nonidet P-40", null, "DNA", "Ds (7-(2-thienyl)imidazo[4,5b]pyridine)", "27966933", "10.1021/jacs.6b10767", "Rn-DsDsDs-44 ( K D = 74.9 pM) exhibited the highest a ffi nity", "step2c_literal_v3"], [3, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "8.5e-11 M", -10.071, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", 298.15, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11", "step2c_literal_v3"], [57, "von Willebrand factor A1-domain", "protein", "P04275", "Rn-DsDs-51mh2", null, "182.0 pM", -9.74, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "SPR", 310.15, null, "1 \u00d7 PBS supplemented with 0.05% (w/v) Nonidet P-40", null, "DNA", "Ds (7-(2-thienyl)imidazo[4,5b]pyridine); mini-hairpin DNA", "27966933", "10.1021/jacs.6b10767", "Rn-DsDs-51mh2 ( K D = 182 pM)", "step2c_literal_v3"], [55, "von Willebrand factor A1-domain", "protein", "P04275", "ARC1172-41", null, "326.0 pM", -9.487, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "SPR", 310.15, null, "1 \u00d7 PBS supplemented with 0.05% (w/v) Nonidet P-40", null, "DNA", null, "27966933", "10.1021/jacs.6b10767", "ARC1172-41 ( K D = 326 pM)", "step2c_literal_v3"], [247, "Human thrombin", "protein", "P00734", "Lin08-08", null, "0.4 nM", -9.398, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20", null, "DNA", null, "37621412", "10.1016/j.omtn.2023.07.038", "Lin(08-08) | 1.63 10^6 | 6.94 10^-4 | 0.4", "step2c_literal_v3"], [249, "Human thrombin", "protein", "P00734", "Pse08-08", null, "0.4 nM", -9.398, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20", null, "DNA", null, "37621412", "10.1016/j.omtn.2023.07.038", "Pse(08-08) | 1.19 10^6 | 5.10 10^-4 | 0.4", "step2c_literal_v3"], [2, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Selected pool", null, "5.8e-10 M", -9.237, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "no_single_sequence_pool", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Selected pool | 2.4 3 10 5 | 1.4 3 10 2 3 | 1.7 3 10 9 | 5.8 3 10 2 10", "step2c_literal_v3"], [154, "thrombin", "protein", "P00734", "HD1-22", "GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT", "6.5e-10 M", -9.187, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", "bivalent fusion; poly-dA linker", "18826387", "10.1111/j.1538-7836.2008.03162.x", "HD1-22 | Thrombin | K D ( M) | 6.5 \u00b7 10 ) 10", "step2c_literal_v3"], [4, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 2", null, "8e-10 M", -9.097, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 2 | 9.8 3 10 5 | 7.3 3 10 2 5 | 1.2 3 10 9 | 8.0 3 10 2 10", "step2c_literal_v3"], [54, "von Willebrand factor A1-domain", "protein", "P04275", "Pr-DsDsDs-40", null, "1.03 nM", -8.987, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "SPR", 310.15, null, "1 \u00d7 PBS supplemented with 0.05% (w/v) Nonidet P-40", null, "DNA", "Ds (7-(2-thienyl)imidazo[4,5b]pyridine)", "27966933", "10.1021/jacs.6b10767", "Pr-DsDsDs-40 ( K D = 1.03 nM)", "step2c_literal_v3"], [39, "prothrombin", "protein", "P00734", "RNAR9D-14T", "GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC", "1.4 nM", -8.854, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "Hepes-saline buffer", null, "2'F-RNA", "2' Fluorocytosine; 2' Fluorouracil", "22385910", "10.1111/j.1538-7836.2012.04679.x", "Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM", "step2c_literal_v3"], [108, "thrombin", "protein", "P00734", "T.7", null, "1.5 nM", -8.824, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "SPR", null, null, "binding buffer supplemented with 0.05% of Tween-20", null, "DNA", null, "37798416", "10.1038/s41587-023-01973-8", "T.7 exhibited the strongest binding signal with a 1.5 nM K d", "step2c_literal_v3"], [5, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 15", null, "2.3e-09 M", -8.638, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 15 | 3.5 3 10 5 | 8.1 3 10 2 4 | 4.3 3 10 8 | 2.3 3 10 2 9", "step2c_literal_v3"], [30, "thrombin", "protein", "P00734", "HD22", "AGTCCGTGGTAGGGCAGGTTGGGGTGACT", "2.4e-09 