{"database": "scout", "table": "v_kd", "is_view": true, "human_description_en": "where assay_method = \"affinity_real_time_qPCR\" and tier = \"Gold\" sorted by kd_log10_molar", "rows": [[363, "HBcAg", "protein", null, "A-9", "AGCAGCACAGAGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCTACCGTGAA", "2.0000000000000003e-10 M", -9.699, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, null, null, null, "DNA", null, "32250595", "10.1021/acs.analchem.9b05740", "This aptamer showed strong binding to HBcAg ( K d : 0.2 nM)", "step2c_acs_v1"], [358, "HBeAg", "protein", null, "EAg3-Py", "TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGAGATGTTTGGTTTT", "4.0000000000000007e-10 M", -9.398, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", "pyrrolo-dC", "32250595", "10.1021/acs.analchem.9b05740", "The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3", "step2c_acs_v1"], [356, "HBeAg", "protein", null, "A-9S", "ACTTTTTTGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCT", "1.2e-09 M", -8.921, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", "/5AmMC6/", "32250595", "10.1021/acs.analchem.9b05740", "The measured dissociation constant ( K d) is improved by 19 times \ue0d5 from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.", "step2c_acs_v1"], [359, "HBeAg", "protein", null, "EAg3", "TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGAGATGTTTGGTTTT", "1.7000000000000001e-09 M", -8.77, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", null, "32250595", "10.1021/acs.analchem.9b05740", "The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3, as compared to the K d value of 1.7 nM with the unmodi fi ed EAg3 aptamer.", "step2c_acs_v1"], [362, "HBeAg", "protein", null, "EAg2", "TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGTGTAGATTGGAAAA", "9.2e-09 M", -8.036, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", null, "32250595", "10.1021/acs.analchem.9b05740", "A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1, 9.2 nM for EAg2", "step2c_acs_v1"], [361, "HBeAg", "protein", null, "EAg1", "TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGTGTAGATTGGTTTT", "9.5e-09 M", -8.022, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", null, "32250595", "10.1021/acs.analchem.9b05740", "A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1", "step2c_acs_v1"], [357, "HBeAg", "protein", null, "A-9", "AGCAGCACAGAGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCTACCGTGAA", "2.29e-08 M", -7.64, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", null, "32250595", "10.1021/acs.analchem.9b05740", "The measured dissociation constant ( K d) is improved by 19 times \ue0d5 from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.", "step2c_acs_v1"], [360, "HBeAg", "protein", null, "EAg0", "TTTTTTTTGGGCGAAGACCGGGACGGGAGGATTCTGTAGATTGGTTTT", "4.4200000000000005e-08 M", -7.355, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", null, "32250595", "10.1021/acs.analchem.9b05740", "A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0", "step2c_acs_v1"]], "truncated": false, "filtered_table_rows_count": 8, "expanded_columns": [], "expandable_columns": [], "columns": ["id", "target_name_canonical", "target_type", "target_uniprot", "aptamer_name", "aptamer_seq", "kd_reported", "kd_log10_molar", "measurement_class", "binding_constant_type", "tier", "source_origin", "verification_level", "sequence_status", "seq_source", "pi_provenance_flag", "assay_method", "assay_temperature_k", "assay_ph", "assay_buffer", "assay_cations", "aptamer_chemistry", "aptamer_modifications", "source_pmid", "doi", "verbatim_quote", "source_db"], "primary_keys": [], "units": {}, "query": {"sql": "select id, target_name_canonical, target_type, target_uniprot, aptamer_name, aptamer_seq, kd_reported, kd_log10_molar, measurement_class, binding_constant_type, tier, source_origin, verification_level, sequence_status, seq_source, pi_provenance_flag, assay_method, assay_temperature_k, assay_ph, assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications, source_pmid, doi, verbatim_quote, source_db from v_kd where \"assay_method\" = :p0 and \"tier\" = :p1 order by kd_log10_molar limit 51", "params": {"p0": "affinity_real_time_qPCR", "p1": "Gold"}}, "facet_results": {"measurement_class": {"name": "measurement_class", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold", "results": [{"value": "intrinsic", "label": "intrinsic", "count": 8, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold&measurement_class=intrinsic", "selected": false}], "truncated": false}, "target_type": {"name": "target_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold", "results": [{"value": "protein", "label": "protein", "count": 8, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold&target_type=protein", "selected": false}], "truncated": false}, "tier": {"name": "tier", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold", "results": [{"value": "Gold", "label": "Gold", "count": 8, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=affinity_real_time_qPCR", "selected": true}], "truncated": false}, "assay_method": {"name": "assay_method", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold", "results": [{"value": "affinity_real_time_qPCR", "label": "affinity_real_time_qPCR", "count": 8, "toggle_url": "https://apt-scout.org/scout/v_kd.json?tier=Gold", "selected": true}], "truncated": false}, "binding_constant_type": {"name": "binding_constant_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold", "results": [{"value": "Kd", "label": "Kd", "count": 8, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold&binding_constant_type=Kd", "selected": false}], "truncated": false}, "verification_level": {"name": "verification_level", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold", "results": [{"value": "multi_agent_verified", "label": "multi_agent_verified", "count": 8, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold&verification_level=multi_agent_verified", "selected": false}], "truncated": false}, "sequence_status": {"name": "sequence_status", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold", "results": [{"value": "verified_in_text_or_SI", "label": "verified_in_text_or_SI", "count": 8, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold&sequence_status=verified_in_text_or_SI", "selected": false}], "truncated": false}}, "suggested_facets": [{"name": "target_name_canonical", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold&_facet=target_name_canonical"}, {"name": "aptamer_name", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold&_facet=aptamer_name"}, {"name": "aptamer_seq", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold&_facet=aptamer_seq"}, {"name": "verbatim_quote", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=affinity_real_time_qPCR&tier=Gold&_facet=verbatim_quote"}], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 55.32921478152275, "source": "apt-scout automated curation pipeline (E. Dohi, NCNP) \u2014 values harvested from public databases; raw source stored per target", "source_url": "https://apt-scout.org", "license": "CC BY 4.0", "license_url": "https://creativecommons.org/licenses/by/4.0/"}