home / scout

Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

25 rows where assay_method = "BLI", measurement_class = "intrinsic" and tier = "Gold" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: target_name_canonical, target_uniprot, assay_temperature_k, assay_ph, assay_buffer, aptamer_modifications, source_pmid, doi, verbatim_quote, source_db

sequence_status 3

  • pending_manual_supp 12
  • pending_supp_oa 9
  • verified_in_text_or_SI 4

verification_level 2

  • extraction_verified 22
  • multi_agent_verified 3

tier 1

  • Gold · 25 ✖

target_type 1

  • protein 25

measurement_class 1

  • intrinsic · 25 ✖

binding_constant_type 1

  • Kd 25

assay_method 1

  • BLI · 25 ✖
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
63 CD8a protein P01732 A8   5.59 nM -8.253 intrinsic Kd Gold v4 extraction_verified pending_supp_oa     BLI 298.15   binding buffer with 0.01% Tween 20   DNA   31209354 10.1038/s41551-019-0411-6 the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively step2c_literal_v3
87 transferrin receptor 1 protein P02786 JBA8.26   6.87 nM -8.163 intrinsic Kd Gold v4 extraction_verified pending_supp_oa     BLI         DNA   35875870 10.1021/jacs.2c05349 Using BLI, JBA8.26 was found to bind immobilized TfR1 with a K D of 6.87 ± 0.04 nM step2c_literal_v3
92 Okadaic Acid protein O95232 OA-LC2-TF   8.735 nM -8.059 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     BLI   7.5 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) 2.0 DNA terminal fixation with GC-rich sequences 36322695 10.1021/acs.analchem.2c02653 The terminal-fixed OA-LC2 (OA-LC2-TF) exhibited a K d of 8.735 ± 0.606 nM step2c_literal_v3
101 thrombin protein P00734 Uyne A - AUyne   12.16 nM -7.915 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     BLI     buffer used for the bead-based selection, which contains Tween-20   DNA 5-ethynyl-2′-deoxyuridine (Uyne); Biotin (5' end) 37531184 10.1021/acschembio.3c00183 U yne A - AUyne | 12.16 ± 0.02 step2c_literal_v3
100 thrombin protein P00734 Uyne A - Uyne Uyne   13.96 nM -7.855 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     BLI     buffer used for the bead-based selection, which contains Tween-20   DNA 5-ethynyl-2′-deoxyuridine (Uyne); Biotin (5' end) 37531184 10.1021/acschembio.3c00183 U yne A - U yne U yne | 13.96 ± 0.03 step2c_literal_v3
62 CD8a protein P01732 A3   14.7 nM -7.833 intrinsic Kd Gold v4 extraction_verified pending_supp_oa     BLI 298.15   binding buffer with 0.01% Tween 20   DNA   31209354 10.1038/s41551-019-0411-6 the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively step2c_literal_v3
95 Dinophysistoxin protein   DTX-SL1-TF   15.45 nM -7.811 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     BLI   7.5 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) 2.0 DNA terminal fixation 36322695 10.1021/acs.analchem.2c02653 DTX-SL1-TF showed a K d of 15.45 ± 1.92 nM step2c_literal_v3
421 hnRNP A1 protein P09651 AS1411 GGTGGTGGTGGTTGTGGTGGTGGTGG 1.75e-08 M -7.757 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   BLI   7.4 BLI buffer (20 mM phosphate buffer, 8 mM KCl, 137 mM NaCl, 0.05% surfactant P20)   DNA   38784467 10.1039/d3md00752a for AS1411, the K d value was 17.5 nM (Fig. 6B) step2c_acs_v1
61 CD8a protein P01732 A1   20.1 nM -7.697 intrinsic Kd Gold v4 extraction_verified pending_supp_oa     BLI 298.15   binding buffer with 0.01% Tween 20   DNA   31209354 10.1038/s41551-019-0411-6 the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively step2c_literal_v3
422 hnRNP A1 protein P09651 TBA GGTTGGTGTGGTTGG 2.1100000000000004e-08 M -7.676 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   BLI   7.4 BLI buffer (20 mM phosphate buffer, 8 mM KCl, 137 mM NaCl, 0.05% surfactant P20)   DNA   38784467 10.1039/d3md00752a for TBA, the K d value was 21.1 nM (Fig. 6A) step2c_acs_v1
94 Dinophysistoxin protein   DTX-SL1   21.75 nM -7.663 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     BLI   7.5 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) 2.0 DNA   36322695 10.1021/acs.analchem.2c02653 DTX-SL1 showed the lowest K d at 21.75 ± 1.42 nM step2c_literal_v3
128 CD117 protein P10721 Apta02   21.8 nM -7.662 intrinsic Kd Gold v4 extraction_verified pending_supp_oa     BLI 298.15       DNA   40487293 10.1002/adfm.202425394 Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 µ m, respectively ( Figure 2 a,b). step2c_literal_v3
