Kd — intrinsic, tightest binders

Verbatim-verified intrinsic equilibrium Kd, tightest first. NOTE: the same aptamer×target can appear in several rows at DIFFERENT temperatures/assays — see assay_temperature_k (K) and assay_method. Compare on kd_log10_molar only.

Custom SQL query returning 555 rows (hide)

SELECT target_name_canonical, target_type, aptamer_name, kd_reported, kd_log10_molar, assay_method, assay_temperature_k, source_pmid, verbatim_quote FROM v_kd WHERE measurement_class='intrinsic' AND kd_log10_molar IS NOT NULL ORDER BY kd_log10_molar ASC

Edit SQL

This data as json, CSV

target_name_canonical	target_type	aptamer_name	kd_reported	kd_log10_molar	assay_method	assay_temperature_k	source_pmid	verbatim_quote
IL-8	protein	8A-35	1.72e-12 M	-11.764	SPR	298.0	24129312	\| 8A-35 \| 5.78 x 10 4 \| 9.95 x 10 -8 \| 1.72 x 10 -12 \| 2.80 \| 3.11 x 10 1 \|
human α-Thrombin	protein	A1	2.0 pM	-11.699			31129134	Also for aptamer A1 we measured with MST KD values in the pico- and nanomolar range (2 pM and 52 nM). The lowest KD value is determined with MST (shown as bar) for aptamer A1, which is 2 pM.
nucleolin	protein	Cy5-AT11-B0	3.3e-12 M	-11.481			31301466	yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8
nucleolin	protein	Cy5-AT11	5.2e-12 M	-11.284			31301466	yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8
nucleolin	protein	Cy5-AT11	9.1e-12 M	-11.041			31301466	K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4
nucleolin	protein	Cy5-AT11-B0	9.5e-12 M	-11.022			31301466	K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4
P-selectin	protein	PF377	14.0 pM	-10.854	filter_binding	310.15	9743465	PF377 \| 14
P-selectin	protein	PF377sl	14.0 pM	-10.854	filter_binding	296.15	9743465	PF377sl \| 14
P-selectin	protein	PF377	16.0 pM	-10.796	filter_binding	310.15	9743465	PF377 \| 16
P-selectin	protein	PF377	18.0 pM	-10.745	filter_binding	277.15	9743465	PF377 \| 18
Malate Synthase	protein	MS10-Trunc	19.0 pM	-10.721			31704587	MS10-Trunc aptamer exhibited high af fi nity for MS (equilibrium dissociation constant [KD] 19 pM)
PDGF-C	protein	α-PC	20.0 pM	-10.699	SPR		42138517	SPR analysis demonstrated that the α -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM
P-selectin	protein	PF377sl	29.0 pM	-10.538	filter_binding	310.15	9743465	PF377sl \| 29
bevacizumab	protein	A14#1	44.0 pM	-10.357			35114463	affinity of A14#1 to bevacizumab markedly increased at pH 4.7 ( K D = 44 pM)
P-selectin	protein	PF377sl	46.0 pM	-10.337	filter_binding	310.15	9743465	PF377sl \| 46
P-selectin	protein	PF373sl	56.0 pM	-10.252	filter_binding	310.15	9743465	PF373sl \| 56
sLe X -BSA	glycan/conjugate	Clone 5	5.7e-11 M	-10.244	SPR	298.15	11178986	sLe X -BSA \| 6.4 3 10 7 \| 3.7 3 10 2 3 \| 1.7 3 10 10 \| 5.7 3 10 2 11
von Willebrand factor A1-domain	protein	Rn-DsDsDs-53mh	61.3 pM	-10.213	SPR	310.15	27966933	RnDsDsDs-53mh ( K D = 61.3 pM)
Myoglobin	protein	anti-Mb aptamer	65.0 pM	-10.187			25957831	The corresponding af fi nity, K D, values calculated from the ratio between dissociation ( k d) and association ( k a ) was found to be 65 pM.
von Willebrand factor A1-domain	protein	Rn-DsDsDs-44	74.9 pM	-10.126	SPR	310.15	27966933	Rn-DsDsDs-44 ( K D = 74.9 pM) exhibited the highest a ffi nity
sLe X -BSA	glycan/conjugate	Clone 5	8.5e-11 M	-10.071	SPR	298.15	11178986	Clone 5 \| 1.3 3 10 5 \| 1.1 3 10 2 5 \| 1.1 3 10 10 \| 8.5 3 10 2 11
PDGF-BB	protein	PDGF-B aptamer	0.1 nM	-10.0	filter_binding		9916931	the binding affinity of the aptamer used in the experiments described below ( K d ≈ 0.1 nM)
ofloxacin	protein	Q2	0.11 nM	-9.959			26547431	Their K D values were calculated at K D 1⁄4 0.11 nM ( 7 0.06) for aptamer Q2
MutS	protein	2-06	1.23e-10 M	-9.91			25668425	The best fi t was obtained at K d = 123 pM and [T]0 = 213 pM
P-selectin	protein	PF398sl	178.0 pM	-9.75	filter_binding	310.15	9743465	PF398sl \| 178
von Willebrand factor A1-domain	protein	Rn-DsDs-51mh2	182.0 pM	-9.74	SPR	310.15	27966933	Rn-DsDs-51mh2 ( K D = 182 pM)
HBcAg	protein	A-9	2.0000000000000003e-10 M	-9.699	affinity_real_time_qPCR		32250595	This aptamer showed strong binding to HBcAg ( K d : 0.2 nM)
ofloxacin	protein	Q8	0.2 nM	-9.699			26547431	K D 1⁄4 0.20 nM ( 7 0.09) for aptamer Q8
OH-BDE47	protein	BDE-A-8	0.2 nM	-9.699			27566357	The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition.
thrombin	protein	29-mer thrombin-specific aptamer	298.0 pM	-9.526			32570818	The n-curve analysis provided a Kd of 298 pM ( + 111 / 81 pM)
VEGF165	protein	3R02	3e-10 M	-9.523			23237717	The K d value for 3R02 was 300 pM
20 Methyl Spirolide G	protein	SPX 7	3e-10 M	-9.523			34144421	The present study, among the aptamers selected, the aptamer with highest affinity had a dissociation constant of 0.3 nM for SPX G
chimeric-tPA	protein	Chi-tPA 1	0.32 nM	-9.495			26876003	selected aptamer having KD values of 0.320 nM
von Willebrand factor A1-domain	protein	ARC1172-41	326.0 pM	-9.487	SPR	310.15	27966933	ARC1172-41 ( K D = 326 pM)
FLRPp (O serotype)	protein	FMD_1	3.46e-10 M	-9.461	SPR		42010751	dissociation constants ( KD ) of 3.46 × 10 -10 M
HBeAg	protein	EAg3-Py	4.0000000000000007e-10 M	-9.398	affinity_real_time_qPCR		32250595	The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3
PDGF-BB	protein	PDGF-specific aptamer	5e-10 M	-9.301	microcantilever	310.15	24723743	K d , as shown in Fig. 10, decreased from approximately 12 × 10 -10 M to 5 × 10 -10 M as the temperature changed from 19 to 37 ◦ C.
BDNF	protein	NV_B12	5e-10 M	-9.301	ALISA		38149631	The equilibrium dissociation constant ( K d) for the NV_B12/BDNF interaction was obtained by fitting the equation, Y = B max × X /( K d + X )... The K d value determined to be 0.5 nM (95% CI: 0.4 -0.6 nM)
Thrombin	protein	TBA29	5e-10 M	-9.301			26643617	and TBA29 (~5 × 10 -10 M)
PlanarAu	protein	1N	5.600000000000001e-10 M	-9.252	QCM		30189130	aptamer 1N showing the highest affinity (0.56 nM)
AGEs-HSA	protein	#9s	0.57 nM	-9.244			24012635	Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively.
sLe X -BSA	glycan/conjugate	Selected pool	5.8e-10 M	-9.237	SPR		11178986	Selected pool \| 2.4 3 10 5 \| 1.4 3 10 2 3 \| 1.7 3 10 9 \| 5.8 3 10 2 10
AGEs-HSA	protein	#4s	0.63 nM	-9.201			24012635	Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively.
MutS	protein	2-06	6.5e-10 M	-9.187			25668425	The experimental points from the second step resulted in the best fi t with the theoretical dependence of R versus [L] 0 at K d = 650 pM
tetracycline	protein	TC aptamer	770.0 pM	-9.114			25517161	dissociation constant Kd of 770 pM ([Mg 2 þ ] 1⁄4 10 mM)
sLe X -BSA	glycan/conjugate	Clone 2	8e-10 M	-9.097	SPR		11178986	Clone 2 \| 9.8 3 10 5 \| 7.3 3 10 2 5 \| 1.2 3 10 9 \| 8.0 3 10 2 10
PSMA	protein	C3	8.000000000000001e-10 M	-9.097	EMSA		41126016	an exemplar shows very high affinity for PSMA ( K d ∼ 0.8 nM).
Immunoglobulin E	protein	IgE37-T10-FAM	0.8 nM	-9.097			32498825	The FA assay using T10-labeled aptamer with a dissociation constant ( K d) about 0.8 nM
Tasset - thrombin complex	protein	Bock	0.87 nM	-9.06	BSI	283.15	22032342	Bock - [Tasset complex] \| not available \| 0.87 ( 0.18 nM
alpha-thrombin	protein	RNAR9D-14T	1.0 nM	-9.0	filter_binding	310.15	22385910	Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) and α-thrombin (apparent Kd =1 nM)
P-selectin	protein	PF422sl	1000.0 pM	-9.0	filter_binding	310.15	9743465	PF422sl \| 1 X 103
neomycin	protein	Aptamer A	1e-09 M	-9.0			36453647	The binding affinity of neomycin to Aptamer A shows a strong K d of 1 nM with an enthalpy and entropy value of -100 kJ/mol & -163.1 J/mol. K
Sc3+	protein	Sc-1	1e-09 M	-9.0	fluorescence		39743479	true K d for the binding of Sc-1 to Sc 3+ to be 1.0 nM
PSMA	protein	C3 (without fluorescein)	1e-09 M	-9.0	EMSA		41126016	EMSA data show that Cy5-labeled C3 without fluorescein binds PSMA just as strongly as the parent construct, with an apparent K d of ∼ 1 nM (Figure S9).
von Willebrand factor A1-domain	protein	Pr-DsDsDs-40	1.03 nM	-8.987	SPR	310.15	27966933	Pr-DsDsDs-40 ( K D = 1.03 nM)
Heparin-binding protein	protein	Apt-13	1.04 nM	-8.983			38675537	The KD values of the three aptamers were 3.42, 1.44, and 1.04 nM, respectively
beta-conglutin	protein	11-mer	1.05e-09 M	-8.979	MST	298.15	33498970	KD values determined (Figure 6b) are very similar (11-mer: 1.05 nM
AP65	protein	AP65_A1	1.057e-09 M	-8.976	ELAA	298.15	29972299	A K D value of 1.057 nM was obtained using the sigmoidal dose-response curve model
PDGF-BB	protein	PDGF-specific aptamer	1.2e-09 M	-8.921	microcantilever	292.15	24723743	K d , as shown in Fig. 10, decreased from approximately 12 × 10 -10 M to 5 × 10 -10 M as the temperature changed from 19 to 37 ◦ C.
HBeAg	protein	A-9S	1.2e-09 M	-8.921	affinity_real_time_qPCR		32250595	The measured dissociation constant ( K d) is improved by 19 times  from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.
PvTRAg	protein	Apt_16	1.2e-09 M	-8.921			40042916	The K D of Apt_14 and Apt_16 was found to be comparable, 1.9 and 1.2 nM, respectively
ATP	protein	Huizenga-Szostak ATP aptamer	1.3e-09 M	-8.886	fluorescence		25170558	binding a ffi nity can be tuned over 4 orders of magnitude (1.3 nM -203 μ M)
prothrombin	protein	RNAR9D-14T	1.4 nM	-8.854	SPR	298.15	22385910	Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM
PD-L1	protein	8-60	1.4 nM	-8.854			34711320	8 e 60, a representative aptamer with high af fi nity (KD 1⁄4 1.4 nM determined by SPR)
Heparin-binding protein	protein	Apt-02	1.44 nM	-8.842			38675537	The KD values of the three aptamers were 3.42, 1.44, and 1.04 nM, respectively
thrombin	protein	T.7	1.5 nM	-8.824	SPR		37798416	T.7 exhibited the strongest binding signal with a 1.5 nM K d
OH-BDE47	protein	BDE-A-12	1.53 nM	-8.815			27566357	The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition.
