{"database": "scout", "table": "v_kd", "is_view": true, "human_description_en": "where assay_method = \"fluorescence\" sorted by kd_log10_molar", "rows": [[219, "CCRF-CEM cells", "cell/EV", "Q9NRR3", "CDN-sgc8", null, "0.08 nM", -10.097, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "fluorescence", null, null, "1 \u00d7 PBS, 5 mM MgCl2", "5.0", "DNA", "biotinylated", "35670775", "10.1021/acs.analchem.2c01359", "Kd=0.08\u00b10.01 nM", "step2c_literal_v3"], [218, "CCRF-CEM cells", "cell/EV", "Q9NRR3", "mono-CDN-sgc8", null, "0.48 nM", -9.319, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "fluorescence", null, null, "1 \u00d7 PBS, 5 mM MgCl2", "5.0", "DNA", "biotinylated", "35670775", "10.1021/acs.analchem.2c01359", "Kd= 0.48 \u00b1 0.04 nM", "step2c_literal_v3"], [217, "CCRF-CEM cells", "cell/EV", "Q9NRR3", "individual sgc8", null, "0.82 nM", -9.086, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "fluorescence", null, null, "1 \u00d7 PBS, 5 mM MgCl2", "5.0", "DNA", "biotinylated", "35670775", "10.1021/acs.analchem.2c01359", "Kd=0.82 \u00b1 0.12 nM", "step2c_literal_v3"], [432, "Sc3+", "protein", "Q96PL5", "Sc-1", "CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC", "1e-09 M", -9.0, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, null, "SELEX buffer", null, "DNA", null, "39743479", "10.1021/jacs.4c13768", "true K d for the binding of Sc-1 to Sc 3+ to be 1.0 nM", "step2c_acs_v1"], [328, "ATP", "protein", "P00846", "Huizenga-Szostak ATP aptamer", null, "1.3e-09 M", -8.886, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_supp_oa", null, null, "fluorescence", null, null, null, null, "DNA", null, "25170558", "10.1021/bc500286r", "binding a ffi nity can be tuned over 4 orders of magnitude (1.3 nM -203 \u03bc M)", "step2c_acs_v1"], [348, "NP", "protein", "Q16612", "NP-C04", null, "8.1e-09 M", -8.092, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", null, 7.4, "20 mM HEPES, 150 mM NaCl, 2 mM KCl, 2 mM MgCl2, and 2 mM CaCl2 (pH 7.4)", null, "DNA", "FAM", "30740973", "10.1021/acs.analchem.8b04623", "the K d values of NP-D01, NP-C04, and NP-D02 were 76..1 \u00b1 10.9, 8.1 \u00b1 2.4, and 41.3 \u00b1 9.5 nM, respectively.", "step2c_acs_v1"], [431, "Sc3+", "protein", "Q96PL5", "Sc-1", "CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC", "1.0300000000000001e-08 M", -7.987, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, null, "SELEX buffer", null, "DNA", null, "39743479", "10.1021/jacs.4c13768", "an apparent K d value of 10.3 nM was obtained", "step2c_acs_v1"], [476, "Escherichia coli O157:H7", "protein", null, "E. coli O157:H7-specific aptamer", "CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG", "1.4400000000000002e-08 M", -7.842, "apparent_cellular", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", 298.15, null, "15% (v/v) PEG200", null, "DNA", "FAM", "41850902", "10.1021/acs.analchem.5c07364", "the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM).", "step2c_acs_v1"], [475, "Escherichia coli O157:H7", "protein", null, "E. coli O157:H7-specific aptamer", "CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG", "1.92e-08 M", -7.717, "apparent_cellular", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", 298.15, null, "liquid milk-based matrices (0% lactalbumin/lactose/casein)", null, "DNA", "FAM", "41850902", "10.1021/acs.analchem.5c07364", "the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM).", "step2c_acs_v1"], [424, "verrucarin A", "protein", null, "Ver1_JYP", null, "2.9500000000000003e-08 M", -7.53, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", null, 7.4, "SELEX buffer", null, "DNA", null, "39404132", "10.1021/acs.analchem.4c03307", "The novel ssDNA aptamer exhibited a binding affinity of 29.5 nM", "step2c_acs_v1"], [354, "paramylon", "protein", null, "Par-15", null, "3.49e-08 M", -7.457, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", null, 7.5, "binding buffer (50 mM Tris, 150 mM NaCl, 5 mM MgCl2, 1 mM EDTA, pH 7.5)", null, "DNA", "FAM", "31809034", "10.1021/acs.jafc.9b04588", "The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 \u00b1 2.61, 34.90 \u00b1 