{"database": "scout", "table": "v_kd", "is_view": true, "human_description_en": "where measurement_class = \"intrinsic\", sequence_status = \"verified_in_text_or_SI\" and tier = \"Gold\" sorted by kd_log10_molar", "rows": [[44, "IL-8", "protein", "P10145", "8A-35", "GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC", "1.72e-12 M", -11.764, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.0, 7.4, "HBST running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, and 0.005% Tween 20)", null, "2'F-RNA", "2'-fluoro-pyrimidine modified", "24129312", "10.1016/j.biomaterials.2013.09.107", "| 8A-35       | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80         | 3.11 x 10 1  |", "step2c_literal_v3"], [621, "nucleolin", "protein", "P19338", "Cy5-AT11-B0", "TGGTGGTGGTTGGTGGTGGTGGTGGT", "3.3e-12 M", -11.481, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "31301466", "10.1016/j.ijpharm.2019.118511", "yielding K D values of 5.2 \u00d7 10 -12 and 3.3 \u00d7 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8", "elsevier_step2c"], [620, "nucleolin", "protein", "P19338", "Cy5-AT11", "TGGTGGTGGTTGTTGTGGTGGTGGTGGT", "5.2e-12 M", -11.284, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "31301466", "10.1016/j.ijpharm.2019.118511", "yielding K D values of 5.2 \u00d7 10 -12 and 3.3 \u00d7 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8", "elsevier_step2c"], [618, "nucleolin", "protein", "P19338", "Cy5-AT11", "TGGTGGTGGTTGTTGTGGTGGTGGTGGT", "9.1e-12 M", -11.041, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "31301466", "10.1016/j.ijpharm.2019.118511", "K D values of 9.1 \u00d7 10 -12 and 9.5 \u00d7 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4", "elsevier_step2c"], [619, "nucleolin", "protein", "P19338", "Cy5-AT11-B0", "TGGTGGTGGTTGGTGGTGGTGGTGGT", "9.5e-12 M", -11.022, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "31301466", "10.1016/j.ijpharm.2019.118511", "K D values of 9.1 \u00d7 10 -12 and 9.5 \u00d7 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4", "elsevier_step2c"], [623, "Malate Synthase", "protein", "Q8N0X4", "MS10-Trunc", "GGTGGTGGTGG", "19.0 pM", -10.721, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "abstract", null, null, null, "31704587", "10.1016/j.omtn.2019.09.026", "MS10-Trunc aptamer exhibited high af fi nity for MS (equilibrium dissociation constant [KD]  19 pM)", "elsevier_step2c"], [140, "PDGF-C", "protein", "P01127", "\u03b1-PC", "CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC", "20.0 pM", -10.699, "intrinsic", "KD", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, 7.4, "HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4)", null, "DNA", "PEG", "42138517", "10.1167/iovs.67.5.36", "SPR analysis demonstrated that the \u03b1 -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM", "step2c_literal_v3"], [669, "bevacizumab", "protein", "P31995", "A14#1", "GCGGTTGGTGGTAGTTACGTTCGC", "44.0 pM", -10.357, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "abstract", null, null, null, "35114463", "10.1016/j.bios.2022.114027", "affinity of A14#1 to bevacizumab markedly increased at pH 4.7 ( K D = 44 pM)", "elsevier_step2c"], [9, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "5.7e-11 M", -10.244, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", 298.15, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11", "step2c_literal_v3"], [3, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "8.5e-11 M", -10.071, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", 298.15, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11", "step2c_literal_v3"], [547, "ofloxacin", "protein", "Q9H015", "Q2", "ATACCAGCTTATTCAATTGCAGGGTATCTGAGGCTTGATCTACTAAATGTCGTGGGGCATTGCTATTGGCGTTGATACGTACAATCGTAATCAGTTAG", "0.11 nM", -9.959, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "26547431", "10.1016/j.bios.2015.10.069", "Their K D values were calculated at K D 1\u20444 0.11 nM ( 7 0.06) for aptamer Q2", "elsevier_step2c"], [331, "MutS", "protein", "O15457", "2-06", "ACTTCTGCCCGCCTCCTTCCTGGTAAAGTCATTAATAGGTGTGGGGTGCCGGGCATTTCGGAGACGAGATAGGCGGACACT", "1.23e-10 M", -9.91, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "25668425", "10.1021/acs.analchem.5b00171", "The best fi t was obtained at K d = 123 