IgE	protein	S2	1.5500000000000002e-09 M	-8.81	NECEEM		36144553	Based on the results of these experiments, the K D values of S1 and S2 were estimated to be 0.83 and 1.55 nM, respectively
human α-thrombin	protein	LOOPER modified thrombin aptamer	1.6000000000000003e-09 M	-8.796	SPR		28938065	Using single-cycle kinetics surface plasmon resonance (SPR), the LOOPER aptamer exhibited a Kd of 1.6 nM
hOX40	protein	9C7	1.7 nM	-8.77	filter_binding	310.15	23113766	9C7 \| 11 \| 1.7
HBeAg	protein	EAg3	1.7000000000000001e-09 M	-8.77	affinity_real_time_qPCR		32250595	The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3, as compared to the K d value of 1.7 nM with the unmodi fi ed EAg3 aptamer.
beta-conglutin	protein	TT-11-mer	1.88e-09 M	-8.726	MST	298.15	33498970	KD values determined (Figure 6b) are very similar (... TT-11 mer: 1.88 nM
Bock - thrombin complex	protein	Tasset	1.9 nM	-8.721	BSI	283.15	22032342	Tasset - [Bock complex] \| not available \| 1.9 ( 0.2 nM
VWF A1-domain	protein	ARC1779	2.0 nM	-8.699	filter_binding	298.15	19422452	This resulted in a final aptamer (ARC1779) that is a 40-nucleotide modified DNA/RNA oligonucleotide with a K D of 2 nM for the A1-domain.
von Willebrand factor	protein	42-nt DNA aptamer	2.0 nM	-8.699	ELISA		31493779	a biotinylated DNA aptamer was able to bind an antibody-captured VWF in a concentration-dependent manner with a dissociation constant ( KD ) of 2.0 nM 0.3.
CD44-HABD	protein	Motif 4 (ADDA adduct)	2e-09 M	-8.699			23057694	motifs 2 and 4(ADDA adduct) have ~2 nM affinity to CD44-HABD
THY1	protein	XA-B217	2.0 nM	-8.699			33242496	The equilibrium dissociation constants, Kd, were derived from these curves and are determined as ... XA-B217=2 nM
Progesterone	protein	PG13T2	2.1 nM	-8.678			28237255	The dissociation constant of the PG13T2-P4 complex calculated using non-linear regression fi tting of the obtained curve was found to be 2.1 nM.
IL-23	protein	A23P15	2.139 nM	-8.67			38810331	the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively
sLe X -BSA	glycan/conjugate	Clone 15	2.3e-09 M	-8.638	SPR		11178986	Clone 15 \| 3.5 3 10 5 \| 8.1 3 10 2 4 \| 4.3 3 10 8 \| 2.3 3 10 2 9
alpha-fetoprotein	protein	AFP-specific ssDNA aptamer	2.37 nM	-8.625			22410487	The K d of the AFP-specific ssDNA was calculated to be 2.37 nM
thrombin	protein	HD22	2.4e-09 M	-8.62	SPR		18826387	HD22 \| Thrombin \| K D ( M) \| 2.4 · 10 ) 9
melatonin	protein	MLT-A-2	2.4 nM	-8.62			36925277	K d = 2.4 ± 2.8 nM for MLT-A-2
melatonin	protein	MLT-A-2F	2.4 nM	-8.62			36925277	MLT-A-2F K d = 2.4 ± 2.8 nM
beta-conglutin	protein	11-mer-TT	2.59e-09 M	-8.587	MST	298.15	33498970	KD values determined (Figure 6b) are very similar (... and 11-mer-TT: 2.59 nM)
Prostate Specific Antigen	protein	Apta	2.6 nM	-8.585			25569871	The change in current is used to determine the PSA -aptamer dissociation constant KD , of ca. 2.6 nM.
Human Cardiac Troponin I	protein	TnIApt 23	2.69 nM	-8.57			26003883	Finally TnIApt 23 showed beast affinity in nanomolar range (2.69 nM) toward the target protein.
beta-conglutin	protein	TT-11-mer-TT	2.71e-09 M	-8.567	MST	298.15	33498970	KD values determined (Figure 6b) are very similar (... TT-11-mer-TT: 2.71 nM
Neuron specific enolase	protein	P-5C8G	2.76 nM	-8.559			38091739	The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively.
thrombin	protein	TBA	2.86e-09 M	-8.544	SPR		16053288	thrombin \| 2.2 10 5 \| 6.3 10 - 4 \| 3.4 10 8 \| 2.86 10 - 9
IL-23	protein	A23P6	2.88 nM	-8.541			38810331	the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively
hCD4	protein	U26	2.93 nM	-8.533	qPCR	298.15	32567629	U26 exhibited the highest binding affinity ( K d = 2.93 ± 1.03 nM) to hCD4-conjugated beads.
S-adenosylmethionine	protein	Bs SAM-I riboswitch	3.0000000000000004e-09 M	-8.523			23343213	Both μ MSA values agree well with results from the in-line probing assays performed using identical buffer conditions: ... 3 nM K d , respectively
S-adenosylmethionine	protein	Pi SAM-I riboswitch	3.0000000000000004e-09 M	-8.523			23343213	which is on the order of the 3 nM value measured using a conventional inline probing assay
dT70	protein	DCC-SSB	3.0000000000000004e-09 M	-8.523			34085169	At a low concentration ( ∼ 2.5 nM), the titration with dT70 gave an approximate assessment of affinity ( K d ∼ 3 nM).
SARS-CoV-2 RBD	protein	CoV2-RBD-1	3.1000000000000005e-09 M	-8.509	flow_cytometry		32551560	the dissociation constant values ( K d) of the CoV2-RBD-1 aptamer ... were 3.1 nM
sLe X	glycan/conjugate	Clone 5	3.3e-09 M	-8.481	SPR		11178986	sLe X \| 1.7 3 10 5 \| 5.5 3 10 2 4 \| 3.0 3 10 8 \| 3.3 3 10 2 9
human α-Thrombin	protein	B1	3.4 nM	-8.469			31129134	for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)
Immunoglobulin E	protein	Unlabeled anti-IgE aptamer	3.5 nM	-8.456			32498825	close to the K d of the unlabeled aptamer (3.5 nM)
gonyautoxin 1/4	protein	tGO18-T-d	3.6 nM	-8.444			33294137	Corresponding Kd values of GO18-T-d and tGO18-T-d, determined by the average of 8 independent measurements, were 75.63 nM and 3.60 nM, respectively.
Surface Antigen 1	protein	SOK14	3.736 nM	-8.428			40288708	SOK14 (3.736 nM, R 2 = 0.7367)
human α-thrombin	protein	Tasset	3.84 nM	-8.416	BSI	283.15	22032342	Tasset - thrombin \| 0.5 - 1.0 nM 14 \| 3.84 ( 0.68 nM
sLe X -BSA	glycan/conjugate	Clone 18	3.9e-09 M	-8.409	SPR		11178986	Clone 18 \| 5.1 3 10 5 \| 2.0 3 10 2 3 \| 2.5 3 10 8 \| 3.9 3 10 2 9
Carcinoembryonic antigen	protein	GAC-P	3.93 nM	-8.406			35517255	The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively.
human α-thrombin	protein	LOOPER modified thrombin aptamer	4e-09 M	-8.398			28938065	Preliminary binding analysis by label-free microscale thermophoresis showed a promising dissociation constant K d = 4 nM for thrombin
Surface Antigen 1	protein	SOK18	4.034 nM	-8.394			40288708	SOK18 (4.034 nM, R 2 = 0.8422)
Surface Antigen 1	protein	SOK3	4.185 nM	-8.378			40288708	SOK3 (4.185 nM, R 2 = 0.8153)
melamine	protein	Apt M	4.4000000000000005e-09 M	-8.357			37343019	dissociation constant K d = 4.4 nM
RAGE	protein	RAGE-aptamer (clone #2)	4.44 nM	-8.353	QCM		28385802	#2RAGE-aptamer \| tcTgTTcAggTTggTAcggTggAAggTgTgATTcAcgAgg \| 4.44±0.56
Thyroglobulin	protein	Seq.T-2	4.51 nM	-8.346			33303143	kon = 3.2 × 10 5 M 1 s 1 , koff = 1.44 × 10 3 s 1 , Kd = 4.51 nM
Carcinoembryonic antigen	protein	P-ATG	4.62 nM	-8.335			35517255	The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively.
Hemagglutinin (HA) protein of AIV H5N1 (A/Vietnam/1203/04)	protein	Aptamer sequence (2)	4.65 nM	-8.333			23523887	the KD (dissociation constants) was 4.65 nM, indicating strong binding between the HA protein and the selected aptamer.
VEGF165	protein	VEap121	4.700000000000001e-09 M	-8.328	SPR	293.15	23237717	As the calculated K d value of VEap121 was 4.7 nM
Oxytetracycline	protein	OTC3	4.7 nM	-8.328			24011458	The lowest K d value (4.7 nM) was obtained with the aptamer OTC3.
HFIXa	protein	Seq 11	4.93 nM	-8.307	ITC	298.15	38776649	Seq 11- \| 7.4 \| 0.983 \| 203 ± \| 4.93 \| 130.6 \| 279 \| 47.42
Myoglobin	protein	Myo40-7-27	4.93e-09 M	-8.307			24914856	The aptamer with the highest a ffi nity ( K d = 4.93 nM) was then used for the fabrication of a label-free supersandwich electrochemical biosensor for Myo detection
human α-Thrombin	protein	B2	5.0 nM	-8.301			31129134	for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)
CD8a	protein	A8	5.59 nM	-8.253	BLI	298.15	31209354	the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively
sST2	protein	sS9_P	5.6 nM	-8.252			37992929	in case of sS9, parent aptamer has outperformed its truncated counterpart in terms of affinity as it has shown higher affinity (Kd ~5.6 nM).
RAGE	protein	RAGE-aptamer (clone #1)	5.68 nM	-8.246	QCM		28385802	#1RAGE-aptamer \| ccTgATATggTgTcAccgccgccTTAgTATTggTgTcTAc \| 5.68±1.10
HIV-1 Rev	protein	RBA-14	5.9 nM	-8.229			30017564	RBA-14 (Figure S2A) binds to Rev with high affinity (K d = 5.9 nM) (Table S1 and Figure 2A).
human α-thrombin	protein	Bock	5.96 nM	-8.225	BSI	283.15	22032342	Bock - thrombin \| 1.4 - 6.2 nM 19 \| 5.96 ( 0.57 nM
biliverdin	protein	Bvd4	6.000000000000001e-09 M	-8.222			40669049	For the biliverdin selection, the tightest affinity aptamer has a dissociation costant ( K d ) value of 6 nM determined using isothermal titration calorimetry (ITC)
human α-Thrombin	protein	A2	6.3 nM	-8.201			31129134	for SCORE (b-nd analysis) the best are A2 (6.3 nM)
Lipopolysaccharide from Klebsiella pneumoniae ATCC 15380	protein	aptamer seq. 5	6.68e-09 M	-8.175	DPV		41323700	The binding affinity of aptamer seq. 5 was 6.68 nM (Fig. 9C).
human β-defensin 2	protein	A ad1	6.8 nM	-8.167			32067984	As a result, A ad1 was found to bind strongly, with a K d of 6.8 nM (Fig. 2).
transferrin receptor 1	protein	JBA8.26	6.87 nM	-8.163	BLI		35875870	Using BLI, JBA8.26 was found to bind immobilized TfR1 with a K D of 6.87 ± 0.04 nM
human α-Thrombin	protein	A3	6.9 nM	-8.161			31129134	for SCORE (b-nd analysis) the best are A2 (6.3 nM) and A3 (6.9 nM)
Carcinoembryonic antigen	protein	P	6.95 nM	-8.158			35517255	The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively.
thrombin	protein	HD1	7.1e-09 M	-8.149	SPR		18826387	HD1 \| Thrombin \| K D ( M) \| 7.1 · 10 ) 9
PTK7	protein	4AsF	7.2 nM	-8.143	SPR	310.15	41065179	4AsF, which exhibited a 10-fold reduction compared to 4APS (0.77 vs 7.20 nM)
VEGF165	protein	cot-pega	7.33 nM	-8.135			26956592	The K D of cot-pega for VEGF was 7.33 nM (Fig. 1b)
Carcinoembryonic antigen	protein	P-GTG	7.33 nM	-8.135			35517255	The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively.
sLe X -BSA	glycan/conjugate	Clone 4	7.4e-09 M	-8.131	SPR		11178986	Clone 4 \| 4.1 3 10 5 \| 3.1 3 10 2 3 \| 1.3 3 10 8 \| 7.4 3 10 2 9
human α-Thrombin	protein	B3	7.6 nM	-8.119			31129134	for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)
Surface Antigen 1	protein	SOK16	7.6 nM	-8.119			40288708	SOK16 (7.6 nM, R 2 = 0.8704)
murine OX40	protein	9.8	8.0 nM	-8.097	filter_binding		18635004	Aptamer 9.8 was chosen for further study, since it had the highest affinity for the OX40 fusion protein.
