{"database": "scout", "table": "v_kd", "is_view": true, "human_description_en": "where sequence_status = \"verified_in_text_or_SI\" and verification_level = \"multi_agent_verified\" sorted by kd_log10_molar", "rows": [[319, "VEGF165", "protein", "P15692", "3R02 Bivalent", "TGTGGGGGTGGACTGGGTGGGTACCTTTTTTTTTTTGTGGGGGTGGACTGGGTGGGTACC", "3e-11 M", -10.523, "avidity_multivalent", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "23237717", "10.1021/ac303023d", "The K d value of 30 pM for 3R02 Bivalent was calculated by measuring SPR.", "step2c_acs_v1"], [312, "thrombin", "protein", "P00734", "MP-TBA15/TBA29-T15", "GGTTGGTGTGGTTGG", "5.2e-11 M", -10.284, "avidity_multivalent", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "backfill_text_verified", null, "saturation_binding", null, 7.4, "physiological buffer (25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 5.0 mM KCl, 1.0 mM MgCl2, 1.0 mM CaCl2) containing BSA (100 \u03bcM)", null, "DNA", "thiolated; 15-mer thymidine linker", "22300379", "10.1021/la204651t", "MP-TBA15/TBA29-T15 -Au NPs provided high flexibility and an appropriate orientation and distance between TBA and TBA units for bivalent binding, allowing stronger interactions with thrombin ( K d = 5.2 \u00d7 10 -11 M; Supporting Information, Figure S3)", "step2c_acs_v1"], [331, "MutS", "protein", "O15457", "2-06", "ACTTCTGCCCGCCTCCTTCCTGGTAAAGTCATTAATAGGTGTGGGGTGCCGGGCATTTCGGAGACGAGATAGGCGGACACT", "1.23e-10 M", -9.91, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "25668425", "10.1021/acs.analchem.5b00171", "The best fi t was obtained at K d = 123 pM and [T]0 = 213 pM", "step2c_acs_v1"], [363, "HBcAg", "protein", null, "A-9", "AGCAGCACAGAGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCTACCGTGAA", "2.0000000000000003e-10 M", -9.699, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, null, null, null, "DNA", null, "32250595", "10.1021/acs.analchem.9b05740", "This aptamer showed strong binding to HBcAg ( K d : 0.2 nM)", "step2c_acs_v1"], [318, "VEGF165", "protein", "P15692", "3R02", "TGTGGGGGTGGACTGGGTGGGTACC", "3e-10 M", -9.523, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "23237717", "10.1021/ac303023d", "The K d value for 3R02 was 300 pM", "step2c_acs_v1"], [358, "HBeAg", "protein", null, "EAg3-Py", "TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGAGATGTTTGGTTTT", "4.0000000000000007e-10 M", -9.398, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", "pyrrolo-dC", "32250595", "10.1021/acs.analchem.9b05740", "The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3", "step2c_acs_v1"], [415, "BDNF", "protein", "P23560", "NV_B12", "GGATTTGAGCTTATGTGGCATAGGTTGCCTGGGTGGGTGGGGTCGGGGAA", "5e-10 M", -9.301, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "ALISA", null, null, "1 \u00d7 selection buffer", null, "DNA", "biotin", "38149631", "10.1021/acschemneuro.3c00661", "The equilibrium dissociation constant ( K d) for the NV_B12/BDNF interaction was obtained by fitting the equation, Y = B max \u00d7 X /( K d + X )... The K d value determined to be 0.5 nM (95% CI: 0.4 -0.6 nM)", "step2c_acs_v1"], [343, "PlanarAu", "protein", null, "1N", "TATGCATGTGTAGTAAGACCTAGTCCACAATCAACG", "5.600000000000001e-10 M", -9.252, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "QCM", null, null, "AIB", null, "DNA", null, "30189130", "10.1021/acscombsci.8b00048", "aptamer 1N showing the highest affinity (0.56 nM)", "step2c_acs_v1"], [332, "MutS", "protein", "O15457", "2-06", "ACTTCTGCCCGCCTCCTTCCTGGTAAAGTCATTAATAGGTGTGGGGTGCCGGGCATTTCGGAGACGAGATAGGCGGACACT", "6.5e-10 M", -9.187, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "25668425", "10.1021/acs.analchem.5b00171", "The experimental points from the second step resulted in the best fi t with the theoretical dependence of R versus [L] 0 at K d = 650 pM", "step2c_acs_v1"], [398, "neomycin", "protein", "Q96LI5", "Aptamer A", "GGACUGGGCGAGAAGUUUAGUCC", "1e-09 