pM and [T]0 = 213 pM", "step2c_acs_v1"], [363, "HBcAg", "protein", null, "A-9", "AGCAGCACAGAGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCTACCGTGAA", "2.0000000000000003e-10 M", -9.699, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, null, null, null, "DNA", null, "32250595", "10.1021/acs.analchem.9b05740", "This aptamer showed strong binding to HBcAg ( K d : 0.2 nM)", "step2c_acs_v1"], [548, "ofloxacin", "protein", "Q9H015", "Q8", "ATACCAGCTTATTCAATTAGTTGTGTATTGAGGTTTGATCTAGGCATAGTCAACAGAGCACGATCGATCTGGCTTGTTCTACAATCGTAATCAGTTAG", "0.2 nM", -9.699, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "26547431", "10.1016/j.bios.2015.10.069", "K D 1\u20444 0.20 nM ( 7 0.09) for aptamer Q8", "elsevier_step2c"], [558, "OH-BDE47", "protein", null, "BDE-A-8", "GACAGCCGGGGCATCAGAGCAGCCGATTGTCTGTTGTGCC", "0.2 nM", -9.699, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "27566357", "10.1016/j.aca.2016.06.040", "The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition.", "elsevier_step2c"], [639, "thrombin", "protein", "P00734", "29-mer thrombin-specific aptamer", "AGTCCGTGGTAGGGCAGGTTGGGGTGACT", "298.0 pM", -9.526, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "32570818", "10.3390/s20123442", "The n-curve analysis provided a Kd of 298 pM ( + 111 / 81 pM)", "elsevier_step2c"], [318, "VEGF165", "protein", "P15692", "3R02", "TGTGGGGGTGGACTGGGTGGGTACC", "3e-10 M", -9.523, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "23237717", "10.1021/ac303023d", "The K d value for 3R02 was 300 pM", "step2c_acs_v1"], [660, "20 Methyl Spirolide G", "protein", null, "SPX 7", "GGCGGTGTGGGTACCACGAGGTTTGGACGCGCGTAGCACCCCATTCAGC", "3e-10 M", -9.523, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "34144421", "10.1016/j.foodchem.2021.130332", "The present study, among the aptamers selected, the aptamer with highest affinity had a dissociation constant of 0.3 nM for SPX G", "elsevier_step2c"], [554, "chimeric-tPA", "protein", null, "Chi-tPA 1", "TTCCAACGGTTGGTGGGTGGTT", "0.32 nM", -9.495, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "abstract", null, null, null, "26876003", "10.1016/j.pep.2016.02.004", "selected aptamer having KD values of 0.320 nM", "elsevier_step2c"], [358, "HBeAg", "protein", null, "EAg3-Py", "TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGAGATGTTTGGTTTT", "4.0000000000000007e-10 M", -9.398, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", "pyrrolo-dC", "32250595", "10.1021/acs.analchem.9b05740", "The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3", "step2c_acs_v1"], [415, "BDNF", "protein", "P23560", "NV_B12", "GGATTTGAGCTTATGTGGCATAGGTTGCCTGGGTGGGTGGGGTCGGGGAA", "5e-10 M", -9.301, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "ALISA", null, null, "1 \u00d7 selection buffer", null, "DNA", "biotin", "38149631", "10.1021/acschemneuro.3c00661", "The equilibrium dissociation constant ( K d) for the NV_B12/BDNF interaction was obtained by fitting the equation, Y = B max \u00d7 X /( K d + X )... The K d value determined to be 0.5 nM (95% CI: 0.4 -0.6 nM)", "step2c_acs_v1"], [343, "PlanarAu", "protein", null, "1N", "TATGCATGTGTAGTAAGACCTAGTCCACAATCAACG", "5.600000000000001e-10 M", -9.252, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "QCM", null, null, "AIB", null, "DNA", null, "30189130", "10.1021/acscombsci.8b00048", "aptamer 1N showing the highest affinity (0.56 nM)", "step2c_acs_v1"], [530, "AGEs-HSA", "protein", null, "#9s", "TCTGCCACCCTCCGACTAACATATCCGGCCTGAGACCA", "0.57 nM", -9.244, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", null, null, null, null, "abstract", null, null, null, "24012635", "10.1016/j.mvr.2013.08.010", "Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively.", "elsevier_step2c"], [529, "AGEs-HSA", "protein", null, "#4s", "CAGAATCGGGGACCACGACACTGCACATACCTCGTACGAA", "0.63 nM", -9.201, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", null, null, null, null, "abstract", null, null, null, "24012635", "10.1016/j.mvr.2013.08.010", "Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively.", "elsevier_step2c"], [332, "MutS", "protein", "O15457", "2-06", "ACTTCTGCCCGCCTCCTTCCTGGTAAAGTCATTAATAGGTGTGGGGTGCCGGGCATTTCGGAGACGAGATAGGCGGACACT", "6.5e-10 