Cu2+	protein	Co-1	8e-09 M	-8.097			40656531	The corresponding true K d values were ... 8 nM for Cu 2+
human α-Thrombin	protein	A3	8.0 nM	-8.097			31129134	For BLI it was found that aptamer A3 (8 nM and 25.5 nM) is the best binder
EsxG	protein	G43	8.04 nM	-8.095			24813997	The dissociation constants of the G43 and G78 aptamers were 8.04 ± 1.90 and 78.85 ± 9.40 nM, respectively.
NP	protein	NP-C04	8.1e-09 M	-8.092	fluorescence		30740973	the K d values of NP-D01, NP-C04, and NP-D02 were 76..1 ± 10.9, 8.1 ± 2.4, and 41.3 ± 9.5 nM, respectively.
digoxin	protein	D1	8.2e-09 M	-8.086			23021809	Binding studies of fluorescein-labeled truncated (without primer binding region) D1 and D2 and full length D1 anti-digoxin aptamers were performed and their corresponding dissociation constants values were 8.2 × 10 -9 , 44.0 × 10 -9 and 17.8 × 10 -9 M, respectively.
EN2	protein	EBA	8.26 nM	-8.083			35798816	EBA had K d = 8.26 nM (R 2 = 0.971)
human thrombin	protein	Azo-1	8.3 nM	-8.081			33039563	The K d values of Azo-1 binding to human thrombin were calculated to be around 3.1 and 8.3 nM before and after irradiation, respectively. However, the reproducibility of K d value measurements is poor (n = 3; S.D. = 2.2 and 5.1 nM, respectively).
human β-defensin 2	protein	A ad1-3	8.4 nM	-8.076			32067984	In contrast, a clone with a 5 ʹ terminal truncation (A ad1 -3 , 69mer, Fig. 4a) could bind to HBD-2 with roughly the same strength as the original sequence ( K d = 8.4 nM, Fig. 4c).
Okadaic Acid	protein	OA-LC2-TF	8.735 nM	-8.059	BLI		36322695	The terminal-fixed OA-LC2 (OA-LC2-TF) exhibited a K d of 8.735 ± 0.606 nM
MPT64	protein	aptamer sequence (17)	8.92 nM	-8.05			28454652	KD (dissociation equilibrium constant) was 8.92 nM
TAR RNA	protein	TAR RNA aptamer (best binding)	9.000000000000001e-09 M	-8.046			39167715	A Biolayer Interferometry (BLI) experiment revealed that TAR RNA aptamers with the best binding affinity exhibited the dissociation constant ( K D) at 9 nM
HBeAg	protein	EAg2	9.2e-09 M	-8.036	affinity_real_time_qPCR		32250595	A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1, 9.2 nM for EAg2
human α-Thrombin	protein	B1	9.2 nM	-8.036			31129134	For SCORE (Anabel analysis) the best is B1 (9.2 nM)
HBeAg	protein	EAg1	9.5e-09 M	-8.022	affinity_real_time_qPCR		32250595	A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1
SP6 RNA polymerase	protein	S05	9.5 nM	-8.022			22426482	The dissociation constant and 50% inhibitory concentration of the aptamer were estimated 9.5 nM and 24.8 nM, respectively.
PDGFR β	protein	Gint4.T	9.6 nM	-8.018	filter_binding		24566984	This aptamer is able to specifically bind to the human PDGFR β ectodomain (Kd: 9.6 nM)
thrombin	protein	3G	9.8 nM	-8.009	MST		33614235	3G \| 52.9 \| 9.8 ± 0.6 \| 3.34
sLe X -BSA	glycan/conjugate	Clone 9	1e-08 M	-8.0	SPR		11178986	Clone 9 \| 3.5 3 10 5 \| 3.1 3 10 2 3 \| 9.5 3 10 7 \| 1.0 3 10 2 8
prothrombin	protein	RNAR9D-14T	10.0 nM	-8.0	filter_binding	310.15	22385910	Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM)
hOX40	protein	11F11	10.0 nM	-8.0	filter_binding	310.15	23113766	11F11 \| 8 \| 10
streptavidin	protein	S8	1e-08 M	-8.0			30520292	At pH 7.4, we determined that S8 has a K d of 10 nM
bevacizumab	protein	A14#1	10.0 nM	-8.0			35114463	One of the three mutants, A14#1_GC2, showed higher affinity than A14#1 ( K D = 10 nM, Supplementary Fig. S3a).
Neuron specific enolase	protein	P-4A29C	10.13 nM	-7.994			38091739	The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively.
trastuzumab	protein	CH1S-3	1.0300000000000001e-08 M	-7.987	MST	298.15	32516525	a ffi nity with a K d value of aptamer CH1S-3 of 10.3 nM
Sc3+	protein	Sc-1	1.0300000000000001e-08 M	-7.987	fluorescence		39743479	an apparent K d value of 10.3 nM was obtained
thrombin	protein	3Leu	10.9 nM	-7.963	MST		33614235	3Leu \| 54.3 \| 10.9 ± 0.2 \| 4.15
17 β -Estradiol	protein	22-mer aptamer	1.1000000000000001e-08 M	-7.959			25803717	new 35-mer and 22-mer aptamers were generated with K D ' s of 14 and 11 nM
PLN 1-32	protein	RNA-Apt30	11.0 nM	-7.959			25240642	Such binding was dependent on the concentration of aptamer, with a dissociation constant ( K d) of 11 nM (Fig. 2A).
25-HydroxyvitaminD3	protein	VDBA14	11.0 nM	-7.959			27520502	the dissociation constants (Kd) of the VDBA14 was estimated to be 11 nM based on a non-linear regression method.
β-conglutin	protein	unmodified β-CBA II aptamer	11.1 nM	-7.955			36354481	with a similar KD of 11.1 nM and 18.5 nM obtained for the unmodified and modified aptamer, respectively.
thrombin-HRP	protein	TBA	1.13e-08 M	-7.947	SPR		16053288	thrombin-HRP \| 6.7 10 4 \| 7.6 10 - 4 \| 8.7 10 7 \| 1.13 10 - 8
Immunoglobulin E	protein	IgE37-T10-FAM (4-bp truncated)	11.4 nM	-7.943			32498825	When 4-base pairs and 5-base pairs were truncated from the stem, the K ds of the aptamers increased to 11.4 nM and 90.5 nM, respectively.
thrombin	protein	3L	11.6 nM	-7.936	MST		33614235	3L \| 51.5 \| 11.6 ± 0.5 \| 5.28
CTLA-4	protein	aptCTLA-4	11.84 nM	-7.927			28918052	dissociation constant (Kd) being 11.84 nM
LPS	protein	NH2-5'-CTT CTG CCC GCC TCC TTC CTAG CCG GAT CGC GCT GGC CAG ATG ATA TAA AGG GTC AGC CCC CCA -GGA GAC GAG ATA GGC GGA CAC T-3'	11.9 nM	-7.924			22182428	Amine-terminated aptamer exhibiting high affinity ( K d = 11.9 nM) to LPS
streptavidin	protein	SA23	12.0 nM	-7.921			23312325	The respective Kd values for streptavidin binding in the monofunctional aptamer ... were 12 nM
coat protein of grouper nervous necrosis virus	protein	A5	12.0 nM	-7.921			26892075	calculated binding affinities ( Kd ) of 12 nM for A5
bevacizumab	protein	A14#1	12.0 nM	-7.921			35114463	A14#1 showed binding capacity with K D = 12 nM.
thrombin	protein	Uyne A - AUyne	12.16 nM	-7.915	BLI		37531184	U yne A - AUyne \| 12.16 ± 0.02
RAGE	protein	RAGE-aptamer (clone #3)	12.44 nM	-7.905	QCM		28385802	#3RAGE-aptamer \| tTccAcTgAgTgccgcggAcTgTTgTTgggAggTggTgTg \| 12.44±1.52
HIV-1 Rev	protein	Stem IIB	12.9 nM	-7.889			30017564	The 35-nt hairpin with the Stem IIB sequence (Figure S2B) binds to Rev with a similar affinity (K d = 12.9 nM) (Table S1 and Figure 2B).
sST2	protein	sS9_P	13.0 nM	-7.886			37992929	The best performing aptamer candidate sS9_P (80mer) has shown affinity in low nanomolar range (~5.6 nM in ALISA and ~13 nM in ITC)
PlanarAu	protein	1N truncated	1.304e-08 M	-7.885	QCM		30189130	1N truncated (Kd = 13.04 nM)
Bisphenol A	protein	38-mer BPA aptamer	13.17 nM	-7.88			32113141	The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM
Staphylococcal enterotoxin A	protein	Apt5	13.36 nM	-7.874			38762575	The aptamer with the highest affinity showed an experimental dissociation constant (K D) of 13.36 ± 18.62 nM.
CD25	protein	Apt51	13.4 nM	-7.873			29055191	Using non-linear regression analysis, the Kd of Apt51 and Apt70 aptamers were found to be 13.4 nM and 138.6 nM, respectively
Staphylococcal enterotoxin D	protein	Aptamer 1	13.43 nM	-7.872			39894103	The KD of the aptamer for SED was determined using SPR and ELASA. The KD values were calculated as 4.4 ± 2.26 nM and 13.43 nM, respectively.
SARS-CoV-2 RBD	protein	CoV2-RBD-4	1.3600000000000001e-08 M	-7.866	flow_cytometry		32551560	the dissociation constant values ( K d) of the ... CoV2-RBD-4 aptamer ... were ... 13.6 nM
thrombin	protein	Uyne A - Uyne Uyne	13.96 nM	-7.855	BLI		37531184	U yne A - U yne U yne \| 13.96 ± 0.03
Le A	protein	Clone 5	1.4e-08 M	-7.854	SPR		11178986	Le A \| 7.3 3 10 2 \| 1.0 3 10 2 5 \| 7.2 3 10 7 \| 1.4 3 10 2 8
IL4Rα	protein	cl.42	14.0 nM	-7.854	FACS		22282665	The calculated K d (14 nM, Fig. 2D) was within the range of anti -IL4R a antibodies
17 β -Estradiol	protein	35-mer aptamer	1.4000000000000001e-08 M	-7.854			25803717	new 35-mer and 22-mer aptamers were generated with K D ' s of 14 and 11 nM
Oxytetracycline	protein	OTC16	14.0 nM	-7.854			24011458	The other 3 aptamers, that is, OTC6, OTC9, and OTC16, showed higher K d values, that is, 9.5, 8.0, and 14.0 nM, respectively
enrofloxacin	protein	Apt58	14.19 nM	-7.848			29574118	The obtained Kd of Apt58 and Apt6, with non-linear regression analysis, were 14.19 nM and 50.77 nM, respectively.
thrombin	protein	3Ser	14.6 nM	-7.836	MST		33614235	3Ser \| 51.7 \| 14.6 ± 0.3 \| 2.51
CD8a	protein	A3	14.7 nM	-7.833	BLI	298.15	31209354	the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively
Neuron specific enolase	protein	P-4G10T	14.82 nM	-7.829			38091739	The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively.
thrombin	protein	TBA15-AnBtz	1.5000000000000002e-08 M	-7.824			37857354	apparent dissociation constant ( K d ) of 15 nM
XBP1	protein	R6 pool	15.0 nM	-7.824			26874109	dissociation equilibrium constant equal to 15 nM
hexahistidine peptide	protein	AptHis-1	15.0 nM	-7.824			32739349	the Kd was as low as 15 nM (Table S1)
hexahistidine peptide	protein	AptHis-2	15.0 nM	-7.824			32739349	the Kd was as low as 15 nM (Table S1)
hexahistidine peptide	protein	AptHis-3	15.0 nM	-7.824			32739349	the Kd was as low as 15 nM (Table S1)
THY1	protein	XA-A9	15.0 nM	-7.824			33242496	The equilibrium dissociation constants, Kd, were derived from these curves and are determined as XA-A9=15 nM
Dinophysistoxin	protein	DTX-SL1-TF	15.45 nM	-7.811	BLI		36322695	DTX-SL1-TF showed a K d of 15.45 ± 1.92 nM
human α-Thrombin	protein	B1	15.7 nM	-7.804			31129134	for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)
N-acetyl-5-hydroxytryptamine	protein	MLT-A-4F	0.016 μM	-7.796			36925277	for NAT very low K d value was observed i.e., 0.016 μM
sLe A	glycan/conjugate	Clone 5	1.7e-08 M	-7.77	SPR		11178986	sLe A \| 1.2 3 10 3 \| 1.9 3 10 2 5 \| 5.9 3 10 7 \| 1.7 3 10 2 8
Progesterone	protein	P4G13	1.7e-08 M	-7.77			25486123	The dissociation constant of the best aptamer, designated as P4G13, was estimated to be 17 nM by electrochemical impedance spectroscopy (EIS) as well as fl uorometric assay.
human α-Thrombin	protein	A2	17.0 nM	-7.77			31129134	for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)
hnRNP A1	protein	AS1411	1.75e-08 M	-7.757	BLI		38784467	for AS1411, the K d value was 17.5 nM (Fig. 6B)
human α-Thrombin	protein	B3	17.6 nM	-7.754			31129134	for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)
GTX1/4	protein	GO18-T-d	17.7 nM	-7.752			26802576	we truncated GTX1/4 aptamer and obtained the aptamer core sequence with a higher K d of 17.7 nM.
digoxin	protein	D1	1.78e-08 M	-7.75			23021809	Truncated (without primer binding region) D1, truncated D2 and full length D1 were bound to digoxin-BSA with Kd value of 8.2 × 10 -9 , 44 × 10 -9 and 17.8 × 10 -9 M, respectively
β-conglutin	protein	biotinylated dUTPs aptamer	18.5 nM	-7.733			36354481	with a similar KD of 11.1 nM and 18.5 nM obtained for the unmodified and modified aptamer, respectively.