M", -9.0, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "36453647", "10.1021/acschembio.2c00653", "The binding affinity of neomycin to Aptamer A shows a strong K d  of 1 nM with an enthalpy and entropy value of -100 kJ/mol & -163.1 J/mol. K", "step2c_acs_v1"], [432, "Sc3+", "protein", "Q96PL5", "Sc-1", "CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC", "1e-09 M", -9.0, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, null, "SELEX buffer", null, "DNA", null, "39743479", "10.1021/jacs.4c13768", "true K d for the binding of Sc-1 to Sc 3+ to be 1.0 nM", "step2c_acs_v1"], [372, "beta-conglutin", "protein", null, "11-mer", "GGTGGGGGTGG", "1.05e-09 M", -8.979, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "MST", 298.15, null, "binding buffer with 0.05% v/v Tween-20", null, "DNA", null, "33498970", "10.3390/ijms22031150", "KD values determined (Figure 6b) are very similar (11-mer: 1.05 nM", "step2c_acs_v1"], [340, "AP65", "protein", "Q13882", "AP65_A1", "AGCTCCAGAAGATAAATTACAGGTGAGGGCGGGCGGGTGGTTGTAATATGATCGAATGGTATATGTGTGTTTGCAACTAGGATACTATGACCCCG", "1.057e-09 M", -8.976, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "ELAA", 298.15, 6.4, "binding buffer (10 mM phosphate, 138 mM NaCl, 2.7 mM KCl, 1.5 mM MgCl2 at pH 6.4)", null, "DNA", "5'-biotinylated", "29972299", "10.1021/acsinfecdis.8b00065", "A K D value of 1.057 nM was obtained using the sigmoidal dose-response curve model", "step2c_acs_v1"], [356, "HBeAg", "protein", null, "A-9S", "ACTTTTTTGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCT", "1.2e-09 M", -8.921, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", "/5AmMC6/", "32250595", "10.1021/acs.analchem.9b05740", "The measured dissociation constant ( K d) is improved by 19 times \ue0d5 from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.", "step2c_acs_v1"], [433, "PvTRAg", "protein", null, "Apt_16", "TTAATAACATGAGTTATTGAATTATTGTTTATTTTTTTTTTTTTG", "1.2e-09 M", -8.921, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, "DNA", null, "40042916", "10.1021/acsinfecdis.4c01047", "The K D of Apt_14 and Apt_16 was found to be comparable, 1.9 and 1.2 nM, respectively", "step2c_acs_v1"], [350, "alkaline phosphatase", "protein", "P09923", "ALP binding aptamer", "CTTCTGCCCGCCTCCTTCCTGGAGGACTGTGGAGGACTTAGCGCCCATCCTTGCCCATGGAGACGAGATAGGCGGACACTC", "1.49e-09 M", -8.827, "avidity_multivalent", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "PISA", null, 9.5, "50 mM glycine-NaOH buffer (pH 9.5)", null, "DNA", "3'-thiol", "30827094", "10.1021/acs.analchem.9b00465", "Similarly, from the response -dose curve (Figure 3B), the K d value for the aptamer -MIP hybrid-coated array was estimated to be 1.49 \u00d7 10 -9 M", "step2c_acs_v1"], [742, "alkaline phosphatase", "protein", "P09923", "ALP binding aptamer", "CTTCTGCCCGCCTCCTTCCTGGAGGACTGTGGAGGACTTAGCGCCCATCCTTGCCCATGGAGACGAGATAGGCGGACACTC", "1.5000000000000002e-09 M", -8.824, "avidity_multivalent", "Kd", "Gold", "ACS", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "PISA", null, null, null, null, "DNA", "3'-thiol", "30827094", "10.1021/acs.analchem.9b00465", "giving cross-reactivity of 3.2 -5.6% and a dissociation constant of 1.5 nM", "step2c_acs_v1"], [394, "IgE", "protein", "P0DOX4", "S2", "GACTACCCGGGTATCTAATCCGACCATTTTTCGTCTCCTTTGTACGAGCAGTGTGCTCGACCTGCCGCCCGTAGG", "1.5500000000000002e-09 M", -8.81, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "NECEEM", null, 9.0, "10 mM Tris-HCl buffer (pH 9.0)", null, "DNA", "FITC", "36144553", "10.3390/molecules27185818", "Based on the results of these experiments, the K D values of S1 and S2 were estimated to be 0.83 and 1.55 nM, respectively", "step2c_acs_v1"], [359, "HBeAg", "protein", null, "EAg3", "TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGAGATGTTTGGTTTT", "1.7000000000000001e-09 M", -8.77, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", null, "32250595", "10.1021/acs.analchem.9b05740", "The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3, as