Binding affinities (Kd) — source-verified (view)
Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target
- target_name_canonical
- Target as named in the source paper.
- target_type
- protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
- target_uniprot
- UniProt accession when a human protein (sparse for now; links to apt-scout target).
- aptamer_name
- Aptamer identifier as reported.
- kd_reported
- Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
- kd_log10_molar
- log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
- measurement_class
- intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
- binding_constant_type
- Kd / apparent-Kd etc. as reported.
- assay_method
- SPR / filter binding / flow cytometry / ITC / BLI …
- assay_temperature_k
- Assay temperature (K) — a reason the same pair can have several rows.
- source_pmid
- PubMed ID of the source paper (links out).
- verbatim_quote
- The exact sentence the value was taken from.
- verification_level
- QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
- sequence_status
- Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
- pi_provenance_flag
- PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
- seq_source
- original (already in source DB) / backfill_text_verified (recovered from paper or SI text).
25 rows where assay_method = "BLI" and measurement_class = "intrinsic" sorted by kd_log10_molar
This data as json, CSV (advanced)
Suggested facets: target_name_canonical, target_uniprot, assay_temperature_k, assay_ph, assay_buffer, aptamer_modifications, source_pmid, doi, verbatim_quote, source_db
sequence_status 3
verification_level 2
tier 1
- Gold 25
target_type 1
- protein 25
measurement_class 1
- intrinsic · 25 ✖
binding_constant_type 1
- Kd 25
assay_method 1
- BLI · 25 ✖
| id | target_name_canonical | target_type | target_uniprot | aptamer_name | aptamer_seq | kd_reported | kd_log10_molar ▼ | measurement_class | binding_constant_type | tier | source_origin | verification_level | sequence_status | seq_source | pi_provenance_flag | assay_method | assay_temperature_k | assay_ph | assay_buffer | assay_cations | aptamer_chemistry | aptamer_modifications | source_pmid | doi | verbatim_quote | source_db |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 63 | CD8a | protein | P01732 | A8 | 5.59 nM | -8.253 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | BLI | 298.15 | binding buffer with 0.01% Tween 20 | DNA | 31209354 | 10.1038/s41551-019-0411-6 | the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively | step2c_literal_v3 | ||||||
| 87 | transferrin receptor 1 | protein | P02786 | JBA8.26 | 6.87 nM | -8.163 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | BLI | DNA | 35875870 | 10.1021/jacs.2c05349 | Using BLI, JBA8.26 was found to bind immobilized TfR1 with a K D of 6.87 ± 0.04 nM | step2c_literal_v3 | ||||||||
| 92 | Okadaic Acid | protein | O95232 | OA-LC2-TF | 8.735 nM | -8.059 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | BLI | 7.5 | 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) | 2.0 | DNA | terminal fixation with GC-rich sequences | 36322695 | 10.1021/acs.analchem.2c02653 | The terminal-fixed OA-LC2 (OA-LC2-TF) exhibited a K d of 8.735 ± 0.606 nM | step2c_literal_v3 | ||||
| 101 | thrombin | protein | P00734 | Uyne A - AUyne | 12.16 nM | -7.915 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | BLI | buffer used for the bead-based selection, which contains Tween-20 | DNA | 5-ethynyl-2′-deoxyuridine (Uyne); Biotin (5' end) | 37531184 | 10.1021/acschembio.3c00183 | U yne A - AUyne | 12.16 ± 0.02 | step2c_literal_v3 | ||||||