LDL-R	protein	RNV-L7	19.6 nM	-7.708			31841991	RNV-L7 aptamer showed speci fi c binding to its LDL-R target with a binding af fi nity value of 19.6 nM.
hMMP-9	protein	F3Bomf	2e-08 M	-7.699	SPR	296.15	23043415	The K d was taken as the concentration leading to half saturation, i.e., about 20 nM.
hMMP-9	protein	F3	2e-08 M	-7.699			23043415	exhibits a strong a ffi nity for hMMP-9 ( K d = 20 nM)
xanthylacrylamide	protein	XAA-1	2e-08 M	-7.699			40261307	The true K d of aptamer XAA-1 was calculated to be 20 nM after accounting for the competitive effect of the quencher-labeled strand
CD8a	protein	A1	20.1 nM	-7.697	BLI	298.15	31209354	the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively
thrombin	protein	TBA	20.2 nM	-7.695	MST		33614235	TBA \| 50.7 \| 20.2 ± 1.3 \| 4.81
thrombin	protein	12G	20.7 nM	-7.684	MST		33614235	12G \| 53.4 \| 20.7 ± 2.8 \| 2.88
hexahistidine peptide	protein	AptHis-C	20.8 nM	-7.682			32739349	its dissociation constant was as low as 20.8 nM
hnRNP A1	protein	TBA	2.1100000000000004e-08 M	-7.676	BLI		38784467	for TBA, the K d value was 21.1 nM (Fig. 6A)
saxitoxin	protein	45e	21.2 nM	-7.674			35324725	aptamer 45e with a K d value of 21.2 nM
thrombin	protein	3Ala	21.4 nM	-7.67	MST		33614235	3Ala \| 50.9 \| 21.4 ± 2.8 \| 3.67
Dinophysistoxin	protein	DTX-SL1	21.75 nM	-7.663	BLI		36322695	DTX-SL1 showed the lowest K d at 21.75 ± 1.42 nM
CD117	protein	Apta02	21.8 nM	-7.662	BLI	298.15	40487293	Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 µ m, respectively ( Figure 2 a,b).
SARS-CoV-2 spike trimer	protein	S14	21.8 nM	-7.662			34188971	The aptamer S14 evinced 3-fold higher affinity (KD = 21.8 nM) then S1 (KD = 68.9 nM).
GTX1/4	protein	GO18-T-d	21.9 nM	-7.66			26802576	Therefore, we further removed inactive nucleotides from GO18-T-a and obtained the core aptamer sequence GO18-T-d with a K d of 21.9 nM
Mouse thrombin	protein	TBA29	22.0 nM	-7.658	SPR		37621412	TBA29 \| 2.76 10^5 \| 6.07 10^-3 \| 22.0
thrombin	protein	3Phe	22.6 nM	-7.646	MST		33614235	3Phe \| 54.3 \| 22.6 ± 4.8 \| 3.39
HBeAg	protein	A-9	2.29e-08 M	-7.64	affinity_real_time_qPCR		32250595	The measured dissociation constant ( K d) is improved by 19 times  from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.
prometryn	protein	P60-1	23.0 nM	-7.638			37453395	The Kd value of P60-1 aptamer for prometryn was approximately 23 nM
beta-conglutin	protein	11-mer	2.3300000000000003e-08 M	-7.633	BLI	303.15	33498970	A 2:1 heterogenous model was used to fit the data and calculate the binding affinities resulting in two different KD values of 6.95 and 23.30 nM.
Neuron specific enolase	protein	P	23.83 nM	-7.623			38091739	Each of them exhibited higher affinity to NSE than the parent aptamer ( K d = 23.83 nM).
Le X	protein	Clone 5	2.4e-08 M	-7.62	SPR		11178986	Le X \| 6.7 3 10 2 \| 1.6 3 10 2 5 \| 4.1 3 10 7 \| 2.4 3 10 2 8
Cry j 2	protein	CJ2-06	24.0 nM	-7.62			25083924	Scatchard analysis based on ELONA showed that BioCJ206 exhibited a high af fi nity for Cry j 2 with a dissociation constant of 24 nM
NMP22	protein	NT2a	2.4260000000000003e-08 M	-7.615	MST		42173503	The K d values were also determined using MicroScale Thermophoresis (MST), and the K d values of NT2a and NT4a were determined to be 24.26 ± 10.47 and 77.29 ± 25.78 nM (Figures 2d and S3).
murine OX40	protein	11.2	25.0 nM	-7.602	filter_binding		18635004	11.2 \| AUACCAGGAUCACAUCCUGAGGAACCCCGGCUCCCAACCU \| 25 \| 4
murine OX40	protein	11.4	25.0 nM	-7.602	filter_binding		18635004	11.4 \| CUUUAAUCCUCGCACUCAGCGCGCAUCACCCUUGACAUCA \| 25 \| 5
murine OX40	protein	9.3	25.0 nM	-7.602	filter_binding		18635004	9.3 \| CAAACCAGCUAUUUCCUGAGGUACCCCGGCUCUCCAUGG \| 25 \| 4
S-adenosylmethionine	protein	Bs SAM-I riboswitch	2.5000000000000002e-08 M	-7.602			23343213	Both μ MSA values agree well with results from the in-line probing assays performed using identical buffer conditions: 25 nM K d
16mer peptide from collagen XI alpha 1 chain	protein	D1	25.0 nM	-7.602			34815029	The K d values were identical (about 25 nM)
16mer peptide from collagen XI alpha 1 chain	protein	C1	25.0 nM	-7.602			34815029	The K d values were identical (about 25 nM)
transferrin receptor 1	protein	tJBA8.1	25.11 nM	-7.6	BLI		35875870	tJBA8.1 bound the TfR1 protein with a K D value of 25.11 ± 0.19 nM
Sterigmatocystin	protein	H Seq02	2.53e-08 M	-7.597	ITC		38175632	The final fitting curve showed a reduced chi-squared (kcal/mol) 2 of 0.871, and the K D value was 25.3 nM.
human α-Thrombin	protein	A3	25.5 nM	-7.593			31129134	For BLI it was found that aptamer A3 (8 nM and 25.5 nM) is the best binder
Staphylococcal enterotoxin B	protein	A2	26.0 nM	-7.585			25624325	A2 and A11 both bound with high affinity to SEB, with dissociation constants of 26 nM and 64 nM, respectively
adenosine monophosphate	protein	AMP aptamer	26.0 nM	-7.585			35934372	BHQ-2-(NH2)2 binds DNA aptamer for AMP with KD = 26 nM.
human α-Thrombin	protein	A2	26.4 nM	-7.578			31129134	for iRIf aptamer A2 is the best (26.4 nM)
Bisphenol A	protein	12-mer BPA aptamer	27.05 nM	-7.568			32113141	The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM
thrombin	protein	3Nic	27.1 nM	-7.567	MST		33614235	3Nic \| 52.1 \| 27.1 ± 4.2 \| 3.69
thrombin	protein	12L	27.2 nM	-7.565	MST		33614235	12L \| 51.0 \| 27.2 ± 3.0 \| 4.17
thrombin	protein	HD22 (TA-TT)	27.8 nM	-7.556	BLI		37531184	TA - TT \| 27.80 ± 0.09
FGFR3 K650E	protein	SU-3	2.82e-08 M	-7.55	SPR		31265241	The predicted K D was 28.2 × 10 -9 ± 19.6 × 10 -9 M( n = 5) in 1 × PBS bu ff er, using 1:1 Langmuir binding model.
hOX40	protein	9C7T	29.0 nM	-7.538	filter_binding	310.15	23113766	observed Kd of * 29nM
dT35	protein	DCC-SSB	2.9e-08 M	-7.538			34085169	The second stage was fitted to a hyperbola to give a K d value of 29 nM.
thrombin	protein	3Amide	29.2 nM	-7.535	MST		33614235	3Amide \| 52.6 \| 29.2 ± 0.4 \| 4.17
Thrombin	protein	aptamer 2S	2.9400000000000002e-08 M	-7.532	SPR		32268723	The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 μM and 29.4 nM, respectively
verrucarin A	protein	Ver1_JYP	2.9500000000000003e-08 M	-7.53	fluorescence		39404132	The novel ssDNA aptamer exhibited a binding affinity of 29.5 nM
thrombin	protein	3Bz	30.0 nM	-7.523	MST		33614235	3Bz \| 52.3 \| 30.0 ± 6.6 \| 4.54
L-TAR RNA	protein	D-6-4t	3.0000000000000004e-08 M	-7.523			23977945	The Kd of in vitro transcribed D-6-4t for L-TAR is 30 nM
Nucleolin (NCL)	protein	rG4-C8 (short loop)	30.0 nM	-7.523			31325486	The K D values for the binding interaction between the short loop (112) rG4 and its rG4-C8 complex with NCL were 309 ± 45 nM and 30 ± 22 nM, respectively.
thrombin	protein	12Amide	30.6 nM	-7.514	MST		33614235	12Amide \| 51.2 \| 30.6 ± 6.1 \| 3.97
Ciprofloxacin	protein	R10K6	3.1e-08 M	-7.509			30609709	a dissociation constant (KD) for the RNA-ligand complex of 31 nM was determined.
Clenbuterol	protein	CLB-2	3.1e-08 M	-7.509			42204903	The ITC of the CLB2 aptamer showed a complex pattern with a fitted K d of 31 nM (Figure S4)
tetrodotoxin	protein	A36	32.4 nM	-7.489			40435760	Aptamer A36, which exhibited high binding affinity (32.4 nM) and stability ( Δ G = 2.58 kcal/mol), was identified as the optimal TTX aptamer.
PDGF-C	protein	α-PC	33.0 nM	-7.481	SPR		42138517	SPR analysis demonstrated that the α -PC aptamer bound tightly to mouse PDGF-C with a high affinity ( KD = 33 nM
Thrombin	protein	Antithrombin aptamer	3.3000000000000004e-08 M	-7.481			31580650	Antithrombin aptamer with KD of 33 nM was successfully isolated by four rounds of MCP-SELEX.
Alpha-fetoprotein	protein	Group I aptamer	33.0 nM	-7.481			22166203	The aptamer interacted with the AFP with a K D of 33 nM.
Alpha-fetoprotein	protein	Group I aptamer	33.9 nM	-7.47			22166203	with a K D of 33.9 nM (group I RNA)
human α-Thrombin	protein	A3	34.6 nM	-7.461			31129134	For SCORE (Anabel analysis) the best is B1 (9.2 nM) and the poorest A3 (34.6 nM)
paramylon	protein	Par-15	3.49e-08 M	-7.457	fluorescence		31809034	The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 ± 2.61, 34.90 ± 5.83, 64.06 ± 6.72, 123.81 ± 13.41, and 249.52 ± 46.39 nM, respectively.
HNP 1-3	protein	6J	35.0 nM	-7.456	ELISA		38591344	Regression analysis (Figure 4a) yielded a K d value of 35 nM
Progesterone	protein	PG13	35.0 nM	-7.456			28237255	The full length PG13 aptamer which showed the highest af fi nity (Kd 1⁄4 35 nM)
Enrofloxacin	protein	ENR-Apt 6	35.08 nM	-7.455			38540931	Figure 4A shows the non-linear fitting curve of ENR-Apt 6, with a Kd value of 35.08 nM.
Zearalenone	protein	M1	35.83 nM	-7.446			38608399	resulting in a slightly higher Kd value of 35.83 nM
Ciprofloxacin	protein	R10K6_V11	3.6000000000000005e-08 M	-7.444			30609709	The determined dissociation constant of 36 nM for V11 is similar to the original full-length aptamer R10K6 (31 nM).