compared to the K d value of 1.7 nM with the unmodi fi ed EAg3 aptamer.", "step2c_acs_v1"], [374, "beta-conglutin", "protein", null, "TT-11-mer", "TTGGTGGGGGTGG", "1.88e-09 M", -8.726, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "MST", 298.15, null, "binding buffer with 0.05% v/v Tween-20", null, "DNA", null, "33498970", "10.3390/ijms22031150", "KD values determined (Figure 6b) are very similar (... TT-11 mer: 1.88 nM", "step2c_acs_v1"], [376, "beta-conglutin", "protein", null, "11-mer-TT", "GGTGGGGGTGGTT", "2.59e-09 M", -8.587, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "MST", 298.15, null, "binding buffer with 0.05% v/v Tween-20", null, "DNA", null, "33498970", "10.3390/ijms22031150", "KD values determined (Figure 6b) are very similar (... and 11-mer-TT: 2.59 nM)", "step2c_acs_v1"], [375, "beta-conglutin", "protein", null, "TT-11-mer-TT", "TTGGTGGGGGTGGTT", "2.71e-09 M", -8.567, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "MST", 298.15, null, "binding buffer with 0.05% v/v Tween-20", null, "DNA", null, "33498970", "10.3390/ijms22031150", "KD values determined (Figure 6b) are very similar (... TT-11-mer-TT: 2.71 nM", "step2c_acs_v1"], [367, "SARS-CoV-2 RBD", "protein", null, "CoV2-RBD-1", "CAGCACCGACCTTGTGCTTTGGGAGTGCTGGTCCAAGGGCGTTAATGGACA", "3.1000000000000005e-09 M", -8.509, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "backfill_text_verified", null, "flow_cytometry", null, null, "PBS with 0.55 mM MgCl2", null, "DNA", null, "32551560", "10.1021/acs.analchem.0c01394", "the dissociation constant values ( K d) of the CoV2-RBD-1 aptamer ... were 3.1 nM", "step2c_acs_v1"], [410, "melamine", "protein", null, "Apt M", "TTCCTTTTCTCTCC", "4.4000000000000005e-09 M", -8.357, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "backfill_text_verified", null, null, null, null, null, null, "DNA", "abasic site", "37343019", "10.1021/acs.analchem.2c05777", "dissociation constant K d = 4.4 nM", "step2c_acs_v1"], [320, "VEGF165", "protein", "P15692", "VEap121", "TGTGGGGGTGGACGGGCCGGGTAGA", "4.700000000000001e-09 M", -8.328, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "SPR", 293.15, 7.4, "Tris-buffered saline (TBS: 10 mM Tris-HCl, 100 mM NaCl, 5 mM KCl, pH 7.4)", null, "DNA", null, "23237717", "10.1021/ac303023d", "As the calculated K d value of VEap121 was 4.7 nM", "step2c_acs_v1"], [327, "Myoglobin", "protein", "P02144", "Myo40-7-27", "CCCTCCTTTCCTTCGACTAGATCTGCTGCGTTGTTCCGA", "4.93e-09 M", -8.307, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, "DNA", null, "24914856", "10.1021/ac501088q", "The aptamer with the highest a ffi nity ( K d = 4.93 nM) was then used for the fabrication of a label-free supersandwich electrochemical biosensor for Myo detection", "step2c_acs_v1"], [455, "biliverdin", "protein", "P53004", "Bvd4", "GACGACGGGTGTGGAACAGTGCGAATACTTTCGAGTCGTC", "6.000000000000001e-09 M", -8.222, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "40669049", "10.1021/acschembio.5c00438", "For the biliverdin selection, the tightest affinity aptamer has a dissociation costant ( K d ) value of 6 nM determined using isothermal titration calorimetry (ITC)", "step2c_acs_v1"], [313, "Salmonella enteritidis", "protein", "P29460", "SENT-9", "CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT", "7.000000000000001e-09 M", -8.155, "apparent_cellular", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "22971146", "10.1021/ac302217u", "It was observed that the aptamer pool collected at the seventh round of selection had the highest binding a ffi nity to the bacteria ( K D = 7 nM).", "step2c_acs_v1"], [445, "Cu2+", "protein", "Q6UVY6", "Co-1", "GACGACGGAACGGAGGTTCTTAGGTCGGTAGACCGAGTCGTC", "8e-09 M", -8.097, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "40656531", "10.1039/d5sc02436f", "The corresponding true K d values were ... 