home / scout

Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

25 rows where assay_method = "MST", sequence_status = "verified_in_text_or_SI" and tier = "Gold" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: target_name_canonical, target_uniprot, aptamer_name, aptamer_seq, assay_ph, assay_buffer, source_pmid, doi, source_db

verification_level 2

  • extraction_verified 19
  • multi_agent_verified 6

measurement_class 2

  • intrinsic 23
  • avidity_multivalent 2

tier 1

  • Gold · 25 ✖

target_type 1

  • protein 25

sequence_status 1

  • verified_in_text_or_SI · 25 ✖

binding_constant_type 1

  • Kd 25

assay_method 1

  • MST · 25 ✖
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
372 beta-conglutin protein   11-mer GGTGGGGGTGG 1.05e-09 M -8.979 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   MST 298.15   binding buffer with 0.05% v/v Tween-20   DNA   33498970 10.3390/ijms22031150 KD values determined (Figure 6b) are very similar (11-mer: 1.05 nM step2c_acs_v1
374 beta-conglutin protein   TT-11-mer TTGGTGGGGGTGG 1.88e-09 M -8.726 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   MST 298.15   binding buffer with 0.05% v/v Tween-20   DNA   33498970 10.3390/ijms22031150 KD values determined (Figure 6b) are very similar (... TT-11 mer: 1.88 nM step2c_acs_v1
376 beta-conglutin protein   11-mer-TT GGTGGGGGTGGTT 2.59e-09 M -8.587 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   MST 298.15   binding buffer with 0.05% v/v Tween-20   DNA   33498970 10.3390/ijms22031150 KD values determined (Figure 6b) are very similar (... and 11-mer-TT: 2.59 nM) step2c_acs_v1
375 beta-conglutin protein   TT-11-mer-TT TTGGTGGGGGTGGTT 2.71e-09 M -8.567 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   MST 298.15   binding buffer with 0.05% v/v Tween-20   DNA   33498970 10.3390/ijms22031150 KD values determined (Figure 6b) are very similar (... TT-11-mer-TT: 2.71 nM step2c_acs_v1
76 thrombin protein P00734 3G GGTTGGTGTGGTTGG 9.8 nM -8.009 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 3 with Guanosine side chain 33614235 10.1016/j.omtn.2021.01.004 3G | 52.9 | 9.8 ± 0.6 | 3.34 step2c_literal_v3
69 thrombin protein P00734 3Leu GGTTGGTGTGGTTGG 10.9 nM -7.963 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 3 with Leucine side chain 33614235 10.1016/j.omtn.2021.01.004 3Leu | 54.3 | 10.9 ± 0.2 | 4.15 step2c_literal_v3
77 thrombin protein P00734 3L GGTTGGTGTGGTTGG 11.6 nM -7.936 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 3 with Lactose side chain 33614235 10.1016/j.omtn.2021.01.004 3L | 51.5 | 11.6 ± 0.5 | 5.28 step2c_literal_v3
70 thrombin protein P00734 3Ser GGTTGGTGTGGTTGG 14.6 nM -7.836 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 3 with Serine side chain 33614235 10.1016/j.omtn.2021.01.004 3Ser | 51.7 | 14.6 ± 0.3 | 2.51 step2c_literal_v3
67 thrombin protein P00734 TBA GGTTGGTGTGGTTGG 20.2 nM -7.695 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA   33614235 10.1016/j.omtn.2021.01.004 TBA | 50.7 | 20.2 ± 1.3 | 4.81 step2c_literal_v3
84 thrombin protein P00734 12G GGTTGGTGTGGTTGG 20.7 nM -7.684 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 12 with Guanosine side chain 33614235 10.1016/j.omtn.2021.01.004 12G | 53.4 | 20.7 ± 2.8 | 2.88 step2c_literal_v3
68 thrombin protein P00734 3Ala GGTTGGTGTGGTTGG 21.4 nM -7.67 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 3 with Alanine side chain 33614235 10.1016/j.omtn.2021.01.004 3Ala | 50.9 | 21.4 ± 2.8 | 3.67 step2c_literal_v3
71 thrombin protein P00734 3Phe GGTTGGTGTGGTTGG 22.6 nM -7.646 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 3 with Phenylalanine side chain 33614235 10.1016/j.omtn.2021.01.004 3Phe | 54.3 | 22.6 ± 4.8 | 3.39 step2c_literal_v3
