{"database": "scout", "table": "v_kd", "is_view": true, "human_description_en": "where target_type = \"glycan/conjugate\" and verification_level = \"extraction_verified\" sorted by kd_log10_molar", "rows": [[9, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "5.7e-11 M", -10.244, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", 298.15, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11", "step2c_literal_v3"], [3, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "8.5e-11 M", -10.071, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", 298.15, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11", "step2c_literal_v3"], [2, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Selected pool", null, "5.8e-10 M", -9.237, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "no_single_sequence_pool", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Selected pool | 2.4 3 10 5 | 1.4 3 10 2 3 | 1.7 3 10 9 | 5.8 3 10 2 10", "step2c_literal_v3"], [4, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 2", null, "8e-10 M", -9.097, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 2 | 9.8 3 10 5 | 7.3 3 10 2 5 | 1.2 3 10 9 | 8.0 3 10 2 10", "step2c_literal_v3"], [5, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 15", null, "2.3e-09 M", -8.638, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 15 | 3.5 3 10 5 | 8.1 3 10 2 4 | 4.3 3 10 8 | 2.3 3 10 2 9", "step2c_literal_v3"], [11, "sLe X", "glycan/conjugate", "Q9NSU2", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "3.3e-09 M", -8.481, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "sLe X | 1.7 3 10 5 | 5.5 3 10 2 4 | 3.0 3 10 8 | 3.3 3 10 2 9", "step2c_literal_v3"], [6, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 18", null, "3.9e-09 M", -8.409, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 18 | 5.1 3 10 5 | 2.0 3 10 2 3 | 2.5 3 10 8 | 3.9 3 10 2 9", "step2c_literal_v3"], [7, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 4", null, "7.4e-09 M", -8.131, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 4 | 4.1 3 10 5 | 3.1 3 10 2 3 | 1.3 3 10 8 | 7.4 3 10 2 9", "step2c_literal_v3"], [8, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Clone 9", null, "1e-08 M", -8.0, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "pending_manual_figure", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Clone 9 | 3.5 3 10 5 | 3.1 3 10 2 3 | 9.5 3 10 7 | 1.0 3 10 2 8", "step2c_literal_v3"], [12, "sLe A", "glycan/conjugate", "P0C0L4", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "1.7e-08 M", -7.77, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "sLe A | 1.2 3 10 3 | 1.9 3 10 2 5 | 5.9 3 10 7 | 1.7 3 10 2 8", "step2c_literal_v3"], [10, "BSA", "glycan/conjugate", "O95870", "Clone 5", "GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU", "1e-07 M", -7.0, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "verified_in_text_or_SI", "original", "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "BSA | 2.2 3 10 4 | 2.3 3 10 2 3 | 9.9 3 10 6 | 1.0 3 10 2 7", "step2c_literal_v3"], [1, "sLe X -BSA", "glycan/conjugate", "Q9NSU2", "Original pool", null, "1.3e-07 M", -6.886, "intrinsic", "Kd", "Gold", "v4", "extraction_verified", "no_single_sequence_pool", null, "KEEP_seq_in_figure", "SPR", null, 7.4, "RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2]", "1.0", "RNA", null, "11178986", "10.1006/bbrc.2001.4327", "Original pool | 2.6 3 10 4 | 3.3 3 10 2 3 | 7.6 3 10 6 | 1.3 3 10 2 7", "step2c_literal_v3"]], "truncated": false, "filtered_table_rows_count": 12, "expanded_columns": [], "expandable_columns": [], "columns": ["id", "target_name_canonical", "target_type", "target_uniprot", "aptamer_name", "aptamer_seq", "kd_reported", "kd_log10_molar", "measurement_class", "binding_constant_type", "tier", "source_origin", "verification_level", "sequence_status", "seq_source", "pi_provenance_flag", "assay_method", "assay_temperature_k", "assay_ph", "assay_buffer", "assay_cations", "aptamer_chemistry", "aptamer_modifications", "source_pmid", "doi", "verbatim_quote", "source_db"], "primary_keys": [], "units": {}, "query": {"sql": "select id, target_name_canonical, target_type, target_uniprot, aptamer_name, aptamer_seq, kd_reported, kd_log10_molar, measurement_class, binding_constant_type, tier, source_origin, verification_level, sequence_status, seq_source, pi_provenance_flag, assay_method, assay_temperature_k, assay_ph, assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications, source_pmid, doi, verbatim_quote, source_db from v_kd where \"target_type\" = :p0 and \"verification_level\" = :p1 order by kd_log10_molar limit 51", "params": {"p0": "glycan/conjugate", "p1": "extraction_verified"}}, "facet_results": {"measurement_class": {"name": "measurement_class", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified", "results": [{"value": "intrinsic", "label": "intrinsic", "count": 12, "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified&measurement_class=intrinsic", "selected": false}], "truncated": false}, "target_type": {"name": "target_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified", "results": [{"value": "glycan/conjugate", "label": "glycan/conjugate", "count": 12, "toggle_url": "https://apt-scout.org/scout/v_kd.json?verification_level=extraction_verified", "selected": true}], "truncated": false}, "tier": {"name": "tier", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified", "results": [{"value": "Gold", "label": "Gold", "count": 12, "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified&tier=Gold", "selected": false}], "truncated": false}, "assay_method": {"name": "assay_method", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified", "results": [{"value": "SPR", "label": "SPR", "count": 12, "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified&assay_method=SPR", "selected": false}], "truncated": false}, "binding_constant_type": {"name": "binding_constant_type", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified", "results": [{"value": "Kd", "label": "Kd", "count": 12, "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified&binding_constant_type=Kd", "selected": false}], "truncated": false}, "verification_level": {"name": "verification_level", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified", "results": [{"value": "extraction_verified", "label": "extraction_verified", "count": 12, "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=glycan%2Fconjugate", "selected": true}], "truncated": false}, "sequence_status": {"name": "sequence_status", "type": "column", "hideable": false, "toggle_url": "/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified", "results": [{"value": "pending_manual_figure", "label": "pending_manual_figure", "count": 5, "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified&sequence_status=pending_manual_figure", "selected": false}, {"value": "verified_in_text_or_SI", "label": "verified_in_text_or_SI", "count": 5, "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified&sequence_status=verified_in_text_or_SI", "selected": false}, {"value": "no_single_sequence_pool", "label": "no_single_sequence_pool", "count": 2, "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified&sequence_status=no_single_sequence_pool", "selected": false}], "truncated": false}}, "suggested_facets": [{"name": "target_name_canonical", "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified&_facet=target_name_canonical"}, {"name": "target_uniprot", "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified&_facet=target_uniprot"}, {"name": "aptamer_name", "toggle_url": "https://apt-scout.org/scout/v_kd.json?target_type=glycan%2Fconjugate&verification_level=extraction_verified&_facet=aptamer_name"}], "next": null, "next_url": null, "private": false, "allow_execute_sql": true, "query_ms": 109.24272006377578, "source": "apt-scout automated curation pipeline (E. Dohi, NCNP) \u2014 values harvested from public databases; raw source stored per target", "source_url": "https://apt-scout.org", "license": "CC BY 4.0", "license_url": "https://creativecommons.org/licenses/by/4.0/"}