| 100 | thrombin | protein | P00734 | Uyne A - Uyne Uyne | 13.96 nM | -7.855 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | BLI | buffer used for the bead-based selection, which contains Tween-20 | DNA | 5-ethynyl-2′-deoxyuridine (Uyne); Biotin (5' end) | 37531184 | 10.1021/acschembio.3c00183 | U yne A - U yne U yne | 13.96 ± 0.03 | step2c_literal_v3 | ||||||
| 62 | CD8a | protein | P01732 | A3 | 14.7 nM | -7.833 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | BLI | 298.15 | binding buffer with 0.01% Tween 20 | DNA | 31209354 | 10.1038/s41551-019-0411-6 | the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively | step2c_literal_v3 | ||||||
| 95 | Dinophysistoxin | protein | DTX-SL1-TF | 15.45 nM | -7.811 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | BLI | 7.5 | 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) | 2.0 | DNA | terminal fixation | 36322695 | 10.1021/acs.analchem.2c02653 | DTX-SL1-TF showed a K d of 15.45 ± 1.92 nM | step2c_literal_v3 | |||||
| 421 | hnRNP A1 | protein | P09651 | AS1411 | GGTGGTGGTGGTTGTGGTGGTGGTGG | 1.75e-08 M | -7.757 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | BLI | 7.4 | BLI buffer (20 mM phosphate buffer, 8 mM KCl, 137 mM NaCl, 0.05% surfactant P20) | DNA | 38784467 | 10.1039/d3md00752a | for AS1411, the K d value was 17.5 nM (Fig. 6B) | step2c_acs_v1 | ||||
| 61 | CD8a | protein | P01732 | A1 | 20.1 nM | -7.697 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | BLI | 298.15 | binding buffer with 0.01% Tween 20 | DNA | 31209354 | 10.1038/s41551-019-0411-6 | the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively | step2c_literal_v3 | ||||||
| 422 | hnRNP A1 | protein | P09651 | TBA | GGTTGGTGTGGTTGG | 2.1100000000000004e-08 M | -7.676 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | BLI | 7.4 | BLI buffer (20 mM phosphate buffer, 8 mM KCl, 137 mM NaCl, 0.05% surfactant P20) | DNA | 38784467 | 10.1039/d3md00752a | for TBA, the K d value was 21.1 nM (Fig. 6A) | step2c_acs_v1 | ||||
| 94 | Dinophysistoxin | protein | DTX-SL1 | 21.75 nM | -7.663 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | BLI | 7.5 | 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) | 2.0 | DNA | 36322695 | 10.1021/acs.analchem.2c02653 | DTX-SL1 showed the lowest K d at 21.75 ± 1.42 nM | step2c_literal_v3 | ||||||
| 128 | CD117 | protein | P10721 | Apta02 | 21.8 nM | -7.662 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | BLI | 298.15 | DNA | 40487293 | 10.1002/adfm.202425394 | Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 µ m, respectively ( Figure 2 a,b). | step2c_literal_v3 | |||||||
| 373 | beta-conglutin | protein | 11-mer | GGTGGGGGTGG | 2.3300000000000003e-08 M | -7.633 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | BLI | 303.15 | 7.4 | PBS, 1.5 mM MgCl2, pH 7.4, 0.1% Tween-20 | DNA | 33498970 | 10.3390/ijms22031150 | A 2:1 heterogenous model was used to fit the data and calculate the binding affinities resulting in two different KD values of 6.95 and 23.30 nM. | step2c_acs_v1 | ||||
| 86 | transferrin receptor 1 | protein | P02786 | tJBA8.1 | 25.11 nM | -7.6 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | BLI | DNA | biotinylated | 35875870 | 10.1021/jacs.2c05349 | tJBA8.1 bound the TfR1 protein with a K D value of 25.11 ± 0.19 nM | step2c_literal_v3 | |||||||
| 98 | thrombin | protein | P00734 | HD22 (TA-TT) | AGTCCGTGGTAGGGCAGGTTGGGGTGACTGTAAACGCTCGCTTCGATCTAGTCCGTGGGGGCAGGGGGGTGACTAGCAGATATGCATCCGTAGC | 27.8 nM | -7.556 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | BLI | buffer used for the bead-based selection, which contains Tween-20 | DNA | Biotin (5' end) | 37531184 | 10.1021/acschembio.3c00183 | TA - TT | 27.80 ± 0.09 | step2c_literal_v3 | ||||
| 99 | thrombin | protein | P00734 | TA-AT | 38.7 nM | -7.412 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | BLI | buffer used for the bead-based selection, which contains Tween-20 | DNA | Biotin (5' end) | 37531184 | 10.1021/acschembio.3c00183 | TA - AT | 38.7 ± 0.5 | step2c_literal_v3 | ||||||