75 thrombin protein P00734 3Nic GGTTGGTGTGGTTGG 27.1 nM -7.567 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 3 with Nicotinamide side chain 33614235 10.1016/j.omtn.2021.01.004 3Nic | 52.1 | 27.1 ± 4.2 | 3.69 step2c_literal_v3
85 thrombin protein P00734 12L GGTTGGTGTGGTTGG 27.2 nM -7.565 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 12 with Lactose side chain 33614235 10.1016/j.omtn.2021.01.004 12L | 51.0 | 27.2 ± 3.0 | 4.17 step2c_literal_v3
72 thrombin protein P00734 3Amide GGTTGGTGTGGTTGG 29.2 nM -7.535 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 3 with Amide side chain 33614235 10.1016/j.omtn.2021.01.004 3Amide | 52.6 | 29.2 ± 0.4 | 4.17 step2c_literal_v3
73 thrombin protein P00734 3Bz GGTTGGTGTGGTTGG 30.0 nM -7.523 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 3 with Benzyl side chain 33614235 10.1016/j.omtn.2021.01.004 3Bz | 52.3 | 30.0 ± 6.6 | 4.54 step2c_literal_v3
83 thrombin protein P00734 12Amide GGTTGGTGTGGTTGG 30.6 nM -7.514 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 12 with Amide side chain 33614235 10.1016/j.omtn.2021.01.004 12Amide | 51.2 | 30.6 ± 6.1 | 3.97 step2c_literal_v3
434 Ara h1 protein P35354 CB-APT1 GTGCTCGGACTCCACTTGCGCTTCATTAACCGGGTTGCTCATTTATTCA 3.63e-08 M -7.44 avidity_multivalent Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   MST 298.15 7.2 1 × binding buffer   DNA   40083221 10.1021/acs.analchem.5c00270 Among them, CBAPT1 exhibited the strongest binding to Ara h1 with a K d value of 36.3 nM in aqueous solutions. step2c_acs_v1
435 Ara h1 protein P35354 CB-APT1 GTGCTCGGACTCCACTTGCGCTTCATTAACCGGGTTGCTCATTTATTCA 4.5000000000000006e-08 M -7.347 avidity_multivalent Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   MST 298.15 7.2 1 × binding buffer with 80% w/w total peanut proteins   DNA   40083221 10.1021/acs.analchem.5c00270 Notably, a similar binding affinity was observed even in a complex matrix that contained 80% w/w total peanut proteins ( K d = 45.0 nM, Figures 3 and S5). step2c_acs_v1
78 thrombin protein P00734 12Ala GGTTGGTGTGGTTGG 51.0 nM -7.292 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 12 with Alanine side chain 33614235 10.1016/j.omtn.2021.01.004 12Ala | 51.7 | 51.0 ± 3.8 | 2.74 step2c_literal_v3
79 thrombin protein P00734 12Trp GGTTGGTGTGGTTGG 67.3 nM -7.172 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 12 with Tryptophan side chain 33614235 10.1016/j.omtn.2021.01.004 12Trp | 54.7 | 67.3 ± 12.1 | 3.12 step2c_literal_v3
80 thrombin protein P00734 12Leu GGTTGGTGTGGTTGG 72.2 nM -7.141 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 12 with Leucine side chain 33614235 10.1016/j.omtn.2021.01.004 12Leu | 53.6 | 72.2 ± 0.9 | 4.14 step2c_literal_v3
81 thrombin protein P00734 12Ser GGTTGGTGTGGTTGG 86.6 nM -7.062 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 12 with Serine side chain 33614235 10.1016/j.omtn.2021.01.004 12Ser | 52.0 | 86.6 ± 4.5 | 2.34 step2c_literal_v3
82 thrombin protein P00734 12Phe GGTTGGTGTGGTTGG 99.1 nM -7.004 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 12 with Phenylalanine side chain 33614235 10.1016/j.omtn.2021.01.004 12Phe | 54.3 | 99.1 ± 6.3 | 4.07 step2c_literal_v3
74 thrombin protein P00734 3NB GGTTGGTGTGGTTGG 163.5 nM -6.786 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   MST   7.4 10 mM Tris HCl, 100 mM potassium phosphate (pH 7.4), 0.5% Tween 20   DNA N3-modified T at position 3 with Nitrobenzyl side chain 33614235 10.1016/j.omtn.2021.01.004 3NB | 51.7 | 163.5 ± 3.5 | 3.82 step2c_literal_v3

Advanced export

JSON shape: default, array, newline-delimited

CSV options:

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';
Powered by Datasette · Queries took 5366.764ms · Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target