373 beta-conglutin protein   11-mer GGTGGGGGTGG 2.3300000000000003e-08 M -7.633 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   BLI 303.15 7.4 PBS, 1.5 mM MgCl2, pH 7.4, 0.1% Tween-20   DNA   33498970 10.3390/ijms22031150 A 2:1 heterogenous model was used to fit the data and calculate the binding affinities resulting in two different KD values of 6.95 and 23.30 nM. step2c_acs_v1
86 transferrin receptor 1 protein P02786 tJBA8.1   25.11 nM -7.6 intrinsic Kd Gold v4 extraction_verified pending_supp_oa     BLI         DNA biotinylated 35875870 10.1021/jacs.2c05349 tJBA8.1 bound the TfR1 protein with a K D value of 25.11 ± 0.19 nM step2c_literal_v3
98 thrombin protein P00734 HD22 (TA-TT) AGTCCGTGGTAGGGCAGGTTGGGGTGACTGTAAACGCTCGCTTCGATCTAGTCCGTGGGGGCAGGGGGGTGACTAGCAGATATGCATCCGTAGC 27.8 nM -7.556 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   BLI     buffer used for the bead-based selection, which contains Tween-20   DNA Biotin (5' end) 37531184 10.1021/acschembio.3c00183 TA - TT | 27.80 ± 0.09 step2c_literal_v3
99 thrombin protein P00734 TA-AT   38.7 nM -7.412 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     BLI     buffer used for the bead-based selection, which contains Tween-20   DNA Biotin (5' end) 37531184 10.1021/acschembio.3c00183 TA - AT | 38.7 ± 0.5 step2c_literal_v3
91 Okadaic Acid protein O95232 OA-LC2   91.13 nM -7.04 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     BLI   7.5 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) 2.0 DNA   36322695 10.1021/acs.analchem.2c02653 OA-LC2 exhibited K d of 91.13 ± 4.64 nM step2c_literal_v3
89 Okadaic Acid protein O95232 OA-SL2   103.4 nM -6.985 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     BLI   7.5 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) 2.0 DNA   36322695 10.1021/acs.analchem.2c02653 from OA-SL1 to OASL2, K d was lowered from 340.5 ± 14.5 to 103.4 ± 7.0 nM step2c_literal_v3
96 Phosphatidylserine protein Q9UG56 PS-LC3-TF   166.2 nM -6.779 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     BLI   7.6 150 mM NaCl and 50 mM K2HPO4 (pH 7.6)   DNA terminal fixation 36322695 10.1021/acs.analchem.2c02653 The terminal-fixed PS-LC3-TF exhibited an even lower K d at 166.2 ± 10.7 nM step2c_literal_v3
90 Okadaic Acid protein O95232 OA-SL3   234.4 nM -6.63 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     BLI   7.5 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) 2.0 DNA   36322695 10.1021/acs.analchem.2c02653 When OA-SL1 was tripled to get the chimera OA-SL3, K d rose to 234.4 ± 15.6 nM step2c_literal_v3
93 Dinophysistoxin protein   anti-DTX parent aptamer   778.1 nM -6.109 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     BLI   7.5 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) 2.0 DNA   36322695 10.1021/acs.analchem.2c02653 antiDTX parent aptamer ( K d = 778.1 ± 73.5 nM) step2c_literal_v3
129 CD117 protein P10721 Apta04   1100.0 nM -5.959 intrinsic Kd Gold v4 extraction_verified pending_supp_oa     BLI 298.15       DNA   40487293 10.1002/adfm.202425394 Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 µ m, respectively ( Figure 2 a,b). step2c_literal_v3
131 CD123 protein O75794 Apta25   1.16 µM -5.936 intrinsic Kd Gold v4 extraction_verified pending_supp_oa     BLI 298.15       DNA   40487293 10.1002/adfm.202425394 BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 µ m for ZW25 and 15.6 µ m for CY30 (Figure S2, Supporting Information). step2c_literal_v3
88 Okadaic Acid protein O95232 anti-OA parent aptamer   1402.0 nM -5.853 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     BLI   7.5 50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5) 2.0 DNA   36322695 10.1021/acs.analchem.2c02653 anti-OA aptamer with high affinity from its parent aptamer ( K d = 1402 ± 58 nM, Figure 1a) step2c_literal_v3
130 CD123 protein O75794 Apta30   15.6 µM -4.807 intrinsic Kd Gold v4 extraction_verified pending_supp_oa     BLI 298.15       DNA   40487293 10.1002/adfm.202425394 BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 µ m for ZW25 and 15.6 µ m for CY30 (Figure S2, Supporting Information). step2c_literal_v3

Advanced export

JSON shape: default, array, newline-delimited

CSV options:

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';
Powered by Datasette · Queries took 125.002ms · Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target