8 nM for Cu 2+", "step2c_acs_v1"], [309, "Streptococcus pyogenes M-type mixture", "protein", null, "20A24P", "AAGCAGCACAGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTATGCGTGCTACCGTGAA", "9.000000000000001e-09 M", -8.046, "apparent_cellular", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "flow_cytometry", null, 7.4, "binding buffer (1-BB; 50 mM Tris-HCl(pH7.4), 5 mM KCl, 100 mM NaCl, 1 mM MgCl2)", null, "DNA", "5'-FAM", "21504182", "10.1021/ac200575e", "Two aptamers, 20A24P and 15A3P (with estimated binding dissociation constants of 9 and 10 nM, respectively)", "step2c_acs_v1"], [362, "HBeAg", "protein", null, "EAg2", "TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGTGTAGATTGGAAAA", "9.2e-09 M", -8.036, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", null, "32250595", "10.1021/acs.analchem.9b05740", "A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1, 9.2 nM for EAg2", "step2c_acs_v1"], [361, "HBeAg", "protein", null, "EAg1", "TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGTGTAGATTGGTTTT", "9.5e-09 M", -8.022, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", null, "32250595", "10.1021/acs.analchem.9b05740", "A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1", "step2c_acs_v1"], [310, "Streptococcus pyogenes M-type mixture", "protein", null, "15A3P", "ATTCACGGTAGCACGCATAGGGACAGCAAGCCCAAGCTGGGTGTGCAAGGTGAGGAGTGGG", "1e-08 M", -8.0, "apparent_cellular", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "flow_cytometry", null, 7.4, "binding buffer (1-BB; 50 mM Tris-HCl(pH7.4), 5 mM KCl, 100 mM NaCl, 1 mM MgCl2)", null, "DNA", "5'-FAM", "21504182", "10.1021/ac200575e", "Two aptamers, 20A24P and 15A3P (with estimated binding dissociation constants of 9 and 10 nM, respectively)", "step2c_acs_v1"], [431, "Sc3+", "protein", "Q96PL5", "Sc-1", "CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC", "1.0300000000000001e-08 M", -7.987, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", null, null, "SELEX buffer", null, "DNA", null, "39743479", "10.1021/jacs.4c13768", "an apparent K d value of 10.3 nM was obtained", "step2c_acs_v1"], [427, "U87MG GBM with IDH1 htz mutation", "protein", null, "Gli-55", "GTCCGGTTCAACCTCTAGCATTCCTGGCGTTATTAACGGAGCAGTCCTGTGGAGTGGGTGA", "1.22e-08 M", -7.914, "apparent_cellular", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "flow_cytometry", 298.15, null, "DPBS", null, "DNA", "Cy5", "39682297", "10.3390/cancers16234111", "The apparent dissociation constant measured for U87MG GBM with the IDH1 htz mutation ( Kd ) of Gli-55 is 12.2 nM", "step2c_acs_v1"], [344, "PlanarAu", "protein", null, "1N truncated", "TATGCATGTGTATATCAACACTCCGGGTCTAATCGTTCA", "1.304e-08 M", -7.885, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "QCM", null, null, "AIB", null, "DNA", null, "30189130", "10.1021/acscombsci.8b00048", "1N truncated (Kd = 13.04 nM)", "step2c_acs_v1"], [368, "SARS-CoV-2 RBD", "protein", null, "CoV2-RBD-4", "ATCCAGAGTGACGCAGCATTTCATCGGGTCCAAAAGGGGCTGCTCGGGATTGCGGATATGGACACGT", "1.3600000000000001e-08 M", -7.866, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "backfill_text_verified", null, "flow_cytometry", null, null, "PBS with 0.55 mM MgCl2", null, "DNA", null, "32551560", "10.1021/acs.analchem.0c01394", "the dissociation constant values ( K d) of the ... CoV2-RBD-4 aptamer ... were ... 