THY1	protein	XA-B216	36.0 nM	-7.444			33242496	The equilibrium dissociation constants, Kd, were derived from these curves and are determined as ... XA-B216=36 nM
Human thrombin	protein	TBA29	36.9 nM	-7.433	SPR		37621412	TBA29 \| 1.34 10^5 \| 4.94 10^-3 \| 36.9
Ni2+	protein	Co-1	3.7e-08 M	-7.432			40656531	The corresponding true K d values were ... 37 nM for Ni 2+
human α-Thrombin	protein	B1	37.0 nM	-7.432			31129134	and the poorest B1 (37 nM)
ceftiofur	protein	Apt-9	37.68 nM	-7.424			40203705	Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were ... 37.68 nM
rmCD3 d ε -Fc	protein	CD3_Apt5	37.9 nM	-7.421	SPR	298.15	38745854	aptamer 5 was the strongest binder (37.9 nM)
Lipopolysaccharide	protein	B2	38.0 nM	-7.42			22370280	The SPR-based K d between the immobilized B2 and the LPS was found to be approximately 38 nM.
thrombin	protein	TA-AT	38.7 nM	-7.412	BLI		37531184	TA - AT \| 38.7 ± 0.5
methionyl-tRNA synthetase	protein	70mer pool	38.8 nM	-7.411			23399565	The dissociation constants of the selected 70 and 42mer pools to M. tuberculosis MRS were 38.8 and 51.3 nM, respectively.
thrombin	protein	LOOP	39.0 nM	-7.409	QCM		16725379	LOOP \| 3.27±1.22 \| 127±100 \| 0.026±0.018 \| 39±27
BTX-2	protein	BT10	42.0 nM	-7.377			25725463	Under these optimum conditions, we have again estimated the binding af fi nity of the BT10 aptamer and a K d value of 42 nM was obtained.
tobramycin	protein	Ap 4	42.12 nM	-7.376			30268963	The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively
saxitoxin	protein	STX-G4-45	42.6 nM	-7.371			35324725	STX-G4-45 ( K d: 42.6 nM, Table S1)
cefquinome	protein	Apt-9	43.3 nM	-7.364			40203705	Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were ... 43.30 nM
cefapirin	protein	Apt-9	43.68 nM	-7.36			40203705	Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were 43.68 nM
digoxin	protein	D2	4.4e-08 M	-7.357			23021809	Truncated (without primer binding region) D1, truncated D2 and full length D1 were bound to digoxin-BSA with Kd value of 8.2 × 10 -9 , 44 × 10 -9 and 17.8 × 10 -9 M, respectively
Total Phthalate Esters (TP)	protein	Truncated 24-mer aptamer	44.1 nM	-7.356			33524734	that of the truncated 24-mer aptamer was 44.1 nM
HBeAg	protein	EAg0	4.4200000000000005e-08 M	-7.355	affinity_real_time_qPCR		32250595	A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0
Oxytetracycline	protein	OTC5	4.5000000000000006e-08 M	-7.347			35777074	the binding was slightly enhanced when NaCl was decreased (Figure 3B, K d reached 45 nM when no NaCl was present)
Zearalenone	protein	A2	47.1 nM	-7.327			38608399	The GO method showed that the Kd value for A2 was 47.1 nM
Human thrombin	protein	M08s	47.2 nM	-7.326	SPR		37621412	M08s \| 7.04 10^5 \| 3.33 10^-2 \| 47.2
sCD80	protein	CD80-16	47.69 nM	-7.322			37816286	CD80-4 and CD80-16 aptamers showed the lowest K d values of 200.5 nM and 47.69 nM, respectively
ODAM	protein	OD64	4.771e-08 M	-7.321	SPR		33455205	the obtained OD64 and OD35 (aptamer cognate pair) presented high a ffi nity and excellent speci fi city, along with dissociation constants ( K d ) of 47.71 nM (OD64)
tobramycin	protein	Ap 3	47.79 nM	-7.321			30268963	The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively
ODAM	protein	OD64	47.71 nM	-7.321			30396019	From this dose-dependency curves, the Kd values of OD64 and OD35, estimated by adopting non-linear regression analysis, were 47.71 nM and 51.36 nM, for OD64 and OD35, respectively.
Immunoglobulin E	protein	IgE37-T10-FAM (no MgCl2)	49.0 nM	-7.31			32498825	Without MgCl2 in the binding buffer, the K d of IgE37-T10-FAM increased to 49 nM
SEC1	protein	C36.2	49.43 nM	-7.306			25053102	The Kd values are 49.43 ± 11.76, 65.14 ± 11.64 and 154.9 ± 45.67 nM, respectively.
lysozyme	protein	lysozyme-binding aptamer	49.5 nM	-7.305			21616496	average ligand-site dissociation constant ( k d ) of 49.5 nM ± 8.3 nM
murine OX40	protein	11.8	50.0 nM	-7.301	filter_binding		18635004	11.8 \| AUACCAGCGAAUAACUCGCUGAGGAACCCGACUCACAAA \| 50 \| 1
HAP 1b	protein	Aptamer 21	5.0000000000000004e-08 M	-7.301			21899290	A high-affinity RNA aptamer (K d = 50 nM) was efficiently identified by SELEX against a heteroaryl dihydropyrimidine structure
Ochratoxin A	protein	OBA36	5.0000000000000004e-08 M	-7.301			35442665	OBA36 binds OTA with a dissociation constant ( K d) down to ∼ 50 nM
human prothrombin	protein	thrombin aptamer	50.0 nM	-7.301			21700444	the thrombin aptamer does bind prothrombin but with a lower KD (50 nM versus 2 nM for thrombin)
17 β -estradiol	protein	E2 aptamer	50.0 nM	-7.301			24594593	Kd was determined to be 50 nM.
HSV-1 gD	protein	DApt	50.0 nM	-7.301			29246315	Our 45-nt-long DNA aptamer showed high af fi nity for HSV-1 gD (binding af fi nity constant [Kd] = 50 nM)
enrofloxacin	protein	Apt6	50.77 nM	-7.294			29574118	The obtained Kd of Apt58 and Apt6, with non-linear regression analysis, were 14.19 nM and 50.77 nM, respectively.
thrombin	protein	12Ala	51.0 nM	-7.292	MST		33614235	12Ala \| 51.7 \| 51.0 ± 3.8 \| 2.74
kanamycin	protein	KAN8-1	5.1e-08 M	-7.292			41914599	Its top sequence, named KAN8 -1, shows a K d of 51 nM at pH 7.5 for kanamycin as measured by isothermal titration calorimetry
adenosine monophosphate	protein	AMP aptamer	51.0 nM	-7.292			35934372	KD of BHQ-2-(NH2)2-AMP aptamer complex was 51 nM
methionyl-tRNA synthetase	protein	42mer pool	51.3 nM	-7.29			23399565	The dissociation constants of the selected 70 and 42mer pools to M. tuberculosis MRS were 38.8 and 51.3 nM, respectively.
Zearalenone	protein	M2	51.31 nM	-7.29			38608399	However, the fluorescence-measured Kd value was 51.31 nM
ODAM	protein	OD35	5.1360000000000005e-08 M	-7.289	SPR		33455205	the obtained OD64 and OD35 (aptamer cognate pair) presented high a ffi nity and excellent speci fi city, along with dissociation constants ( K d ) of 47.71 nM (OD64) and 51.36 nM (OD35).
ODAM	protein	OD35	51.36 nM	-7.289			30396019	From this dose-dependency curves, the Kd values of OD64 and OD35, estimated by adopting non-linear regression analysis, were 47.71 nM and 51.36 nM, for OD64 and OD35, respectively.
human α-Thrombin	protein	A1	52.0 nM	-7.284			31129134	Also for aptamer A1 we measured with MST KD values in the pico- and nanomolar range (2 pM and 52 nM).
tobramycin	protein	Ap 1	52.37 nM	-7.281			30268963	Compared with Ap 1 (Kd =52.37nM), the a ffi nity of the aptamer maintains and slightly increases with the removing of the redundant sequence.
BHQ-2-(NH(NH)NH2)2	protein	AMP aptamer	53.0 nM	-7.276			35934372	Incubation of the aptamer with AMP decreased KD down to 53 nM
Aβ42 oligomer	protein	Aβ-Apt	5.33e-08 M	-7.273	SPR	298.15	35019631	suggesting that the binding a ffi nity of A β -Apt with A β 42 oligomer ( K d = 53.3 nM) was stronger than that of A β -Apt with A β 42 monomer.
Ochratoxin A	protein	OBA33	5.4e-08 M	-7.268			35442665	The binding a ffi nity of OBA33 is 54 nM for OTA
HSV-1 gD	protein	DApt	53.92 nM	-7.268			29246315	a nonlinear regression analysis of the determined values was plotted to give a speci fi c Kd of 53.92 nM (Figure 1C).
tobramycin	protein	Ap 2	54.58 nM	-7.263			30268963	The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively
Surface Antigen 1	protein	SOK11	56.66 nM	-7.247			40288708	SOK11 (56.66 nM, R 2 = 0.8128)
ofloxacin	protein	Q1	56.9 nM	-7.245			26547431	Aptamer Q1 was found to have an af fi nity constant of K D 1⁄4 56.9 nM ( 7 11.3)
CD63	protein	CD63 Aptamer	5.8e-08 M	-7.237	SPR		26500145	The equilibrium constant of the aptamer immobilized via 3 0 end was found to be KD = 5.8 -10 8 M.
t-Bu Hoechst dye	protein	Aptamer II	58.2 nM	-7.235			38613867	The Aptamer II sequence has a fluorescence-determined KD of 58.2 nM (Table 2)
Rat beta-crosslaps	protein	BC2	59.0 nM	-7.229			33379043	The BC1 and BC2 aptamers show high affinity in the nanomolar range, 69 and 59 nM, respectively
Rat osteocalcin	protein	OC2	59.0 nM	-7.229			33379043	The high-affinity aptamers of OC and BC showed the Kd values of 59 and 55 nM respectively.
melamine	protein	Mel36-1	6.000000000000001e-08 M	-7.222			42261635	The highest affinity aptamers exhibited a dissociation constant ( K d) of ∼ 60 nM
adenosine monophosphate	protein	AMP aptamer	60.0 nM	-7.222			35934372	KD in saturated AMP concentration (500 μ M) was 60 nM
prothrombin	protein	ARC-183	60.7 nM	-7.217	SPR	298.15	22385910	Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM and ARC-183 = 60.7 nM)
prothrombin	protein	HD1-22	6.1e-08 M	-7.215	SPR		18826387	HD1-22 \| Prothrombin \| K D ( M) \| 6.1 · 10 ) 8
Tau	protein	Apt	62.5 nM	-7.204	SPR	298.15	41034513	Surface plasmon resonance (SPR) assay revealed that Apt could specifically bind to Tau proteins with high affinity (dissociation constant = 62.5 ± 1.1 nM)
Pb2+	protein	TBA-4PI[T3]	6.300000000000001e-08 M	-7.201		298.15	34543022	a titration of Pb(NO3)2 to 1 μ M TBA-4PI[T3] provided an apparent dissociate constant ( K d) of 63 nM
Aβ42 monomer	protein	Aβ-Apt	6.34e-08 M	-7.198	SPR	298.15	35019631	It was evaluated that A β -Apt showed the ability to bind A β 42 with a K d of 63.4 nM.
SipA	protein	Apt17	63.4 nM	-7.198			31953175	Apt17 displayed Kd values of 114.9 and 63.4 nM at 27 °C and 37 °C, respectively
Staphylococcal enterotoxin B	protein	A11	64.0 nM	-7.194			25624325	A2 and A11 both bound with high affinity to SEB, with dissociation constants of 26 nM and 64 nM, respectively
paramylon	protein	Par-18	6.406e-08 M	-7.193	fluorescence		31809034	The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 ± 2.61, 34.90 ± 5.83, 64.06 ± 6.72, 123.81 ± 13.41, and 249.52 ± 46.39 nM, respectively.
Total Phthalate Esters (TP)	protein	Parental 39-mer aptamer	65.7 nM	-7.182			33524734	Compared with the Kd (TP) of 65.7 nM for the parental 39-mer aptamer
thrombin	protein	12Trp	67.3 nM	-7.172	MST		33614235	12Trp \| 54.7 \| 67.3 ± 12.1 \| 3.12
SARS-CoV-2 spike trimer	protein	S1	68.9 nM	-7.162			34188971	The aptamer S14 evinced 3-fold higher affinity (KD = 21.8 nM) then S1 (KD = 68.9 nM).