M", -8.62, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", null, "18826387", "10.1111/j.1538-7836.2008.03162.x", "HD22 | Thrombin | K D ( M) | 2.4 \u00b7 10 ) 9", "step2c_literal_v3"], [251, "Human thrombin", "protein", "P00734", "Pse08-29", "TGACCTCTAGTGACTGATTTACGAGTC", "2.6 nM", -8.585, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", "KEEP_seq_in_figure", "SPR", null, 7.4, "PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20", null, "DNA", null, "37621412", "10.1016/j.omtn.2023.07.038", "Pse(08 - 29) | 1.33 10^6 | 3.47 10^-3 | 2.6", "step2c_literal_v3"], [16, "thrombin", "protein", "P00734", "TBA", "GGTTGGTGTGGTTGG", "2.86e-09 M", -8.544, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", "biotin at 3' end; six-carbon spacer", "16053288", "10.1021/ac0502450", "thrombin | 2.2 10 5 | 6.3 10 - 4 | 3.4 10 8 | 2.86 10 - 9", "step2c_literal_v3"], [11, "sLe X", "glycan/conjugate", "Q9NSU2", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "3.3e-09 M", -8.481, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "sLe X | 1.7 3 10 5 | 5.5 3 10 2 4 | 3.0 3 10 8 | 3.3 3 10 2 9", "step2c_literal_v3"], [156, "prothrombin", "protein", "P00734", "HD1", "GGTTGGTGTGGTTGG", "3.5e-09 M", -8.456, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", null, "18826387", "10.1111/j.1538-7836.2008.03162.x", "HD1 | Prothrombin+ phospholipids | K D ( M) | 3.5 \u00b7 10 ) 9", "step2c_literal_v3"], [6, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 18", null, "3.9e-09 M", -8.409, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 18 | 5.1 3 10 5 | 2.0 3 10 2 3 | 2.5 3 10 8 | 3.9 3 10 2 9", "step2c_literal_v3"], [250, "Mouse thrombin", "protein", null, "Pse08-08", null, "4.2 nM", -8.377, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20", null, "DNA", null, "37621412", "10.1016/j.omtn.2023.07.038", "Pse(08-08) | 7.35 10^5 | 3.06 10^-3 | 4.2", "step2c_literal_v3"], [252, "Mouse thrombin", "protein", null, "Pse08-29", "TGACCTCTAGTGACTGATTTACGAGTC", "6.3 nM", -8.201, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", "KEEP_seq_in_figure", "SPR", null, 7.4, "PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20", null, "DNA", null, "37621412", "10.1016/j.omtn.2023.07.038", "Pse(08 - 29) | 6.72 10^5 | 4.26 10^-3 | 6.3", "step2c_literal_v3"], [248, "Mouse thrombin", "protein", null, "Lin08-08", null, "6.7 nM", -8.174, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20", null, "DNA", null, "37621412", "10.1016/j.omtn.2023.07.038", "Lin(08-08) | 6.41 10^5 | 4.30 10^-3 | 6.7", "step2c_literal_v3"], [28, "thrombin", "protein", "P00734", "HD1", "GGTTGGTGTGGTTGG", "7.1e-09 M", -8.149, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", null, "18826387", "10.1111/j.1538-7836.2008.03162.x", "HD1 | Thrombin | K D ( M) | 7.1 \u00b7 10 ) 9", "step2c_literal_v3"], [139, "PTK7", "protein", "Q13308", "4AsF", null, "7.2 nM", -8.143, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "SPR", 310.15, 7.4, "1 \u00d7 DPBS", "5.0", "DNA", "SF at positions A23, A24, A25, A26", "41065179", "10.1021/jacs.5c11823", "4AsF, which exhibited a 10-fold reduction compared to 4APS (0.77 vs 7.20 nM)", "step2c_literal_v3"], [7, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 4", null, "7.4e-09 M", -8.131, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 4 | 4.1 3 10 5 | 3.1 3 10 2 3 | 1.3 3 10 8 | 7.4 3 10 2 9", "step2c_literal_v3"], [194, "\u03b1-thrombin", "protein", "P00734", "TBA-iT7", "GGTTGGTGTGGTTGG", "9.9 nM", -8.004, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, null, "100 mM KCl", null, "DNA", "3'-inverted thymidine at position 7", "30735210", "10.1039/c9ob00053d", "TBA-iT7 | 9.9", "step2c_literal_v3"], [8, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 9", null, "1e-08 M", -8.0, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 9 | 3.5 3 10 5 | 3.1 3 10 2 3 | 9.5 3 10 7 | 1.0 3 10 2 8", "step2c_literal_v3"], [17, "thrombin-HRP", "protein", null, "TBA", "GGTTGGTGTGGTTGG", "1.13e-08 M", -7.947, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", "biotin