M", -9.187, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "25668425", "10.1021/acs.analchem.5b00171", "The experimental points from the second step resulted in the best fi t with the theoretical dependence of R versus [L] 0 at K d = 650 pM", "step2c_acs_v1"], [634, "Immunoglobulin E", "protein", "Q96D42", "IgE37-T10-FAM", "GGGGCACGTTTATCCGTCCCTAGTGGCGTGCCCC", "0.8 nM", -9.097, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "abstract", null, null, null, "32498825", "10.1016/j.talanta.2020.121018", "The FA assay using T10-labeled aptamer with a dissociation constant ( K d) about 0.8 nM", "elsevier_step2c"], [33, "Tasset - thrombin complex", "protein", null, "Bock", "GGTTGGTGTGGTTGG", "0.87 nM", -9.06, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "BSI", 283.15, 7.5, "50 mM TRIS buffer (pH 7.5) containing 100 mM NaCl and 1 mM MgCl2", "1.0", "DNA", null, "22032342", "10.1021/ac202823m", "Bock - [Tasset complex] | not available | 0.87 ( 0.18 nM", "step2c_literal_v3"], [38, "alpha-thrombin", "protein", "P05154", "RNAR9D-14T", "GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC", "1.0 nM", -9.0, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "filter_binding", 310.15, 7.4, "Hepes-saline buffer with 0.01% BSA", null, "2'F-RNA", "2' Fluorocytosine; 2' Fluorouracil", "22385910", "10.1111/j.1538-7836.2012.04679.x", "Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) and \u03b1-thrombin (apparent Kd =1 nM)", "step2c_literal_v3"], [398, "neomycin", "protein", "Q96LI5", "Aptamer A", "GGACUGGGCGAGAAGUUUAGUCC", "1e-09 M", -9.0, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "36453647", "10.1021/acschembio.2c00653", "The binding affinity of neomycin to Aptamer A shows a strong K d  of 1 nM with an enthalpy and entropy value of -100 kJ/mol & -163.1 J/mol. K", "step2c_acs_v1"], [432, "Sc3+", "protein", "Q96PL5", "Sc-1", "CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC", "1e-09 M", -9.0, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, null, "SELEX buffer", null, "DNA", null, "39743479", "10.1021/jacs.4c13768", "true K d for the binding of Sc-1 to Sc 3+ to be 1.0 nM", "step2c_acs_v1"], [372, "beta-conglutin", "protein", null, "11-mer", "GGTGGGGGTGG", "1.05e-09 M", -8.979, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "MST", 298.15, null, "binding buffer with 0.05% v/v Tween-20", null, "DNA", null, "33498970", "10.3390/ijms22031150", "KD values determined (Figure 6b) are very similar (11-mer: 1.05 nM", "step2c_acs_v1"], [340, "AP65", "protein", "Q13882", "AP65_A1", "AGCTCCAGAAGATAAATTACAGGTGAGGGCGGGCGGGTGGTTGTAATATGATCGAATGGTATATGTGTGTTTGCAACTAGGATACTATGACCCCG", "1.057e-09 M", -8.976, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "ELAA", 298.15, 6.4, "binding buffer (10 mM phosphate, 138 mM NaCl, 2.7 mM KCl, 1.5 mM MgCl2 at pH 6.4)", null, "DNA", "5'-biotinylated", "29972299", "10.1021/acsinfecdis.8b00065", "A K D value of 1.057 nM was obtained using the sigmoidal dose-response curve model", "step2c_acs_v1"], [356, "HBeAg", "protein", null, "A-9S", "ACTTTTTTGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCT", "1.2e-09 M", -8.921, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", "/5AmMC6/", "32250595", "10.1021/acs.analchem.9b05740", "The measured dissociation constant ( K d) is improved by 19 times \ue0d5 from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.", "step2c_acs_v1"], [433, "PvTRAg", "protein", null, "Apt_16", "TTAATAACATGAGTTATTGAATTATTGTTTATTTTTTTTTTTTTG", "1.2e-09 M", -8.921, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, "DNA", null, "40042916", "10.1021/acsinfecdis.4c01047", "The K D of Apt_14 and Apt_16 was found to be comparable, 1.9 and 1.2 nM, respectively", "step2c_acs_v1"], [39, "prothrombin", "protein", "P00734", "RNAR9D-14T", "GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC", "1.4 nM", -8.854, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", 298.15, 7.4, "Hepes-saline buffer", null, "2'F-RNA", "2' Fluorocytosine; 2' Fluorouracil", "22385910", "10.1111/j.1538-7836.2012.04679.x", "Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM", "step2c_literal_v3"], [559, "OH-BDE47", "protein", null, "BDE-A-12", "ATTGCACGTCTCCGCCGCTTGGGTGGAGAGGCTATTCGGC", "1.53 