Rat beta-crosslaps	protein	BC1	69.0 nM	-7.161			33379043	The BC1 and BC2 aptamers show high affinity in the nanomolar range, 69 and 59 nM, respectively
chlorpromazine	protein	CHL-3	69.8 nM	-7.156			36049339	The Kd value of CHL-3 is 69.8 nM.
thrombin	protein	12Leu	72.2 nM	-7.141	MST		33614235	12Leu \| 53.6 \| 72.2 ± 0.9 \| 4.14
Nampt	protein	no. 19	72.52 nM	-7.14			22704839	dissociation constant ( Kd ) was calculated to be 72.52 nM for the no. 19 aptamer
SCAF4	protein	PTf-SRiApt	0.073 µM	-7.137	fluorescence		40574704	0.073 ± 0.003 µ m for PTf -SRiApt
Fok I	protein	F6#71	74.0 nM	-7.131			27899266	dissociation constants of F6#8 and #71 were 82 nM and 74 nM, respectively
HFIXa	protein	Seq 5	74.07 nM	-7.13	ITC	298.15	38776649	Seq 5- \| 7.4 \| 0.921 \| 13.5 \| 74.07 \| 209.1 \| 565 \| 40.43
alkaline phosphatase	protein	ALP binding aptamer	7.49e-08 M	-7.126	PISA		30827094	From the response -dose curve (Figure 3A), the dissociation constant ( K d ) for aptamermodi fi ed array was estimated by the logistic function fi tting to be 7.49 × 10 -8 M
neomycin-B	protein	NEO7A	75.0 nM	-7.125			23535583	NEO7A bound neomycin-B with a Kd of 75 nM in buffer A
gonyautoxin 1/4	protein	GO18-T-d	75.63 nM	-7.121			33294137	Corresponding Kd values of GO18-T-d and tGO18-T-d, determined by the average of 8 independent measurements, were 75.63 nM and 3.60 nM, respectively.
Co2+	protein	Co-1	7.6e-08 M	-7.119			40656531	The corresponding true K d values were ... 76 nM for Co 2+
PAUF	protein	P12FR2	77.0 nM	-7.114			21963224	the equilibrium dissociation constant calculated from the relation of KD = kd / ka was 77 nM
prothrombin	protein	HD1	7.8e-08 M	-7.108	SPR		18826387	HD1 \| Prothrombin \| K D ( M) \| 7.8 · 10 ) 8
hemagglutinin (HA) protein of H1N1 influenza virus (A/Puerto Rico/8/1934)	protein	aptamer 1	78.0 nM	-7.108	fluorescence	310.15	26904922	As it showed a higher binding affinity for HA protein (Kd = 78 -1nM), aptamer 1 was tested
kanamycin	protein	Ky2	78.8 nM	-7.103			21530479	The dissociation constants ( K d [kanamycin] = 78.8 nM
kanamycin	protein	Ky2	78.8 nM	-7.103			28259207	The dissociation constants (Kd [kanamycin] = 78.8 nM
Plasmodium falciparum glutamate dehydrogenase	protein	NG3	79.0 nM	-7.102			29909195	A thiolated ssDNA aptamer (NG3) that binds speci fi cally to Pf GDH antigen with high a ffi nity (K d= 79 nM) was used to develop the aptasensor.
lysozyme	protein	lysozyme-binding aptamer	80.0 nM	-7.097			21616496	average dissociation constant ( k d ) was 80.0nM ± 14nM
MUP13	protein	Apt-1.4	80.0 nM	-7.097			35026634	The equilibrium dissociation constants ( KD ) were 180 ± 80 nM for Apt-2.5 and 80 ± 44 nM for Apt-1.4.
patulin	protein	PAT C3	8.2e-08 M	-7.086	SPR		35546052	PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 × 10 -8 and 1.9 × 10 -7 M, respectively
Oxytetracycline	protein	OTC5	8.2e-08 M	-7.086			35777074	In a buffer containing 300 mM NaCl and 10 mM MgCl2, the fitted K d value was 82 nM (Figure 3B, black trace)
Fok I	protein	F6#8	82.0 nM	-7.086			27899266	dissociation constants of F6#8 and #71 were 82 nM and 74 nM, respectively
Neuron specific enolase	protein	NSE-Apt5-5BioTEG	83.0 nM	-7.081			35495513	Through kinetic analysis, the binding rate constant and dissociation rate constant were determined to be 1.21 -10 4 Ms 1 and 1.004 -10 3 s 1 , respectively... Though this SPR analysis, the dissociation constant ( K d) was determined to be about 83 nM
Staphylococcal enterotoxin B	protein	PEGA11	83.5 nM	-7.078			25624325	PEGA11 had a dissociation constant of 83.5 nM in selection buffer
kanamycin B	protein	Ky2	84.5 nM	-7.073			21530479	K d [kanamycin B] = 84.5 nM
kanamycin B	protein	Ky2	84.5 nM	-7.073			28259207	Kd [kanamycin B] = 84.5 nM
kanamycin	protein	Kana2	85.6 nM	-7.068			21530479	The K d values of Kana2 and Ky2 as determined by fluorescence measurement were 85.6 and 78.8 nM, respectively
thrombin	protein	12Ser	86.6 nM	-7.062	MST		33614235	12Ser \| 52.0 \| 86.6 ± 4.5 \| 2.34
Zearalenone	protein	Z100	87.22 nM	-7.059			38608399	Moreover, the Kd value of Z100 measured by the GO method was found to be 87.22 nM
thrombin	protein	APTA	88.0 nM	-7.056	QCM		16725379	APTA \| 0.97±0.45 \| 86±73 \| 0.011±0.006 \| 88±52
fibrinogen	protein	FA	89.6 nM	-7.048	microscale thermophoresis		33395250	The K d calculated for the fi brinogen target was 89.6 nM
HspX	protein	H63 SL-2 M6	9e-08 M	-7.046			30205966	H63 SL-2 M6 displayed a speci fi c and high a ffi nity interaction with HspX (Kd ∼ 9.0 × 10 -8 M).
Zearalenone	protein	A1	90.25 nM	-7.045			38608399	The Kd value was 90.25 nM as determined by the GO method
Immunoglobulin E	protein	IgE37-T10-FAM (5-bp truncated)	90.5 nM	-7.043			32498825	When 4-base pairs and 5-base pairs were truncated from the stem, the K ds of the aptamers increased to 11.4 nM and 90.5 nM, respectively.
N-acetylneuraminic acid	protein	Neu5Ac aptamer	91.0 nM	-7.041	ITC	310.15	37217750	To validate ARPLA, we first determined the binding affinity ( K d ) of the Neu5Ac aptamer by isothermal titration calorimetry (ITC) as 91 nM (Extended Data Fig. 2a,b)
mouse IL-2	protein	M20	91.0 nM	-7.041			35756119	The results indicated that the af fi nity of the M20 aptamer was greater than the M15, and its predicted Kd was 91 nM
Okadaic Acid	protein	OA-LC2	91.13 nM	-7.04	BLI		36322695	OA-LC2 exhibited K d of 91.13 ± 4.64 nM
rmCD3 d ε -Fc	protein	CD3_Apt1	91.3 nM	-7.04	SPR	298.15	38745854	aptamer 1 (91.3 nM)
6'-sialyllactose	protein	Apt9-1	9.175000000000001e-08 M	-7.037	fluorescence	298.15	36700646	A 35 nt truncated aptamer Apt9-1 ( K d = 91.75 nM) with higher affinity than Apt9 was finally obtained.
BHQ-2-(NH(NH)NH2)2	protein	AMP aptamer	92.0 nM	-7.036			35934372	BHQ-2-(NH(NH)NH2)2 had lower affinity to the aptamer in the low salt buffer. KD was 92 nM
17 β -estradiol	protein	HEV1	9.276e-08 M	-7.033	MST		38276613	the dissociation constant (KD value) is 92.76 ± 66.02 nM as calculated by the calculation function that comes with the system.
Gymnodimine-A	protein	G48nop	95.3 nM	-7.021			35324692	The resulting K D value of G48nop (95.30 nM) was about one third of that of G48 (288 nM)
thrombin	protein	TBA15	97.0 nM	-7.013			23850569	A K D value of 97 nM 1 nM was determined for the TBA/Thr complex in the MST assay
Oxytetracycline	protein	OTC5	9.8e-08 M	-7.009			35777074	we fitted the peak fluorescence to obtain a K d of 98 nM (Figure 4B)
neomycin	protein	NAN-NEO	98.101 nM	-7.008			22321384	Using the LineweaverBurk equation (Equation 1), we calculated the dissociation constant (Kd) to be 98.101 nM (Figure 5, B ).
thrombin	protein	12Phe	99.1 nM	-7.004	MST		33614235	12Phe \| 54.3 \| 99.1 ± 6.3 \| 4.07
BSA	glycan/conjugate	Clone 5	1e-07 M	-7.0	SPR		11178986	BSA \| 2.2 3 10 4 \| 2.3 3 10 2 3 \| 9.9 3 10 6 \| 1.0 3 10 2 7
D-TAR RNA	protein	L-6-4t	1.0000000000000001e-07 M	-7.0			23977945	the K d of the L-aptamer for D-TAR RNA is 100 nM
Bisphenol A	protein	BPA-specific aptamer	1.0000000000000001e-07 M	-7.0			25329684	the K d value for free BPA binding to the BPA aptamer was determined experimentally using MST to be ∼ 100 nM
Thrombin	protein	TBA15	1e-07 M	-7.0			26643617	K d of free TBA15 (~1 × 10 -7 M)
human β-defensin 2	protein	U gu1	100.0 nM	-7.0			32067984	Besides, clone U gu1 bound somewhat poorly to HBD-2 ( K d = 100 nM, Fig. S2).
CD9	protein	CD9-26	101.96 nM	-6.992	fluorescence	277.15	37585601	CD9-26 \| 5 ′ -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG TGC GCA CTA GAG CAG GTA CGG TGT CA-3 ′ \| - 8.92
human α-Thrombin	protein	A3	101.9 nM	-6.992			31129134	and as poorest binder aptamer A3 (101.9 nM).
tobramycin	protein	Ky2	103.0 nM	-6.987			21530479	and K d [tobramycin] = 103 nM)
tobramycin	protein	Ky2	103.0 nM	-6.987			28259207	and Kd [tobramycin] = 103nM
Okadaic Acid	protein	OA-SL2	103.4 nM	-6.985	BLI		36322695	from OA-SL1 to OASL2, K d was lowered from 340.5 ± 14.5 to 103.4 ± 7.0 nM
aflatoxin B2	protein	A50-T26-TMR	105.0 nM	-6.979			30086944	the K d for AFB2 was determined to be 105 nM in our study.
luteolin	protein	LUT#28	107.0 nM	-6.971			29524380	The value of Kd for LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively.
luteolin	protein	LUT#3	109.0 nM	-6.963			29524380	The value of Kd for LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively.
domoic acid	protein	C1-d	1.09e-07 M	-6.963			36421085	Biolayer interferometry assay illustrated that C1-d possessed a K on (1/Ms) value of 2.94 × 10 5 , a K dis (1/s) value of 5.13 × 10 -2 , and a K D (M) value of 1.09 × 10 -7 M in the interaction with DA.
thrombin	protein	HD1	110.0 nM	-6.959	filter_binding		41053535	HD1 binds both thrombin (K D = 110 nm)
BHQ-2-(NH2)2	protein	off-target DNA hairpin	110.0 nM	-6.959			35934372	KD of the complex between BHQ-2-(NH2)2 and off-target DNA hairpin ... was twice higher, 110 nM
PA toxin	protein	Apt11	1.1200000000000001e-07 M	-6.951			20136122	The aptamer was developed in-house by capillary electrophoresis systematic evolution of ligands by exponential enrichment (CE-SELEX) and had a dissociation constant (K d ) of 112 nM.
polysialic acid	protein	Apt3	114.0 nM	-6.943			35151974	The K d value of candidate Apt3 is the lowest among all the tested candidate aptamer sequences, which is 114.0 nM
trisialic acid	protein	Apt3	114.0 nM	-6.943			40545079	aptamer Apt3 ( K d = 114.0 nM)
human α-Thrombin	protein	A3	117.8 nM	-6.929			31129134	and the poorest binder is A3 (117.8 nM).
SCAF4	protein	PT1/2-SRiApt	0.121 µM	-6.917	fluorescence		40574704	0.121 ± 0.054 µ m for PT1/2 -SRiApt
SIRT2	protein	Apt 45	1.233e-07 M	-6.909	fluorescence	310.15	40200675	selected Apt 45 ( K d = 123.3 nM) to fabricate the 'turn-on' fluorescent biosensor
Netilmicin	protein	APT-21	126.0 nM	-6.9			35752088	Intriguingly, the Kd value in the experiment (Fig. 4B) is 126.0 nM
thrombin	protein	A4	127.0 nM	-6.896			23850569	The K D value determined for A4 (127 nM 1.4 nM) was very close to that of TBA15
human α-Thrombin	protein	A1	129.8 nM	-6.887			31129134	for iRIf aptamer A2 is the best (26.4 nM) and aptamer A1 the poorest (129.8 nM)
sLe X -BSA	glycan/conjugate	Original pool	1.3e-07 M	-6.886	SPR		11178986	Original pool \| 2.6 3 10 4 \| 3.3 3 10 2 3 \| 7.6 3 10 6 \| 1.3 3 10 2 7
H-Thr	protein	Seq-1	136.0 nM	-6.866			31103164	The good af fi nity of Seq-1 (Fig. S2) with 136 nM and Apt-29 with 199 nM were obtained
saxitoxin	protein	75a	136.0 nM	-6.866			35324725	aptamer 75a with a K d value of 136 nM
CD25	protein	Apt70	138.6 nM	-6.858			29055191	Using non-linear regression analysis, the Kd of Apt51 and Apt70 aptamers were found to be 13.4 nM and 138.6 nM, respectively
guanine	protein	R10G2	1.4e-07 M	-6.854			38194356	In our R10G2 aptamer, a K d of 140 nM guanine was achieved
Oxytetracycline	protein	OTC5	1.47e-07 M	-6.833		298.15	35777074	a representative sequence named OTC5 had a dissociation constant of 147 nM measured by isothermal titration calorimetry.