5.83, 64.06 \u00b1 6.72, 123.81 \u00b1 13.41, and 249.52 \u00b1 46.39 nM, respectively.", "step2c_acs_v1"], [355, "paramylon", "protein", null, "Par-18", null, "6.406e-08 M", -7.193, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", null, 7.5, "binding buffer (50 mM Tris, 150 mM NaCl, 5 mM MgCl2, 1 mM EDTA, pH 7.5)", null, "DNA", "FAM", "31809034", "10.1021/acs.jafc.9b04588", "The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 \u00b1 2.61, 34.90 \u00b1 5.83, 64.06 \u00b1 6.72, 123.81 \u00b1 13.41, and 249.52 \u00b1 46.39 nM, respectively.", "step2c_acs_v1"], [135, "SCAF4", "protein", "O95104", "PTf-SRiApt", "TTAAAGGGGTGGGGAGTCAT", "0.073 \u00b5M", -7.137, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, 6.5, "30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm \u03b2-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA", null, "DNA", "phosphorothioate", "40574704", "10.1002/advs.202500433", "0.073 \u00b1 0.003 \u00b5 m for PTf -SRiApt", "step2c_literal_v3"], [52, "hemagglutinin (HA) protein of H1N1 influenza virus (A/Puerto Rico/8/1934)", "protein", null, "aptamer 1", "GGGAGCTCAGAATAAACGCTCAAGGCACGGCATGTGTGGTATGTGGTGCCTGTACTCGTTCGACATGAGGCCCGGATC", "78.0 nM", -7.108, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "fluorescence", 310.15, 7.35, "binding buffer (20 mM HEPES buffer pH 7.35, 120 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, and 5 mM KCl)", "1.0", "DNA", null, "26904922", "10.1089/nat.2015.0564", "As it showed a higher binding affinity for HA protein (Kd = 78 -1nM), aptamer 1 was tested", "step2c_literal_v3"], [400, "6'-sialyllactose", "protein", "Q9Y3R4", "Apt9-1", null, "9.175000000000001e-08 M", -7.037, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", 298.15, 7.4, "10 mM PBS (pH 7.4)", null, "DNA", null, "36700646", "10.1021/acs.jafc.2c07784", "A 35 nt truncated aptamer Apt9-1 ( K d = 91.75 nM) with higher affinity than Apt9 was finally obtained.", "step2c_acs_v1"], [102, "CD9", "protein", "P21926", "CD9-26", "ATAGTCCCTTGGCGTGCTTCACAACCTTGAACTTGACGCAGGATCGTTCAGTGCGCACTAGAGCAGGTACGGTGTCA", "101.96 nM", -6.992, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "fluorescence", 277.15, null, "1 \u00d7 SELEX buffer", null, "DNA", null, "37585601", "10.1021/acssensors.3c00879", "CD9-26 | 5 \u2032 -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG TGC GCA CTA GAG CAG GTA CGG TGT CA-3 \u2032 | - 8.92", "step2c_literal_v3"], [474, "Moraxella osloensis", "protein", null, "MO9", "GCATTCAGAGCCATCCACCCTGAAGGTGGCGTATATCGATGTTCGGGACGCCGTGCCTGTTGCGTACGAATGG", "1.1890000000000001e-07 M", -6.925, "apparent_cellular", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, null, null, null, "DNA", "thiolated", "41784024", "10.1021/acssensors.5c03424", "high-a ffi nity aptamer (K d = 118.9 nM)", "step2c_acs_v1"], [134, "SCAF4", "protein", "O95104", "PT1/2-SRiApt", "TTAAAGGGGTGGGGAGTCAT", "0.121 \u00b5M", -6.917, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, 6.5, "30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm \u03b2-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA", null, "DNA", "phosphorothioate", "40574704", "10.1002/advs.202500433", "0.121 \u00b1 0.054 \u00b5 m for PT1/2 -SRiApt", "step2c_literal_v3"], [436, "SIRT2", "protein", "Q8IXJ6", "Apt 45", null, "1.233e-07 M", -6.909, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", 310.15, null, null, null, "DNA", "FAM", "40200675", "10.1021/acs.analchem.5c00066", "selected Apt 45 ( K d = 123.3 nM) to fabricate the 'turn-on' fluorescent biosensor", "step2c_acs_v1"], [399, "6'-sialyllactose", "protein", "Q9Y3R4", "Apt9", null, "1.5230000000000003e-07 M", -6.817, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", 298.15, 7.4, "10 mM PBS (pH 7.4)", null, "DNA", null, "36700646", "10.1021/acs.jafc.2c07784", "The ssDNA aptamer Apt9 ( K d = 152.3 nM) with a length of 79 nucleotides (nt) was demonstrated as the optimal aptamer candidate", "step2c_acs_v1"], [133, "SCAF4", "protein", "O95104", "PT1/3-SRiApt", "TTAAAGGGGTGGGGAGTCAT", "0.223 \u00b5M", -6.652, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, 6.5, "30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm \u03b2-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA", null, "DNA", "phosphorothioate", "40574704", "10.1002/advs.202500433", "0.223 \u00b1 0.030 \u00b5 m for PT 1/3 -SRiApt", "step2c_literal_v3"], [467, "benzovindiflupyr", "protein", null, "Apt.BZF01", null, "2.2650000000000002e-07 M", -6.645, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", null, null, null, null, "DNA", null, "41614999", "10.1021/acs.jafc.5c15044", "corrected KDs of 226.5 nM (Apt.BZF01)", "step2c_acs_v1"], [103, "CD9", "protein", "P21926", "CD9-28", "ATAGTCCCTTGGCGTGCTTCACAACCTTGAACTTGACGCAGGATCGTTCAGGGCGCACTAGAGCAGGTACGGTGTCA", "289.67 nM", -6.538, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "fluorescence", 277.15, null, "1 \u00d7 SELEX buffer", null, "DNA", null, "37585601", "10.1021/acssensors.3c00879", "CD9-28 | 5 \u2032 -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG GGC GCA CTA GAG CAG GTA CGG TGT CA-3 \u2032 | - 8.80", "step2c_literal_v3"], [450, "biliverdin", "protein", "P53004", "Bvd4", "GACGACGGGTGTGGAACAGTGCGAATACTTTCGAGTCGTC", "4.0999999999999994e-07 M", -6.387, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, 7.6, "selection buffer", null, "DNA", null, "40669049", "10.1021/acschembio.5c00438", "Titration of biliverdin into 1 \u03bcM Bvd4 aptamer led to an approximate 90% fluorescence drop (Figure 3A), and the fitted dissociation constant ( K d ) was 0.41 \u03bcM", "step2c_acs_v1"], [132, "SCAF4", "protein", "O95104", "SRiApt", "TTAAAGGGGTGGGGAGTCAT", "0.469 \u00b5M", -6.329, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, 6.5, "30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm \u03b2-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA", null, "DNA", null, "40574704", "10.1002/advs.202500433", "The binding affinities (K D ) were determined to be 0.469 \u00b1 0.010 \u00b5 m for unmodified SRiApt", "step2c_literal_v3"], [246, "CD9", "protein", "P21926", "CD9-08", "TGACACCGTACCTGCTCTAGTGCGCACTGAACGATCCTGCGTCAAGTTCAAGGTTGTGAAGCACGCCAAGGGACTAT", "494.37 nM", -6.306, "non_intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "fluorescence", 277.15, null, "1 \u00d7 SELEX buffer", null, "DNA", null, "37585601", "10.1021/acssensors.3c00879", "CD9-08 | 5 \u2032 -TGA CAC CGT ACC TGC TCT AGT GCG CAC TGA ACG ATC CTG CGT CAA GTT CAA GGT TGT GAA GCA CGC CAA GGG ACT AT-3 \u2032 | - 11.71", "step2c_literal_v3"], [453, "bilirubin", "protein", "P22309", "Brb7", "GACGACATAAGCTCTTAGCGCGTGTTTACCACCTTTGTCGTC", "1.4e-06 M", -5.854, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, 7.6, "selection buffer", null, "DNA", null, "40669049", "10.1021/acschembio.5c00438", "After titrating bilirubin into 1.0 \u03bcM Brb7 aptamer, the saturation fluorescence decrease reached 99% (Figure 6A) and its K d was fitted to be 1.4 \u03bcM", "step2c_acs_v1"], [451, "biliverdin", "protein", "P53004", "Bvd1", "GACGACGAACGGAGTAGGTTTTAACGAATGAAATGGGTCGTC", "2e-06 M", -5.699, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, 7.6, "selection buffer", null, "DNA", null, "40669049", "10.1021/acschembio.5c00438", "The same trend was also observed for the Bvd1 aptamer (Figure S1), and the fitted K d was 2.0 \u03bcM.", "step2c_acs_v1"], [425, "verrucarin A", "protein", null, "14_Ver1", null, "2.2e-06 M", -5.658, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", null, 7.4, "SELEX buffer", null, "DNA", "6-FAM at 5'-end; dabcyl at 3'-end", "39404132", "10.1021/acs.analchem.4c03307", "The binding test demonstrated that the decrease in fluorescence was correlated with increasing verrucarin A concentration with K D = 2.2 \u03bcM.", "step2c_acs_v1"], [426, "verrucarin A", "protein", null, "Ver1_JYP (C32G mutant)", null, "2.2999999999999996e-06 M", -5.638, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", null, 7.4, "SELEX buffer", null, "DNA", "C32G mutation", "39404132", "10.1021/acs.analchem.4c03307", "guanine with both functional groups exhibited partially recovered binding activity ( K D = 2.3 \u03bcM).", "step2c_acs_v1"], [122, "hemin", "protein", "Q9NP58", "Sequence D", "GGTTGGTGTGGTTGG", "2.9 \u03bcM", -5.538, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, 7.4, "10 mM K-phosphate, pH 7.4, 0.1 M KCl, and 1% DMSO", null, "DNA", "phosphorothioate (Sp, stereopure)", "40368877", "10.1021/acs.molpharmaceut.5c00117", "Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 \u03bc M for sequences C and D, respectively.", "step2c_literal_v3"], [123, "hemin", "protein", "Q9NP58", "Sequence C", "GGTTGGTGTGGTTGG", "8.3 \u03bcM", -5.081, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, 7.4, "10 mM K-phosphate, pH 7.4, 0.1 M KCl, and 1% DMSO", null, "DNA", "phosphorothioate (Rp, stereopure)", "40368877", "10.1021/acs.molpharmaceut.5c00117", "Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 \u03bc M for sequences C and D, respectively.", "step2c_literal_v3"], [454, "bilirubin", "protein", "P22309", "Brb9", "GACGACGAATGCAATGGGGCCTGCCGAACGTCTTTAGGATTT", "9e-06 M", -5.046, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, 7.6, "selection buffer", null, "DNA", null, "40669049", "10.1021/acschembio.5c00438", "The same trend was also observed in the Brb9 aptamer (Figure S4), which showed a K d of 9.0 \u03bcM.", "step2c_acs_v1"], [463, "Patulin", "protein", null, "PTL-1", null, "1.8399999999999997e-05 M", -4.735, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", null, 6.0, "selection buffer (10 mM MES, pH 6.0, 150 mM NaCl, 5 mM MgCl2)", null, "DNA", null, "41473783", "10.1186/s44280-025-00101-2", "yielding an apparent K d of 18.4 \u03bcM", "step2c_acs_v1"], [124, "dehydroepiandrosterone sulfate", "protein", "Q06520", "DHEAS aptamer (stem, Rp)", null, "32.03 \u03bcM", -4.494, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "fluorescence", null, 8.0, "20 mM Tris Buffer, 1 M NaCl, 10 mM MgCl2, pH 8.0", "10.0", "DNA", "phosphorothioate (Rp, stereopure); fluorescein", "40368877", "10.1021/acs.molpharmaceut.5c00117", "Values calculated are 32.03 \u03bc M for stem Rp", "step2c_literal_v3"], [126, "dehydroepiandrosterone sulfate", "protein", "Q06520", "DHEAS aptamer (loop, Rp)", null, "33.28 \u03bcM", -4.478, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "fluorescence", null, 8.0, "20 mM Tris Buffer, 1 M NaCl, 10 mM MgCl2, pH 8.0", "10.0", "DNA", "phosphorothioate (Rp, stereopure); fluorescein", "40368877", "10.1021/acs.molpharmaceut.5c00117", "33.28 \u03bc M for loop Rp", "step2c_literal_v3"], [125, "dehydroepiandrosterone sulfate", "protein", "Q06520", "DHEAS aptamer (stem, Sp)", null, "36.57 \u03bcM", -4.437, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "fluorescence", null, 8.0, "20 mM Tris Buffer, 1 M NaCl, 10 mM MgCl2, pH 8.0", "10.0", "DNA", "phosphorothioate (Sp, stereopure); fluorescein", "40368877", "10.1021/acs.molpharmaceut.5c00117", "36.57 \u03bc M for stem Sp", "step2c_literal_v3"], [464, "Patulin", "protein", null, "PAT-6", null, "4.8e-05 M", -4.319, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", null, 6.0, "20 mM MES buffer, pH = 6.0, with 150 mM NaCl and 2.0 mM MgCl2", null, "DNA", null, "41473783", "10.1186/s44280-025-00101-2", "PAT-6 has weaker binding affinities ( Kd = 48 \u03bcM by ThT, Fig. 4S)", "step2c_acs_v1"], [127, "dehydroepiandrosterone sulfate", "protein", "Q06520", "DHEAS aptamer (loop, Sp)", null, "59.62 \u03bcM", -4.225, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_supp", null, null, "fluorescence", null, 8.0, "20 mM Tris Buffer, 1 M NaCl, 10 mM MgCl2, pH 8.0", "10.0", "DNA", "phosphorothioate (Sp, stereopure); fluorescein", "40368877", "10.1021/acs.molpharmaceut.5c00117", "59.62 \u03bc M for loop Sp", "step2c_literal_v3"], [468, "L-lactate", "protein", "Q9BYZ2", "D-Lac1103", "TGATGTCGTC", "8.999999999999999e-05 M", -4.046, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "backfill_text_verified", null, "fluorescence", null, null, null, null, "DNA", "FAM", "41779931", "10.1021/acs.analchem.5c07149", "The true K d for D-Lac1103 was calculated to be 0.09 mM for L-lactate", "step2c_acs_v1"], [471, "L-lactate", "protein", "Q9BYZ2", "Lac201", null, "0.0009000000000000001 M", -3.046, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", 296.15, null, "SELEX buffer", null, "DNA", "2AP", "41779931", "10.1021/acs.analchem.5c07149", "the