nM", -8.815, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "27566357", "10.1016/j.aca.2016.06.040", "The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition.", "elsevier_step2c"], [394, "IgE", "protein", "P0DOX4", "S2", "GACTACCCGGGTATCTAATCCGACCATTTTTCGTCTCCTTTGTACGAGCAGTGTGCTCGACCTGCCGCCCGTAGG", "1.5500000000000002e-09 M", -8.81, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "NECEEM", null, 9.0, "10 mM Tris-HCl buffer (pH 9.0)", null, "DNA", "FITC", "36144553", "10.3390/molecules27185818", "Based on the results of these experiments, the K D values of S1 and S2 were estimated to be 0.83 and 1.55 nM, respectively", "step2c_acs_v1"], [41, "hOX40", "protein", null, "9C7", "GGGAGGACGATGCGGAAAAAAGAACACUUCCGAUUAGGGCCCACCCUAACGGCCGCAGACGACTCGCCCGA", "1.7 nM", -8.77, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "filter_binding", 310.15, 7.5, "selection buffer F (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2, and 0.01% BSA)", null, "2'F-RNA", null, "23113766", "10.1089/nat.2012.0388", "9C7 | 11 | 1.7", "step2c_literal_v3"], [359, "HBeAg", "protein", null, "EAg3", "TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGAGATGTTTGGTTTT", "1.7000000000000001e-09 M", -8.77, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", null, "32250595", "10.1021/acs.analchem.9b05740", "The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3, as compared to the K d value of 1.7 nM with the unmodi fi ed EAg3 aptamer.", "step2c_acs_v1"], [374, "beta-conglutin", "protein", null, "TT-11-mer", "TTGGTGGGGGTGG", "1.88e-09 M", -8.726, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "MST", 298.15, null, "binding buffer with 0.05% v/v Tween-20", null, "DNA", null, "33498970", "10.3390/ijms22031150", "KD values determined (Figure 6b) are very similar (... TT-11 mer: 1.88 nM", "step2c_acs_v1"], [35, "Bock - thrombin complex", "protein", "Q86YV9", "Tasset", "CAGTCCGTGGTAGGGCAGGTTGGGGTGACTTCGTGGAA", "1.9 nM", -8.721, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "BSI", 283.15, 7.5, "50 mM TRIS buffer (pH 7.5) containing 100 mM NaCl and 1 mM MgCl2", "1.0", "DNA", null, "22032342", "10.1021/ac202823m", "Tasset - [Bock complex] | not available | 1.9 ( 0.2 nM", "step2c_literal_v3"], [649, "THY1", "protein", "P04216", "XA-B217", "CAGGGGACGCACCAAGGTTGCCCACCGACGTGCAGGCGAACTACAGGCACGCGGCCATGACCCGCGTGCTG", "2.0 nM", -8.699, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "33242496", "10.1016/j.biochi.2020.11.018", "The equilibrium dissociation constants, Kd, were derived from these curves and are determined as ... XA-B217=2 nM", "elsevier_step2c"], [565, "Progesterone", "protein", "P06401", "PG13T2", "GATTAACATTAGCCCACCGCCCACC", "2.1 nM", -8.678, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "28237255", "10.1016/j.ab.2017.02.014", "The dissociation constant of the PG13T2-P4 complex calculated using non-linear regression fi tting of the obtained curve was found to be 2.1 nM.", "elsevier_step2c"], [727, "IL-23", "protein", "P26951", "A23P15", "GGTCACTTCCAACGCTTA", "2.139 nM", -8.67, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "backfill_text_verified", null, null, null, null, "text", null, null, null, "38810331", "10.1016/j.jpba.2024.116245", "the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively", "elsevier_step2c"], [508, "alpha-fetoprotein", "protein", "P02771", "AFP-specific ssDNA aptamer", "GGCAGGAAGACAAACAAGCTTGGCGGCGGGAAGGTGTTTAAATTCCCGGGTCTGCGTGGTCTGTGGTGCTGT", "2.37 nM", -8.625, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "text", null, null, null, "22410487", "10.1016/j.bios.2012.02.024", "The K d of the AFP-specific ssDNA was calculated to be 2.37 nM", "elsevier_step2c"], [30, "thrombin", "protein", "P00734", "HD22", "AGTCCGTGGTAGGGCAGGTTGGGGTGACT", "2.4e-09 M", -8.62, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", null, "SPR", null, null, null, null, "DNA", null, "18826387", "10.1111/j.1538-7836.2008.03162.x", "HD22 | Thrombin | K D ( M) | 2.4 \u00b7 10 ) 9", "step2c_literal_v3"], [376, "beta-conglutin", "protein", null, "11-mer-TT", "GGTGGGGGTGGTT", "2.59e-09 M", -8.587, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "MST", 298.15, null, "binding buffer with 0.05% v/v Tween-20", null, "DNA", null, "33498970", "10.3390/ijms22031150", "KD values determined (Figure 6b) are very similar (... and 11-mer-TT: 2.59 nM)", "step2c_acs_v1"], [537, "Prostate Specific Antigen", "protein", "P07288", "Apta", "TTTAAATAGCATTAAAGCTCGCCATCAAATAGC", "2.6 nM", -8.585, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "abstract", null, null, null, "25569871", "10.1016/j.bios.2014.12.033", "The change in current is used to determine the PSA -aptamer dissociation constant KD , of ca. 2.6 nM.", "elsevier_step2c"], [375, "beta-conglutin", "protein", null, "TT-11-mer-TT", "TTGGTGGGGGTGGTT", "2.71e-09 M", -8.567, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "MST", 298.15, null, "binding buffer with 0.05% v/v Tween-20", null, "DNA", null, "33498970", "10.3390/ijms22031150", "KD values determined (Figure 6b) are very similar (... TT-11-mer-TT: 2.71 nM", "step2c_acs_v1"], [712, "Neuron specific enolase", "protein", "P09104", "P-5C8G", "TCACACAGGGAGCTCTCCTACATTAATAACGCATTGCGTT", "2.76 nM", -8.559, "intrinsic", "Kd", "Gold", "elsevier", "extraction_verified", "verified_in_text_or_SI", "original", null, null, null, null, "abstract", null, null, null, "38091739", "10.1016/j.talanta.2023.125535", "The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively.", "elsevier_step2c"]], "truncated": false, "filtered_table_rows_count": 327, "expanded_columns": [], "expandable_columns": [], "columns": ["id", "target_name_canonical", "target_type", "target_uniprot", "aptamer_name", "aptamer_seq", "kd_reported", "kd_log10_molar", "measurement_class", "binding_constant_type", "tier", "source_origin", "verification_level", "sequence_status", "seq_source", "pi_provenance_flag", "assay_method", "assay_temperature_k", "assay_ph", "assay_buffer", "assay_cations", "aptamer_chemistry", "aptamer_modifications", "source_pmid", "doi", "verbatim_quote", "source_db"], "primary_keys": [], "units": {}, "query": {"sql": "select id, target_name_canonical, target_type, target_uniprot, aptamer_name, aptamer_seq, kd_reported, kd_log10_molar, measurement_class, binding_constant_type, tier, source_origin, verification_level, sequence_status, seq_source, pi_provenance_flag, assay_method, assay_temperature_k, assay_ph, assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications, source_pmid, doi, verbatim_quote, source_db from v_kd where \"measurement_class\" = :p0 and \"sequence_status\" = :p1 and \"tier\" = :p2 order by kd_log10_molar limit 51", "params": {"p0": "intrinsic", "p1": "verified_in_text_or_SI", "p2": "Gold"}}, "facet_results": {"measurement_class": {"name": "measurement_class", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold", "results": [{"value": "intrinsic", "label": "intrinsic", "count": 327, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&tier=Gold", "selected": true}], "truncated": false}, "target_type": {"name": "target_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold", "results": [{"value": "protein", "label": "protein", "count": 322, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&target_type=protein", "selected": false}, {"value": "glycan/conjugate", "label": "glycan/conjugate", "count": 5, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&target_type=glycan%2Fconjugate", "selected": false}], "truncated": false}, "tier": {"name": "tier", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold", "results": [{"value": "Gold", "label": "Gold", "count": 327, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI", "selected": true}], "truncated": false}, "assay_method": {"name": "assay_method", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold", "results": [{"value": "SPR", "label": "SPR", "count": 37, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=SPR", "selected": false}, {"value": "MST", "label": "MST", "count": 23, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=MST", "selected": false}, {"value": "fluorescence", "label": "fluorescence", "count": 19, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=fluorescence", "selected": false}, {"value": "filter_binding", "label": "filter_binding", "count": 13, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=filter_binding", "selected": false}, {"value": "affinity_real_time_qPCR", "label": "affinity_real_time_qPCR", "count": 8, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=affinity_real_time_qPCR", "selected": false}, {"value": "QCM", "label": "QCM", "count": 7, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=QCM", "selected": false}, {"value": "BLI", "label": "BLI", "count": 4, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=BLI", "selected": false}, {"value": "BSI", "label": "BSI", "count": 4, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=BSI", "selected": false}, {"value": "ITC", "label": "ITC", "count": 4, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=ITC", "selected": false}, {"value": "ELISA", "label": "ELISA", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=ELISA", "selected": false}, {"value": "flow_cytometry", "label": "flow_cytometry", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=flow_cytometry", "selected": false}, {"value": "mass_spectrometry", "label": "mass_spectrometry", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=mass_spectrometry", "selected": false}, {"value": "ALISA", "label": "ALISA", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=ALISA", "selected": false}, {"value": "ELAA", "label": "ELAA", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=ELAA", "selected": false}, {"value": "FACS", "label": "FACS", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=FACS", "selected": false}, {"value": "NECEEM", "label": "NECEEM", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=NECEEM", "selected": false}, {"value": "PISA", "label": "PISA", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=PISA", "selected": false}, {"value": "microscale thermophoresis", "label": "microscale thermophoresis", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=microscale+thermophoresis", "selected": false}, {"value": "qPCR", "label": "qPCR", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&assay_method=qPCR", "selected": false}], "truncated": false}, "binding_constant_type": {"name": "binding_constant_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold", "results": [{"value": "Kd", "label": "Kd", "count": 324, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&binding_constant_type=Kd", "selected": false}, {"value": "KD", "label": "KD", "count": 3, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&binding_constant_type=KD", "selected": false}], "truncated": false}, "verification_level": {"name": "verification_level", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold", "results": [{"value": "extraction_verified", "label": "extraction_verified", "count": 233, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&verification_level=extraction_verified", "selected": false}, {"value": "multi_agent_verified", "label": "multi_agent_verified", "count": 94, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&verification_level=multi_agent_verified", "selected": false}], "truncated": false}, "sequence_status": {"name": "sequence_status", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold", "results": [{"value": "verified_in_text_or_SI", "label": "verified_in_text_or_SI", "count": 327, "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&tier=Gold", "selected": true}], "truncated": false}}, "suggested_facets": [{"name": "source_origin", "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=source_origin"}, {"name": "seq_source", "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=seq_source"}, {"name": "assay_temperature_k", "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=assay_temperature_k"}, {"name": "assay_ph", "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=assay_ph"}, {"name": "aptamer_chemistry", "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=aptamer_chemistry"}, {"name": "source_db", "toggle_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&_facet=source_db"}], "next": "50", "next_url": "https://apt-scout.org/scout/v_kd.json?measurement_class=intrinsic&sequence_status=verified_in_text_or_SI&tier=Gold&_next=50", "private": false, "allow_execute_sql": true, "query_ms": 37.008312065154314, "source": "apt-scout automated curation pipeline (E. Dohi, NCNP) \u2014 values harvested from public databases; raw source stored per target", "source_url": "https://apt-scout.org", "license": "CC BY 4.0", "license_url": "https://creativecommons.org/licenses/by/4.0/"}