at 3' end; six-carbon spacer", "16053288", "10.1021/ac0502450", "thrombin-HRP | 6.7 10 4 | 7.6 10 - 4 | 8.7 10 7 | 1.13 10 - 8", "step2c_literal_v3"], [198, "\u03b1-thrombin", "protein", "P00734", "TBA-iT9", "GGTTGGTGTGGTTGG", "11.5 nM", -7.939, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, null, "100 mM KCl", null, "DNA", "3'-inverted thymidine at position 9", "30735210", "10.1039/c9ob00053d", "TBA-iT9 | 11.5", "step2c_literal_v3"], [196, "\u03b1-thrombin", "protein", "P00734", "TBA-G8-iT8", "GGTTGGTTTGGTTGG", "12.4 nM", -7.907, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, null, "100 mM KCl", null, "DNA", "3'-inverted thymidine at position 8", "30735210", "10.1039/c9ob00053d", "TBA-G8-iT8 | 12.4", "step2c_literal_v3"], [14, "Le A", "protein", "P00488", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "1.4e-08 M", -7.854, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Le A | 7.3 3 10 2 | 1.0 3 10 2 5 | 7.2 3 10 7 | 1.4 3 10 2 8", "step2c_literal_v3"], [193, "\u03b1-thrombin", "protein", "P00734", "TBA-iT7", "GGTTGGTGTGGTTGG", "15.9 nM", -7.799, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20", null, "DNA", "3'-inverted thymidine at position 7", "30735210", "10.1039/c9ob00053d", "TBA-iT7 | 15.9", "step2c_literal_v3"], [12, "sLe A", "glycan/conjugate", "P0C0L4", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "1.7e-08 M", -7.77, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "sLe A | 1.2 3 10 3 | 1.9 3 10 2 5 | 5.9 3 10 7 | 1.7 3 10 2 8", "step2c_literal_v3"], [107, "Mouse thrombin", "protein", null, "TBA29", "TGACCCTAGTGACTGATTTACGAGGTC", "22.0 nM", -7.658, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", "KEEP_seq_in_figure", "SPR", null, 7.4, "PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20", null, "DNA", null, "37621412", "10.1016/j.omtn.2023.07.038", "TBA29 | 2.76 10^5 | 6.07 10^-3 | 22.0", "step2c_literal_v3"], [13, "Le X", "protein", "O15496", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "2.4e-08 M", -7.62, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Le X | 6.7 3 10 2 | 1.6 3 10 2 5 | 4.1 3 10 7 | 2.4 3 10 2 8", "step2c_literal_v3"], [302, "prostate-cancer-derived small extracellular vesicles", "cell/EV", "Q99523", "seq25", null, "24.02 nM", -7.619, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_supp_oa", null, null, "SPR", null, null, "PBST buffer", null, "DNA", "5'-FAM", "41646885", "10.1016/j.omtn.2026.102836", "The affinity of seq25 for positive selection was significantly higher than that of the other aptamers, with a KD of 24.02 nM", "step2c_literal_v3"], [189, "\u03b1-thrombin", "protein", "P00734", "TBA", "GGTTGGTGTGGTTGG", "27.2 nM", -7.565, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20", null, "DNA", null, "30735210", "10.1039/c9ob00053d", "TBA | 27.2", "step2c_literal_v3"], [141, "PDGF-C", "protein", "P01127", "\u03b1-PC", "CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC", "33.0 nM", -7.481, "intrinsic", "KD", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, 7.4, "HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4)", null, "DNA", null, "42138517", "10.1167/iovs.67.5.36", "SPR analysis demonstrated that the \u03b1 -PC aptamer bound tightly to mouse PDGF-C with a high affinity ( KD = 33 nM", "step2c_literal_v3"], [192, "\u03b1-thrombin", "protein", "P00734", "TBA-iT3", "GGTTGGTGTGGTTGG", "33.9 nM", -7.47, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, null, "100 mM KCl", null, "DNA", "3'-inverted thymidine at position 3", "30735210", "10.1039/c9ob00053d", "TBA-iT3 | 33.9", "step2c_literal_v3"], [106, "Human thrombin", "protein", "P00734", "TBA29", "TGACCCTAGTGACTGATTTACGAGGTC", "36.9 nM", -7.433, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", "KEEP_seq_in_figure", "SPR", null, 7.4, "PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20", null, "DNA", null, "37621412", "10.1016/j.omtn.2023.07.038", "TBA29 | 1.34 10^5 | 4.94 10^-3 | 