fitted K d was 0.9 mM (Figure 5C, black line)", "step2c_acs_v1"], [469, "D-lactate", "protein", "Q86WU2", "D-Lac1103", "TGATGTCGTC", "0.0025 M", -2.602, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "backfill_text_verified", null, "fluorescence", 295.15, null, "SELEX buffer", null, "DNA", "FAM", "41779931", "10.1021/acs.analchem.5c07149", "In addition, the apparent K d values for D-Lac1103 are 0.46 mMfor L-lactate and 2.5 mM for D-lactate", "step2c_acs_v1"], [457, "Tris(hydroxymethyl)aminomethane", "protein", null, "Tris aptamer", null, "0.0026000000000000003 M", -2.585, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", null, null, null, null, "DNA", null, "40905906", "10.1021/acs.analchem.5c03351", "ThT yielded K d values changed modestly from 1.6 to 2.6 mM", "step2c_acs_v1"], [473, "L-lactate", "protein", "Q9BYZ2", "Lac2059", null, "0.0033 M", -2.481, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", 296.15, null, "SELEX buffer", null, "DNA", "2AP", "41779931", "10.1021/acs.analchem.5c07149", "The fitted K d was 3.3 mM for this 2AP-labeled aptamer", "step2c_acs_v1"], [472, "L-lactate", "protein", "Q9BYZ2", "Lac201", null, "0.0043 M", -2.367, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "pending_manual_supp", null, null, "fluorescence", 296.15, null, "SELEX buffer", null, "DNA", "2AP", "41779931", "10.1021/acs.analchem.5c07149", "although the obtained K d (4.3 mM) was about 5-fold higher than that obtained using Mg 2+ .", "step2c_acs_v1"], [438, "acrylamide", "protein", "P41145", "AA-1", "GACGACGGAATCCTGGTGCACGTTGGTGGAGGTCACGTCGTC", "0.0047 M", -2.328, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, 7.4, "20 mM HEPES buffer (pH 7.4) with 100 mM NaCl and 1 mM MgCl2", null, "DNA", null, "40261307", "10.1021/acs.analchem.5c00783", "Similarly, the AA-1 aptamer exhibited a true K d value of 4.7 mM via the strand-displacement assay", "step2c_acs_v1"], [437, "acrylamide", "protein", "P41145", "AA-1", "GACGACGGAATCCTGGTGCACGTTGGTGGAGGTCACGTCGTC", "0.0105 M", -1.979, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, 7.4, "20 mM HEPES pH 7.4, 100 mM NaCl, and 1 mM MgCl2", null, "DNA", null, "40261307", "10.1021/acs.analchem.5c00783", "the fitted K d value was 10.5 mM", "step2c_acs_v1"]], "truncated": false, "filtered_table_rows_count": 47, "expanded_columns": [], "expandable_columns": [], "columns": ["id", "target_name_canonical", "target_type", "target_uniprot", "aptamer_name", "aptamer_seq", "kd_reported", "kd_log10_molar", "measurement_class", "binding_constant_type", "tier", "source_origin", "verification_level", "sequence_status", "seq_source", "pi_provenance_flag", "assay_method", "assay_temperature_k", "assay_ph", "assay_buffer", "assay_cations", "aptamer_chemistry", "aptamer_modifications", "source_pmid", "doi", "verbatim_quote", "source_db"], "primary_keys": [], "units": {}, "query": {"sql": "select id, target_name_canonical, target_type, target_uniprot, aptamer_name, aptamer_seq, kd_reported, kd_log10_molar, measurement_class, binding_constant_type, tier, source_origin, verification_level, sequence_status, seq_source, pi_provenance_flag, assay_method, assay_temperature_k, assay_ph, assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications, source_pmid, doi, verbatim_quote, source_db from v_kd where \"assay_method\" = :p0 order by kd_log10_molar limit 51", "params": {"p0": "fluorescence"}}, "facet_results": {"measurement_class": {"name": "measurement_class", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=fluorescence", "results": [{"value": "intrinsic", "label": "intrinsic", "count": 40, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&measurement_class=intrinsic", "selected": false}, {"value": "non_intrinsic", "label": "non_intrinsic", "count": 4, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&measurement_class=non_intrinsic", "selected": false}, {"value": "apparent_cellular", "label": "apparent_cellular", "count": 3, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&measurement_class=apparent_cellular", "selected": false}], "truncated": false}, "target_type": {"name": "target_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=fluorescence", "results": [{"value": "protein", "label": "protein", "count": 44, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&target_type=protein", "selected": false}, {"value": "cell/EV", "label": "cell/EV", "count": 3, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&target_type=cell%2FEV", "selected": false}], "truncated": false}, "tier": {"name": "tier", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=fluorescence", "results": [{"value": "Gold", "label": "Gold", "count": 47, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&tier=Gold", "selected": false}], "truncated": false}, "assay_method": {"name": "assay_method", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=fluorescence", "results": [{"value": "fluorescence", "label": "fluorescence", "count": 47, "toggle_url": "https://apt-scout.org/scout/v_kd.json", "selected": true}], "truncated": false}, "binding_constant_type": {"name": "binding_constant_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=fluorescence", "results": [{"value": "Kd", "label": "Kd", "count": 47, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&binding_constant_type=Kd", "selected": false}], "truncated": false}, "verification_level": {"name": "verification_level", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=fluorescence", "results": [{"value": "multi_agent_verified", "label": "multi_agent_verified", "count": 30, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&verification_level=multi_agent_verified", "selected": false}, {"value": "extraction_verified", "label": "extraction_verified", "count": 17, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&verification_level=extraction_verified", "selected": false}], "truncated": false}, "sequence_status": {"name": "sequence_status", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?assay_method=fluorescence", "results": [{"value": "pending_manual_supp", "label": "pending_manual_supp", "count": 23, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&sequence_status=pending_manual_supp", "selected": false}, {"value": "verified_in_text_or_SI", "label": "verified_in_text_or_SI", "count": 23, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&sequence_status=verified_in_text_or_SI", "selected": false}, {"value": "pending_supp_oa", "label": "pending_supp_oa", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&sequence_status=pending_supp_oa", "selected": false}], "truncated": false}}, "suggested_facets": [{"name": "target_name_canonical", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&_facet=target_name_canonical"}, {"name": "target_uniprot", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&_facet=target_uniprot"}, {"name": "aptamer_seq", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&_facet=aptamer_seq"}, {"name": "seq_source", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&_facet=seq_source"}, {"name": "assay_temperature_k", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&_facet=assay_temperature_k"}, {"name": "assay_ph", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&_facet=assay_ph"}, {"name": "assay_buffer", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&_facet=assay_buffer"}, {"name": "assay_cations", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&_facet=assay_cations"}, {"name": "aptamer_modifications", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&_facet=aptamer_modifications"}, {"name": "source_pmid", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&_facet=source_pmid"}, {"name": "doi", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&_facet=doi"}, {"name": "source_db", "toggle_url": "https://apt-scout.org/scout/v_kd.json?assay_method=fluorescence&_facet=source_db"}], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 61.278355307877064, "source": "apt-scout automated curation pipeline (E. Dohi, NCNP) \u2014 values harvested from public databases; raw source stored per target", "source_url": "https://apt-scout.org", "license": "CC BY 4.0", "license_url": "https://creativecommons.org/licenses/by/4.0/"}