| 91 | Okadaic Acid | protein | O95232 | OA-LC2 | 91.13 nM | -7.04 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | BLI | 7.5 | 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) | 2.0 | DNA | 36322695 | 10.1021/acs.analchem.2c02653 | OA-LC2 exhibited K d of 91.13 ± 4.64 nM | step2c_literal_v3 | |||||
| 89 | Okadaic Acid | protein | O95232 | OA-SL2 | 103.4 nM | -6.985 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | BLI | 7.5 | 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) | 2.0 | DNA | 36322695 | 10.1021/acs.analchem.2c02653 | from OA-SL1 to OASL2, K d was lowered from 340.5 ± 14.5 to 103.4 ± 7.0 nM | step2c_literal_v3 | |||||
| 96 | Phosphatidylserine | protein | Q9UG56 | PS-LC3-TF | 166.2 nM | -6.779 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | BLI | 7.6 | 150 mM NaCl and 50 mM K2HPO4 (pH 7.6) | DNA | terminal fixation | 36322695 | 10.1021/acs.analchem.2c02653 | The terminal-fixed PS-LC3-TF exhibited an even lower K d at 166.2 ± 10.7 nM | step2c_literal_v3 | |||||
| 90 | Okadaic Acid | protein | O95232 | OA-SL3 | 234.4 nM | -6.63 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | BLI | 7.5 | 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) | 2.0 | DNA | 36322695 | 10.1021/acs.analchem.2c02653 | When OA-SL1 was tripled to get the chimera OA-SL3, K d rose to 234.4 ± 15.6 nM | step2c_literal_v3 | |||||
| 93 | Dinophysistoxin | protein | anti-DTX parent aptamer | 778.1 nM | -6.109 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | BLI | 7.5 | 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) | 2.0 | DNA | 36322695 | 10.1021/acs.analchem.2c02653 | antiDTX parent aptamer ( K d = 778.1 ± 73.5 nM) | step2c_literal_v3 | ||||||
| 129 | CD117 | protein | P10721 | Apta04 | 1100.0 nM | -5.959 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | BLI | 298.15 | DNA | 40487293 | 10.1002/adfm.202425394 | Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 µ m, respectively ( Figure 2 a,b). | step2c_literal_v3 | |||||||
| 131 | CD123 | protein | O75794 | Apta25 | 1.16 µM | -5.936 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | BLI | 298.15 | DNA | 40487293 | 10.1002/adfm.202425394 | BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 µ m for ZW25 and 15.6 µ m for CY30 (Figure S2, Supporting Information). | step2c_literal_v3 | |||||||
| 88 | Okadaic Acid | protein | O95232 | anti-OA parent aptamer | 1402.0 nM | -5.853 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | BLI | 7.5 | 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) | 2.0 | DNA | 36322695 | 10.1021/acs.analchem.2c02653 | anti-OA aptamer with high affinity from its parent aptamer ( K d = 1402 ± 58 nM, Figure 1a) | step2c_literal_v3 | |||||
| 130 | CD123 | protein | O75794 | Apta30 | 15.6 µM | -4.807 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | BLI | 298.15 | DNA | 40487293 | 10.1002/adfm.202425394 | BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 µ m for ZW25 and 15.6 µ m for CY30 (Figure S2, Supporting Information). | step2c_literal_v3 |
Advanced export
JSON shape: default, array, newline-delimited
CREATE VIEW v_kd AS
SELECT k.id,
target_name_canonical,
CASE
WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
ELSE 'protein'
END AS target_type,
target_uniprot, aptamer_name, aptamer_seq,
(COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
CASE
WHEN vh.verdict='confirmed' THEN 'human_verified'
WHEN vh.verdict='corrected' THEN 'human_corrected'
WHEN vh.verdict='rejected' THEN 'human_rejected'
WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
ELSE 'automated'
END AS verification_level,
sequence_status, seq_source, pi_provenance_flag,
assay_method,
CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';