AP65	protein	AP65_A1	1.48e-07 M	-6.83			29972299	The resulting K D was 148 nM
6'-sialyllactose	protein	Apt9	1.5230000000000003e-07 M	-6.817	fluorescence	298.15	36700646	The ssDNA aptamer Apt9 ( K d = 152.3 nM) with a length of 79 nucleotides (nt) was demonstrated as the optimal aptamer candidate
Surface Antigen 1	protein	SOK10	152.9 nM	-6.816			40288708	SOK10 (152.9 nM, R 2 = 0.7217)
progastrin-releasing peptide (31-98)	protein	ProGRP-48-5BioTEG	153.0 nM	-6.815			35495513	The dissociation constant ( K d) of ProGRP31-98 to aptamer was calculated to be 153 nM
D-TAR RNA	protein	L-6-4t	1.6e-07 M	-6.796			23977945	The L-6-4t aptamer has somewhat reduced affinity for D-TAR RNA under the low-salt conditions (K d = 160 nM)
Hen egg white lysozyme	protein	DNA analog a2	161.0 nM	-6.793			21167858	The aptamerlysozyme equilibrium dissociation constant of 161 ± 16nM agrees reasonably well with the Kd from fluorescence anisotropy (467 ± 140nM). The overall free energy and enthalpy changes are -9.32 ± 0.06kcal/mol and 2.2 ± 1.0 kcal/mol, respectively.
thrombin	protein	3NB	163.5 nM	-6.786	MST		33614235	3NB \| 51.7 \| 163.5 ± 3.5 \| 3.82
Phosphatidylserine	protein	PS-LC3-TF	166.2 nM	-6.779	BLI		36322695	The terminal-fixed PS-LC3-TF exhibited an even lower K d at 166.2 ± 10.7 nM
xanthylacrylamide	protein	XAA-1	1.6800000000000002e-07 M	-6.775			40261307	an apparent K d value of 168 nM was obtained
Tramadol hydrochloride	protein	Apt39	178.4 nM	-6.749			33965888	the Kd of Apt39 was measured to be 178.4 nM
patulin	protein	PAT C4	1.9e-07 M	-6.721	SPR		35546052	PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 × 10 -8 and 1.9 × 10 -7 M, respectively
Sc3+	protein	Sc-1	1.9200000000000003e-07 M	-6.717			39743479	obtained an apparent K d value of 192 nM
Netilmicin	protein	APT-21	194.1 nM	-6.712			35752088	APT-21 bound to NET with high affinity (Kd = 194.1 nM)
streptomycin	protein	STR1	199.1 nM	-6.701			23601877	the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively.
H-Thr	protein	Apt-29	199.0 nM	-6.701			31103164	The good af fi nity of Seq-1 (Fig. S2) with 136 nM and Apt-29 with 199 nM were obtained
malachite green	protein	MGA	200.0 nM	-6.699			27591602	Based on the fl uorescence enhancement of MG, the initial dissociation constant ( K d) is determined to be 200 nM as seen in Figs. 2A and B
sCD80	protein	CD80-4	200.5 nM	-6.698			37816286	CD80-4 and CD80-16 aptamers showed the lowest K d values of 200.5 nM and 47.69 nM, respectively
bilirubin	protein	Brb7	2.03e-07 M	-6.693			40669049	The tightest binding bilirubin aptamer has a K d value of 203 nM based on ITC
rmCD3 d ε -Fc	protein	CD3_Apt12	206.0 nM	-6.686	SPR	298.15	38745854	aptamer 12 (206 nM)
AP65	protein	AP65_A1	2.09e-07 M	-6.68			29972299	K D of 209 nM was obtained
saxitoxin	protein	STX-R-75	209.4 nM	-6.679			35324725	STX-R-75 ( K d: 209.4 nM, Table S1)
di-2-ethylhexyl phthalate	protein	PT01 aptamer	213.0 nM	-6.672			30189334	The dissociation constant, Kd, of the PT01 aptamer was calculated as 213.0 nM using Eq. (1).
rhGH	protein	rhGH-specific aptamer	218.0 nM	-6.662			19500672	the affinity constant was K D = 218 nM rhGH
Cd2+	protein	probe	2.2e-07 M	-6.658			32618180	the disassociation constant ( K D) between Cd 2+ and its aptamer were calculated to be 96 M -1 S -1 , 2.11 × 10 -5 S -1 , and 220 nM, respectively
streptomycin	protein	STR3	221.3 nM	-6.655			23601877	the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively.
SCAF4	protein	PT1/3-SRiApt	0.223 µM	-6.652	fluorescence		40574704	0.223 ± 0.030 µ m for PT 1/3 -SRiApt
xanthylacrylamide	protein	XAA-1	2.2400000000000002e-07 M	-6.65			40261307	Using the ThT assay, an apparent K d of 224 nM was obtained for XAA-1
benzovindiflupyr	protein	Apt.BZF01	2.2650000000000002e-07 M	-6.645	fluorescence		41614999	corrected KDs of 226.5 nM (Apt.BZF01)
Adenosine	protein	Ade1301b	2.3000000000000002e-07 M	-6.638			36947745	Ade1301b showed an even lower K d of 230 nM
aflatoxin M1	protein	A50-T26-TMR	230.0 nM	-6.638			30086944	The aptamer showed almost the same FA responses to AFM1 and AFM2, with K ds to be 230 nM and 302 nM, respectively.
urea	protein	U38	232.0 nM	-6.635			26002019	isolate a urea speci fi c DNA aptamer with a dissociation constant ( K d) of 232 nM
Okadaic Acid	protein	OA-SL3	234.4 nM	-6.63	BLI		36322695	When OA-SL1 was tripled to get the chimera OA-SL3, K d rose to 234.4 ± 15.6 nM
urea	protein	U38	238.0 nM	-6.623			26002019	The K d of aptamer was calculated to be 238 nM
Sr2+	protein	Thrombin Binding Aptamer	240.0 nM	-6.62	mass_spectrometry	298.15	18318508	the Kd determined from the best-fit curve is 240 ( 50 nM for the interaction of TBA and Sr 2 +
Zika NS1	protein	10 (truncated)	2.4000000000000003e-07 M	-6.62			29120623	comparable binding affinities (24 and 45 pM for 100-nt and 41-nt 2 , and 134 and 240 nM for 100-nt and 54-nt 10 , respectively)
dT20	protein	DCC-SSB	2.4000000000000003e-07 M	-6.62		293.15	34085169	Titrations of dT 27 and dT20 at low concentrations of DCCSSB gave smaller fluorescence changes, and the data were fit to give single K d values of 43 and 240 nM, respectively
cortisol	protein	CSS.3	2.4000000000000003e-07 M	-6.62			38270529	Our own internal work confirmed that CSS.3 had the best binding affinity in binding buffer with a K D of 240 nM
kanamycin	protein	Apt 1/Apt 2 (split aptamers)	247.0 nM	-6.607			35316405	With the (GlcN)5 added in the binding buffer, the Kd was measured to be 247 nM
Ni2+	protein	Ni-4	2.5700000000000004e-07 M	-6.59			40656531	and 257 nM for Ni 2+ in the same titration
rHuEPOa	protein	813	260.0 nM	-6.585			20971648	The K d values of sequences of 807, 813, and 850 were 82 ± 32 nM, 260 ± 117 nM, and 590 ± 354 nM, respectively
Tetracycline	protein	OTC5	2.6400000000000003e-07 M	-6.578			35777074	they also showed a similar fluorescence enhancement with a K d of 264 nM TC
streptomycin	protein	STR6	272.0 nM	-6.565			23601877	the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively.
5-Methoxytryptamine	protein	MLT-C-1F	0.274 μM	-6.562			36925277	For L-TRP and 5-MT very low K d were observed i.e., 0.324 μM and 0.274 μM respectively
human α-Thrombin	protein	A1	279.0 nM	-6.554			31129134	Whereas the highest value was determined with iRIf for aptamer A1, which is 279 nM.
trisialic acid	protein	Apt3-1	282.7 nM	-6.549			40545079	Apt3 -1 ( K d = 282.7 nM)
VEGF165	protein	no. 529	2.8800000000000004e-07 M	-6.541			36215718	The K D values of 524, 64, and 529, were 36.3, 79.3, and 288 nM, respectively.
Lactose	protein	Clone 5	2.9e-07 M	-6.538	SPR		11178986	Lactose \| 6.3 3 10 2 \| 1.8 3 10 2 4 \| 3.4 3 10 6 \| 2.9 3 10 2 7
CD9	protein	CD9-28	289.67 nM	-6.538	fluorescence	277.15	37585601	CD9-28 \| 5 ′ -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG GGC GCA CTA GAG CAG GTA CGG TGT CA-3 ′ \| - 8.80
Sc3+	protein	Sc-1b	3.0200000000000003e-07 M	-6.52			39743479	its K d (302 nM) was comparable to that of Sc-1
aflatoxin M2	protein	A50-T26-TMR	302.0 nM	-6.52			30086944	The aptamer showed almost the same FA responses to AFM1 and AFM2, with K ds to be 230 nM and 302 nM, respectively.
kanamycin	protein	Apt 1/Apt 2 (split aptamers)	304.0 nM	-6.517			35316405	The split aptamers exhibited high affinity towards the kanamycin, with an Kd of 304 nM.
streptomycin	protein	STR12	340.64 nM	-6.468			23601877	the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively.
serotonin	protein	Serotonin Aptamer	3.6000000000000005e-07 M	-6.444			36704862	The steady-state binding responses were fitted to the affinity model in eq 1, as shown in Figure 3B, which yielded a K d of 360 nM.
Hen egg white lysozyme	protein	DNA analog a1	378.0 nM	-6.423			21167858	The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 ◦ C are 378nM, 467nM and 573nM, respectively.
benzylpenicillin	protein	BBA1	383.4 nM	-6.416			28522308	a Kd of 383.4 nM (dissociation constant) was determined.
benzylpenicillin	protein	BBA1	383.4 nM	-6.416			33184760	a Kd of 383.4 nM (dissociation constant) was determined.
bilirubin	protein	Bvd4	3.9e-07 M	-6.409			40669049	We then performed a careful bilirubin titration (Figure S3A), and a clear binding was observed with an apparent K d of 390 nM bilirubin (Figure S3B).
dT20	protein	DCC-SSB	3.96e-07 M	-6.402		293.15	34085169	With dT20, the intercept suggests a dissociation rate constant of 49 s -1 , producing a value of 396 nM for the equilibrium dissociation constant
biliverdin	protein	Bvd4	4.0999999999999994e-07 M	-6.387	fluorescence		40669049	Titration of biliverdin into 1 μM Bvd4 aptamer led to an approximate 90% fluorescence drop (Figure 3A), and the fitted dissociation constant ( K d ) was 0.41 μM
theophylline	protein	ΔTCT8-4 theophylline-binding aptamer	4.2e-07 M	-6.377			41248478	Analysis of the SPR dose -response data gave a binding affinity of 420 nM.
rmCD3 d ε -Fc	protein	CD3_Apt3	430.0 nM	-6.367	SPR	298.15	38745854	aptamer 3 (430 nM)
Kringle 5	protein	KG-4	432.0 nM	-6.365			37149949	The preferred aptamer KG-4, which demonstrated a low dissociation constant ( K d) of ~ 432 nM
mannose-capped lipoarabinomannan	protein	ZXL1	436.3 nM	-6.36	ELONA	310.15	24572295	The K d of 436.3 ± 37.84 nM was established as described in the Methods section.
Uric Acid	protein	Apt2	4.61e-07 M	-6.336			42095518	Microscale thermophoresis (MST) analysis yielded a Kd value of 461 nM for Apt2
Hen egg white lysozyme	protein	DNA analog a2	467.0 nM	-6.331			21167858	The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 ◦ C are 378nM, 467nM and 573nM, respectively.