36.9", "step2c_literal_v3"], [200, "\u03b1-thrombin", "protein", "P00734", "TBA-iT12", "GGTTGGTGTGGTTGG", "37.0 nM", -7.432, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, null, "100 mM KCl", null, "DNA", "3'-inverted thymidine at position 12", "30735210", "10.1039/c9ob00053d", "TBA-iT12 | 37.0", "step2c_literal_v3"], [195, "\u03b1-thrombin", "protein", "P00734", "TBA-G8-iT8", "GGTTGGTTTGGTTGG", "37.1 nM", -7.431, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20", null, "DNA", "3'-inverted thymidine at position 8", "30735210", "10.1039/c9ob00053d", "TBA-G8-iT8 | 37.1", "step2c_literal_v3"], [112, "rmCD3 d \u03b5 -Fc", "protein", null, "CD3_Apt5", "CCTTGCCTGCTTTCACGTGTGATCCCTGCCCGT", "37.9 nM", -7.421, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "PBS and 0.005% (v/v) Tween 20, pH 7.4", null, "2'F-RNA", "2' Fluoropyrimidines", "38745854", "10.1016/j.omtn.2024.102198", "aptamer 5 was the strongest binder (37.9 nM)", "step2c_literal_v3"], [197, "\u03b1-thrombin", "protein", "P00734", "TBA-iT9", "GGTTGGTGTGGTTGG", "41.0 nM", -7.387, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20", null, "DNA", "3'-inverted thymidine at position 9", "30735210", "10.1039/c9ob00053d", "TBA-iT9 | 41.0", "step2c_literal_v3"], [190, "\u03b1-thrombin", "protein", "P00734", "TBA", "GGTTGGTGTGGTTGG", "42.7 nM", -7.37, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, null, "100 mM KCl", null, "DNA", null, "30735210", "10.1039/c9ob00053d", "TBA | 42.7", "step2c_literal_v3"], [199, "\u03b1-thrombin", "protein", "P00734", "TBA-iT12", "GGTTGGTGTGGTTGG", "46.8 nM", -7.33, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20", null, "DNA", "3'-inverted thymidine at position 12", "30735210", "10.1039/c9ob00053d", "TBA-iT12 | 46.8", "step2c_literal_v3"]], "truncated": false, "filtered_table_rows_count": 66, "expanded_columns": [], "expandable_columns": [], "columns": ["id", "target_name_canonical", "target_type", "target_uniprot", "aptamer_name", "aptamer_seq", "kd_reported", "kd_log10_molar", "measurement_class", "binding_constant_type", "tier", "source_origin", "verification_level", "sequence_status", "seq_source", "pi_provenance_flag", "assay_method", "assay_temperature_k", "assay_ph", "assay_buffer", "assay_cations", "aptamer_chemistry", "aptamer_modifications", "source_pmid", "doi", "verbatim_quote", "source_db"], "primary_keys": [], "units": {}, "query": {"sql": "select id, target_name_canonical, target_type, target_uniprot, aptamer_name, aptamer_seq, kd_reported, kd_log10_molar, measurement_class, binding_constant_type, tier, source_origin, verification_level, sequence_status, seq_source, pi_provenance_flag, assay_method, assay_temperature_k, assay_ph, assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications, source_pmid, doi, verbatim_quote, source_db from v_kd where \"assay_method\" = :p0 and \"verification_level\" = :p1 order by kd_log10_molar limit 51", "params": {"p0": "SPR", "p1": "extraction_verified"}}, "facet_results": {"measurement_class": {"name": "measurement_class", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified", "results": [{"value": "intrinsic", "label": "intrinsic", "count": 44, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&measurement_class=intrinsic", "selected": false}, {"value": "non_intrinsic", "label": "non_intrinsic", "count": 22, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&measurement_class=non_intrinsic", "selected": false}], "truncated": false}, "target_type": {"name": "target_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified", "results": [{"value": "protein", "label": "protein", "count": 53, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&target_type=protein", "selected": false}, {"value": "glycan/conjugate", "label": "glycan/conjugate", "count": 12, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&target_type=glycan%2Fconjugate", "selected": false}, {"value": "cell/EV", "label": "cell/EV", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&target_type=cell%2FEV", "selected": false}], "truncated": false}, "tier": {"name": "tier", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified", "results": [{"value": "Gold", "label": "Gold", "count": 66, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&tier=Gold", "selected": false}], "truncated": false}, "assay_method": {"name": "assay_method", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified", "results": [{"value": "SPR", "label": "SPR", "count": 66, "toggle_url": "https://apt-scout.org/scout/v_kd.json?verification_level=extraction_verified", "selected": true}], "truncated": false}, "binding_constant_type": {"name": "binding_constant_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified", "results": [{"value": "Kd", "label": "Kd", "count": 64, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&binding_constant_type=Kd", "selected": false}, {"value": "KD", "label": "KD", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&binding_constant_type=KD", "selected": false}], "truncated": false}, "verification_level": {"name": "verification_level", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified", "results": [{"value": "extraction_verified", "label": "extraction_verified", "count": 66, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR", "selected": true}], "truncated": false}, "sequence_status": {"name": "sequence_status", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified", "results": [{"value": "verified_in_text_or_SI", "label": "verified_in_text_or_SI", "count": 46, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&sequence_status=verified_in_text_or_SI", "selected": false}, {"value": "pending_manual_supp", "label": "pending_manual_supp", "count": 8, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&sequence_status=pending_manual_supp", "selected": false}, {"value": "pending_manual_figure", "label": "pending_manual_figure", "count": 5, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&sequence_status=pending_manual_figure", "selected": false}, {"value": "pending_supp_oa", "label": "pending_supp_oa", "count": 5, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&sequence_status=pending_supp_oa", "selected": false}, {"value": "no_single_sequence_pool", "label": "no_single_sequence_pool", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&sequence_status=no_single_sequence_pool", "selected": false}], "truncated": false}}, "suggested_facets": [{"name": "target_name_canonical", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&_facet=target_name_canonical"}, {"name": "target_uniprot", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&_facet=target_uniprot"}, {"name": "aptamer_seq", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&_facet=aptamer_seq"}, {"name": "seq_source", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&_facet=seq_source"}, {"name": "assay_temperature_k", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&_facet=assay_temperature_k"}, {"name": "assay_buffer", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&_facet=assay_buffer"}, {"name": "assay_cations", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&_facet=assay_cations"}, {"name": "aptamer_chemistry", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&_facet=aptamer_chemistry"}, {"name": "aptamer_modifications", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&_facet=aptamer_modifications"}, {"name": "source_pmid", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&_facet=source_pmid"}, {"name": "doi", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&_facet=doi"}], "next": "50", "next_url": "https://apt-scout.org/scout/v_kd.json?assay_method=SPR&verification_level=extraction_verified&_next=50", "private": false, "allow_execute_sql": true, "query_ms": 37.53201896324754, "source": "apt-scout automated curation pipeline (E. Dohi, NCNP) \u2014 values harvested from public databases; raw source stored per target", "source_url": "https://apt-scout.org", "license": "CC BY 4.0", "license_url": "https://creativecommons.org/licenses/by/4.0/"}