13.6 nM", "step2c_acs_v1"], [428, "U87MG GBM with IDH1 htz mutation", "protein", null, "Gli-35", "GCGTTATTAACGGAGCAGTCCTGTGGAGTGGGTGA", "1.3600000000000001e-08 M", -7.866, "apparent_cellular", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "flow_cytometry", 298.15, null, "DPBS", null, "DNA", "Cy5", "39682297", "10.3390/cancers16234111", "while for Gli-35, it is 13.6 nM.", "step2c_acs_v1"], [476, "Escherichia coli O157:H7", "protein", null, "E. coli O157:H7-specific aptamer", "CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG", "1.4400000000000002e-08 M", -7.842, "apparent_cellular", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", 298.15, null, "15% (v/v) PEG200", null, "DNA", "FAM", "41850902", "10.1021/acs.analchem.5c07364", "the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM).", "step2c_acs_v1"], [411, "thrombin", "protein", "P00734", "TBA15-AnBtz", "GGTTGGTGTGGTTGGTATATT", "1.5000000000000002e-08 M", -7.824, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "37857354", "10.1021/acs.bioconjchem.3c00373", "apparent dissociation constant ( K d ) of 15 nM", "step2c_acs_v1"], [330, "Progesterone", "protein", "P06401", "P4G13", "GCATCACACACCGATACTCACCCGCCTGATTAACATTAGCCCACCGCCCACCCCCGCTGC", "1.7e-08 M", -7.77, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "25486123", "10.1021/ac503639s", "The dissociation constant of the best aptamer, designated as P4G13, was estimated to be 17 nM by electrochemical impedance spectroscopy (EIS) as well as fl uorometric assay.", "step2c_acs_v1"], [421, "hnRNP A1", "protein", "P09651", "AS1411", "GGTGGTGGTGGTTGTGGTGGTGGTGG", "1.75e-08 M", -7.757, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "BLI", null, 7.4, "BLI buffer (20 mM phosphate buffer, 8 mM KCl, 137 mM NaCl, 0.05% surfactant P20)", null, "DNA", null, "38784467", "10.1039/d3md00752a", "for AS1411, the K d value was 17.5 nM (Fig. 6B)", "step2c_acs_v1"], [475, "Escherichia coli O157:H7", "protein", null, "E. coli O157:H7-specific aptamer", "CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG", "1.92e-08 M", -7.717, "apparent_cellular", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "fluorescence", 298.15, null, "liquid milk-based matrices (0% lactalbumin/lactose/casein)", null, "DNA", "FAM", "41850902", "10.1021/acs.analchem.5c07364", "the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM).", "step2c_acs_v1"], [441, "xanthylacrylamide", "protein", null, "XAA-1", "GACGACGTAGGTGTGGATGGCTTTGAAAAAGGGCTAGTCGTC", "2e-08 M", -7.699, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "40261307", "10.1021/acs.analchem.5c00783", "The true K d of aptamer XAA-1 was calculated to be 20 nM after accounting for the competitive effect of the quencher-labeled strand", "step2c_acs_v1"], [422, "hnRNP A1", "protein", "P09651", "TBA", "GGTTGGTGTGGTTGG", "2.1100000000000004e-08 M", -7.676, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "BLI", null, 7.4, "BLI buffer (20 mM phosphate buffer, 8 mM KCl, 137 mM NaCl, 0.05% surfactant P20)", null, "DNA", null, "38784467", "10.1039/d3md00752a", "for TBA, the K d value was 21.1 nM (Fig. 6A)", "step2c_acs_v1"], [357, "HBeAg", "protein", null, "A-9", "AGCAGCACAGAGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCTACCGTGAA", "2.29e-08 M", -7.64, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "affinity_real_time_qPCR", null, 7.4, "1 \u00d7 BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)", null, "DNA", null, "32250595", "10.1021/acs.analchem.9b05740", "The measured dissociation constant ( K d) is improved by 19 times \ue0d5 from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.", "step2c_acs_v1"], [373, "beta-conglutin", "protein", null, "11-mer", "GGTGGGGGTGG", "2.3300000000000003e-08 M", -7.633, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "BLI", 303.15, 7.4, "PBS, 1.5 mM MgCl2, pH 7.4, 0.1% Tween-20", null, "DNA", null, "33498970", "10.3390/ijms22031150", "A 2:1 heterogenous model was used to fit the data and calculate the binding affinities resulting in two different KD values of 6.95 and 23.30 nM.", "step2c_acs_v1"], [485, "melamine", "protein", null, "Mel36-1", "GGAGTTCGTAGAGGTGTCCTAAGTCTTTAGGTTGGA", "2.4000000000000003e-08 M", -7.62, "non_intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "backfill_text_verified", null, null, 298.15, null, null, null, null, null, "42261635", "10.1021/acs.analchem.6c01553", "Mel36-1 has the most sensitive response with an apparent K d of 24 