Muscovy duck parvovirus	protein	Apt-10	467.0 nM	-6.331			28917743	the ssDNA aptamer Apt-10, which specifically bound to MDPV with high affinity ( Kd = 467 nM) was successfully screened
Fe2+	protein	Co-1	4.68e-07 M	-6.33			40656531	The corresponding true K d values were ... 468 nM for Fe 2+
SCAF4	protein	SRiApt	0.469 µM	-6.329	fluorescence		40574704	The binding affinities (K D ) were determined to be 0.469 ± 0.010 µ m for unmodified SRiApt
Bisphenol A	protein	63-mer BPA aptamer	491.69 nM	-6.308			32113141	The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM
Mouse thrombin	protein	M08s	495.0 nM	-6.305	SPR		37621412	M08s \| 3.56 10^5 \| 1.76 10^-1 \| 495
thrombospondin-1	protein	M55	0.5 μM	-6.301	ELISA		24434496	The K D value of the aptamer M55 binding to thrombospondin-1 was determined as 0.5 7 0.2 μ M
adenine	protein	R10A4	5.000000000000001e-07 M	-6.301			38194356	our R10A4 aptamer has a comparable K d of 500 nM
Clenbuterol	protein	CLB-1	5.61e-07 M	-6.251			42204903	the apparent K d was 561 nM (Figure 3B)
Hen egg white lysozyme	protein	DNA analog a3	573.0 nM	-6.242			21167858	The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 ◦ C are 378nM, 467nM and 573nM, respectively.
mouse IL-2	protein	M15	600.0 nM	-6.222			35756119	The calculation of the dissociation constant predicted 91 and 600 nM Kd for M20 and M15, respectively
human β-defensin 2	protein	A ad1-2	676.0 nM	-6.17			32067984	a clone with a truncation at the 3 ʹ terminal (A ad1 -2 , 58mer, Fig. 4a) was found to bind more weakly to HBD-2 ( K d = 676 nM, Fig. 4b).
HER3	protein	HBR	700.0 nM	-6.155			33770580	The dissociation constant ( K D) of HBR was calculated from the resulting BLI sensorgrams was 700 nM.
Alternariol	protein	AOH 6C	701.0 nM	-6.154			34655971	The apparent KD of AOH 6C, B-2-3 and T-23 were 701 nM, 445 nM and 274 nM, respectively
Co2+	protein	Co-1	7.310000000000001e-07 M	-6.136			40656531	the Co-1 aptamer has a K d of 731 nM for Co 2+
Dinophysistoxin	protein	anti-DTX parent aptamer	778.1 nM	-6.109	BLI		36322695	antiDTX parent aptamer ( K d = 778.1 ± 73.5 nM)
Clenbuterol	protein	CLB-1	7.98e-07 M	-6.098			42204903	CLB binding was preserved in the absence of Mg 2+ ( K d 798 nM)
Clenbuterol	protein	CLB-1	8.850000000000001e-07 M	-6.053			42204903	ITC showed that the CLB-1 aptamer has a K d of 885 nM (Figure 3D)... The enthalpy ( Δ H = -24.9 kcal mol -1 ) and entropy ( Δ S = -55.9 cal K -1 mol -1 )
Co2+	protein	Ni-4	9.01e-07 M	-6.045			40656531	Ni-4 exhibited a K d of 901 nM for Co 2+
prothrombin	protein	HD1	992.0 nM	-6.003	filter_binding		41053535	and prothrombin (K D = 992 nm)
Thrombin	protein	aptamer 1S	1.08e-06 M	-5.967	SPR		32268723	The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 μM and 29.4 nM, respectively
CD117	protein	Apta04	1100.0 nM	-5.959	BLI	298.15	40487293	Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 µ m, respectively ( Figure 2 a,b).
CD123	protein	Apta25	1.16 µM	-5.936	BLI	298.15	40487293	BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 µ m for ZW25 and 15.6 µ m for CY30 (Figure S2, Supporting Information).
Bisphenol A	protein	23-mer BPA aptamer	1190.61 nM	-5.924			32113141	The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM
CD20	protein	Aptamer 2	1.2 μM	-5.921	ITC	298.15	39004051	\| 2 \| 1.2 ± 0.2 \| 1.49 ± 0.01 \| > mM \| N/D \|
IL-8	protein	8A-30	1.22e-06 M	-5.914	SPR	298.0	24129312	\| 8A-30 \| 1.32 x 10 6 \| 1.62 \| 1.22 x 10 -6 \| 4.62 x 10 -5 \| 1.06 x 10 -3 \|
bilirubin	protein	Brb7	1.4e-06 M	-5.854	fluorescence		40669049	After titrating bilirubin into 1.0 μM Brb7 aptamer, the saturation fluorescence decrease reached 99% (Figure 6A) and its K d was fitted to be 1.4 μM
Okadaic Acid	protein	anti-OA parent aptamer	1402.0 nM	-5.853	BLI		36322695	anti-OA aptamer with high affinity from its parent aptamer ( K d = 1402 ± 58 nM, Figure 1a)
amikacin	protein	Aptamer A1	1.5e-06 M	-5.824	ITC	298.15	36453647	Aptamer A1 binds 7-fold stronger to amikacin with a K d value of 1.5 μM
domoic acid	protein	C1-s	1.5e-06 M	-5.824			36421085	BLI results showed that the affinity of C1-s ( K D value, 1.50 × 10 -6 M) and C1 for DAwas at an equivalent level.
thrombin	protein	TBA15	1690.0 nM	-5.772			23850569	The addition of 10% blood plasma to the working buffer changed the K D values significantly ( K D TBA 1⁄4 1690 nM 15 nM
ESAT6/CFP10 fusion protein	protein	Aptamer 3 (core 21-nt)	1.81e-06 M	-5.742			40359808	retaining only the core 21-nucleotide sequence at the 5 ′ end results in a dramatic reduction of the K d value to 1.81E-6
cRNA	protein	CRP-specific RNA aptamer	1.98 μM	-5.703			22365749	Binding kinetics as determined by incubating different target concentrations against constant number of aptamers immobilized on sensor surface showed the K d values of 1.98 and 2.4 μM for cRNA and CRP, respectively.
biliverdin	protein	Bvd1	2e-06 M	-5.699	fluorescence		40669049	The same trend was also observed for the Bvd1 aptamer (Figure S1), and the fitted K d was 2.0 μM.
CTNNA1	protein	EA2	2.07 µM	-5.684	MST		40265971	The K d values (2.07 ± 0.60 µ M) obtained from MST assay (Figure 2l) further corroborated the specific binding between CTNNA1 and EA2.
verrucarin A	protein	14_Ver1	2.2e-06 M	-5.658	fluorescence		39404132	The binding test demonstrated that the decrease in fluorescence was correlated with increasing verrucarin A concentration with K D = 2.2 μM.
verrucarin A	protein	Ver1_JYP (C32G mutant)	2.2999999999999996e-06 M	-5.638	fluorescence		39404132	guanine with both functional groups exhibited partially recovered binding activity ( K D = 2.3 μM).
C-reactive protein	protein	CRP-specific RNA aptamer	2.4 μM	-5.62			22365749	Binding kinetics as determined by incubating different target concentrations against constant number of aptamers immobilized on sensor surface showed the K d values of 1.98 and 2.4 μM for cRNA and CRP, respectively.
hemin	protein	Sequence D	2.9 μM	-5.538	fluorescence		40368877	Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 μ M for sequences C and D, respectively.
thrombin	protein	A4	3040.0 nM	-5.517			23850569	K D A4 1⁄4 3040 nM 65 nM
swine C5a	protein	S1	4.0 μM	-5.398			30336124	Aptamer S1 bound specifically to swine C5a with a dissociation constant of 4 μM as measured by surface plasmon resonance (SPR).
Brevetoxin-2	protein	Bap5	4.83 uM	-5.316			28058132	The Kd value for the binding between the Bap5 aptamer and BTX-2 was 4.83 uM
K+	protein	Thrombin Binding Aptamer	5000.0 nM	-5.301	mass_spectrometry	298.15	18318508	the Kd determined from the bestfit curve is 5000 ( 1000 nM for the interaction of TBA and K +
CD20	protein	Aptamer 2-f1	5.5 μM	-5.26	ITC	298.15	39004051	\| 2-f1 \| 5.5 ± 1.3 \| 1.46 ± 0.03 \| > mM \| N/D \|
CD20	protein	Aptamer 1	6.4 μM	-5.194	ITC	298.15	39004051	\| 1 \| 6.4 ± 1.0 \| 0.86 ± 0.01 \| N/D \| N/D \|
hemin	protein	Sequence C	8.3 μM	-5.081	fluorescence		40368877	Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 μ M for sequences C and D, respectively.
CD20	protein	Aptamer 1-f1	9.0 μM	-5.046	ITC	298.15	39004051	\| 1-f1 \| 9.0 ± 2.4 \| 0.98 ± 0.02 \| > mM \| N/D \|
P-selectin	protein	NX244	9000000.0 pM	-5.046	filter_binding	310.15	9743465	NX244 \| 9 X 106
bilirubin	protein	Brb9	9e-06 M	-5.046	fluorescence		40669049	The same trend was also observed in the Brb9 aptamer (Figure S4), which showed a K d of 9.0 μM.
amikacin	protein	Aptamer A	9.999999999999999e-06 M	-5.0			36453647	native Aptamer A, which has a K d value of 10 μM
Patulin	protein	PTL-1	1.2499999999999999e-05 M	-4.903	ITC	298.15	41473783	The measured K d from ITC value was 12.5 μM
CD123	protein	Apta30	15.6 µM	-4.807	BLI	298.15	40487293	BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 µ m for ZW25 and 15.6 µ m for CY30 (Figure S2, Supporting Information).
Patulin	protein	PTL-1	1.8399999999999997e-05 M	-4.735	fluorescence		41473783	yielding an apparent K d of 18.4 μM
CD20	protein	Aptamer 1-f2	18.9 μM	-4.724	ITC	298.15	39004051	\| 1-f2 \| 18.9 ± 3.3 \| 1.07 ± 0.03 \| > mM \| N/D \|
dehydroepiandrosterone sulfate	protein	DHEAS aptamer (stem, Rp)	32.03 μM	-4.494	fluorescence		40368877	Values calculated are 32.03 μ M for stem Rp
dehydroepiandrosterone sulfate	protein	DHEAS aptamer (loop, Rp)	33.28 μM	-4.478	fluorescence		40368877	33.28 μ M for loop Rp
dehydroepiandrosterone sulfate	protein	DHEAS aptamer (stem, Sp)	36.57 μM	-4.437	fluorescence		40368877	36.57 μ M for stem Sp
patulin	protein	PAT Rep	4e-05 M	-4.398	SPR		35546052	PAT Rep showed a K D value of 4.0 × 10 -5 M
Patulin	protein	PAT-6	4.8e-05 M	-4.319	fluorescence		41473783	PAT-6 has weaker binding affinities ( Kd = 48 μM by ThT, Fig. 4S)
thiamethoxam	protein	Thi-5R-18	4.935e-05 M	-4.307			36831921	According to the ITC results (Figure 5), the Kd value was 4.935 × 10 -5 Mfor Thi-5R-18 combined with the target to release heat
dehydroepiandrosterone sulfate	protein	DHEAS aptamer (loop, Sp)	59.62 μM	-4.225	fluorescence		40368877	59.62 μ M for loop Sp
YRLFRK	protein	BC 007	86.7 μM	-4.062			33163683	followed by YRLFRK with Kd = 86.7 μM
L-lactate	protein	D-Lac1103	8.999999999999999e-05 M	-4.046	fluorescence		41779931	The true K d for D-Lac1103 was calculated to be 0.09 mM for L-lactate
L-lactate	protein	Lac2059	0.00011 M	-3.959	ITC	298.15	41779931	The K d from ITC was determined to be 0.11 mM
L-lactate	protein	Lac201	0.0009000000000000001 M	-3.046	fluorescence	296.15	41779931	the fitted K d was 0.9 mM (Figure 5C, black line)
D-lactate	protein	D-Lac1103	0.0025 M	-2.602	fluorescence	295.15	41779931	In addition, the apparent K d values for D-Lac1103 are 0.46 mMfor L-lactate and 2.5 mM for D-lactate
Tris(hydroxymethyl)aminomethane	protein	Tris aptamer	0.0026000000000000003 M	-2.585	fluorescence		40905906	ThT yielded K d values changed modestly from 1.6 to 2.6 mM
L-lactate	protein	Lac2059	0.0033 M	-2.481	fluorescence	296.15	41779931	The fitted K d was 3.3 mM for this 2AP-labeled aptamer
L-lactate	protein	Lac201	0.0043 M	-2.367	fluorescence	296.15	41779931	although the obtained K d (4.3 mM) was about 5-fold higher than that obtained using Mg 2+ .
acrylamide	protein	AA-1	0.0047 M	-2.328	fluorescence		40261307	Similarly, the AA-1 aptamer exhibited a true K d value of 4.7 mM via the strand-displacement assay
acrylamide	protein	AA-1	0.0105 M	-1.979	fluorescence		40261307	the fitted K d value was 10.5 mM