nM", "step2c_acs_v1"], [317, "Salmonella typhimurium", "protein", "Q8IWE5", "STYP-3", "GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC", "2.5000000000000002e-08 M", -7.602, "apparent_cellular", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, null, null, null, null, null, null, null, "23075417", "10.1021/ac302902s", "It was observed that the aptamer pool collected at the seventh round of selection had the highest binding a ffi nity to the bacteria ( K D = 25 nM).", "step2c_acs_v1"], [416, "Sterigmatocystin", "protein", null, "H Seq02", "GAATACGGATTACTGTTCGTACTGACCTATGCTGTGGAGT", "2.53e-08 M", -7.597, "intrinsic", "Kd", "Gold", "v4", "multi_agent_verified", "verified_in_text_or_SI", "original", null, "ITC", null, null, null, null, "DNA", "amino-modified", "38175632", "10.1021/acs.analchem.3c03675", "The final fitting curve showed a reduced chi-squared (kcal/mol) 2 of 0.871, and the K D value was 25.3 nM.", "step2c_acs_v1"]], "truncated": false, "filtered_table_rows_count": 113, "expanded_columns": [], "expandable_columns": [], "columns": ["id", "target_name_canonical", "target_type", "target_uniprot", "aptamer_name", "aptamer_seq", "kd_reported", "kd_log10_molar", "measurement_class", "binding_constant_type", "tier", "source_origin", "verification_level", "sequence_status", "seq_source", "pi_provenance_flag", "assay_method", "assay_temperature_k", "assay_ph", "assay_buffer", "assay_cations", "aptamer_chemistry", "aptamer_modifications", "source_pmid", "doi", "verbatim_quote", "source_db"], "primary_keys": [], "units": {}, "query": {"sql": "select id, target_name_canonical, target_type, target_uniprot, aptamer_name, aptamer_seq, kd_reported, kd_log10_molar, measurement_class, binding_constant_type, tier, source_origin, verification_level, sequence_status, seq_source, pi_provenance_flag, assay_method, assay_temperature_k, assay_ph, assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications, source_pmid, doi, verbatim_quote, source_db from v_kd where \"sequence_status\" = :p0 and \"verification_level\" = :p1 order by kd_log10_molar limit 51", "params": {"p0": "verified_in_text_or_SI", "p1": "multi_agent_verified"}}, "facet_results": {"measurement_class": {"name": "measurement_class", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified", "results": [{"value": "intrinsic", "label": "intrinsic", "count": 94, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&measurement_class=intrinsic", "selected": false}, {"value": "apparent_cellular", "label": "apparent_cellular", "count": 12, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&measurement_class=apparent_cellular", "selected": false}, {"value": "avidity_multivalent", "label": "avidity_multivalent", "count": 6, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&measurement_class=avidity_multivalent", "selected": false}, {"value": "non_intrinsic", "label": "non_intrinsic", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&measurement_class=non_intrinsic", "selected": false}], "truncated": false}, "target_type": {"name": "target_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified", "results": [{"value": "protein", "label": "protein", "count": 113, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&target_type=protein", "selected": false}], "truncated": false}, "tier": {"name": "tier", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified", "results": [{"value": "Gold", "label": "Gold", "count": 113, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&tier=Gold", "selected": false}], "truncated": false}, "assay_method": {"name": "assay_method", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified", "results": [{"value": "fluorescence", "label": "fluorescence", "count": 13, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&assay_method=fluorescence", "selected": false}, {"value": "SPR", "label": "SPR", "count": 8, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&assay_method=SPR", "selected": false}, {"value": "affinity_real_time_qPCR", "label": "affinity_real_time_qPCR", "count": 8, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&assay_method=affinity_real_time_qPCR", "selected": false}, {"value": "flow_cytometry", "label": "flow_cytometry", "count": 8, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&assay_method=flow_cytometry", "selected": false}, {"value": "MST", "label": "MST", "count": 6, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&assay_method=MST", "selected": false}, {"value": "BLI", "label": "BLI", "count": 3, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&assay_method=BLI", "selected": false}, {"value": "PISA", "label": "PISA", "count": 3, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&assay_method=PISA", "selected": false}, {"value": "ITC", "label": "ITC", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&assay_method=ITC", "selected": false}, {"value": "QCM", "label": "QCM", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&assay_method=QCM", "selected": false}, {"value": "ALISA", "label": "ALISA", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&assay_method=ALISA", "selected": false}, {"value": "ELAA", "label": "ELAA", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&assay_method=ELAA", "selected": false}, {"value": "NECEEM", "label": "NECEEM", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&assay_method=NECEEM", "selected": false}, {"value": "saturation_binding", "label": "saturation_binding", "count": 1, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&assay_method=saturation_binding", "selected": false}], "truncated": false}, "binding_constant_type": {"name": "binding_constant_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified", "results": [{"value": "Kd", "label": "Kd", "count": 113, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&binding_constant_type=Kd", "selected": false}], "truncated": false}, "verification_level": {"name": "verification_level", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified", "results": [{"value": "multi_agent_verified", "label": "multi_agent_verified", "count": 113, "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI", "selected": true}], "truncated": false}, "sequence_status": {"name": "sequence_status", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified", "results": [{"value": "verified_in_text_or_SI", "label": "verified_in_text_or_SI", "count": 113, "toggle_url": "https://apt-scout.org/scout/v_kd.json?verification_level=multi_agent_verified", "selected": true}], "truncated": false}}, "suggested_facets": [{"name": "source_origin", "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&_facet=source_origin"}, {"name": "seq_source", "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&_facet=seq_source"}, {"name": "assay_temperature_k", "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&_facet=assay_temperature_k"}, {"name": "assay_ph", "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&_facet=assay_ph"}, {"name": "assay_buffer", "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&_facet=assay_buffer"}, {"name": "aptamer_chemistry", "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&_facet=aptamer_chemistry"}, {"name": "aptamer_modifications", "toggle_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&_facet=aptamer_modifications"}], "next": "50", "next_url": "https://apt-scout.org/scout/v_kd.json?sequence_status=verified_in_text_or_SI&verification_level=multi_agent_verified&_next=50", "private": false, "allow_execute_sql": true, "query_ms": 70.74365625157952, "source": "apt-scout automated curation pipeline (E. Dohi, NCNP) \u2014 values harvested from public databases; raw source stored per target", "source_url": "https://apt-scout.org", "license": "CC BY 4.0", "license_url": "https://creativecommons.org/licenses/by/4.0/"}