home / scout

Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

80 rows where assay_method = "SPR" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: target_uniprot, aptamer_seq, seq_source, assay_temperature_k, assay_ph, assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications, source_pmid, doi, source_db

sequence_status 5

  • verified_in_text_or_SI 54
  • pending_manual_supp 12
  • pending_manual_figure 7
  • pending_supp_oa 5
  • no_single_sequence_pool 2

target_type 3

  • protein 67
  • glycan/conjugate 12
  • cell/EV 1

verification_level 2

  • extraction_verified 66
  • multi_agent_verified 14

measurement_class 2

  • intrinsic 58
  • non_intrinsic 22

binding_constant_type 2

  • Kd 78
  • KD 2

tier 1

  • Gold 80

assay_method 1

  • SPR · 80 ✖
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
44 IL-8 protein P10145 8A-35 GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC 1.72e-12 M -11.764 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.0 7.4 HBST running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, and 0.005% Tween 20)   2'F-RNA 2'-fluoro-pyrimidine modified 24129312 10.1016/j.biomaterials.2013.09.107 | 8A-35 | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80 | 3.11 x 10 1 | step2c_literal_v3
140 PDGF-C protein P01127 α-PC CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC 20.0 pM -10.699 intrinsic KD Gold v4 extraction_verified verified_in_text_or_SI original   SPR   7.4 HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4)   DNA PEG 42138517 10.1167/iovs.67.5.36 SPR analysis demonstrated that the α -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM step2c_literal_v3
9 sLe X -BSA glycan/conjugate Q9NSU2 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 5.7e-11 M -10.244 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR 298.15 7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11 step2c_literal_v3
56 von Willebrand factor A1-domain protein P04275 Rn-DsDsDs-53mh   61.3 pM -10.213 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR 310.15   1 × PBS supplemented with 0.05% (w/v) Nonidet P-40   DNA Ds (7-(2-thienyl)imidazo[4,5b]pyridine); mini-hairpin DNA 27966933 10.1021/jacs.6b10767 RnDsDsDs-53mh ( K D = 61.3 pM) step2c_literal_v3
53 von Willebrand factor A1-domain protein P04275 Rn-DsDsDs-44   74.9 pM -10.126 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR 310.15   1 × PBS supplemented with 0.05% (w/v) Nonidet P-40   DNA Ds (7-(2-thienyl)imidazo[4,5b]pyridine) 27966933 10.1021/jacs.6b10767 Rn-DsDsDs-44 ( K D = 74.9 pM) exhibited the highest a ffi nity step2c_literal_v3
3 sLe X -BSA glycan/conjugate Q9NSU2 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 8.5e-11 M -10.071 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR 298.15 7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11 step2c_literal_v3
57 von Willebrand factor A1-domain protein P04275 Rn-DsDs-51mh2   182.0 pM -9.74 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR 310.15   1 × PBS supplemented with 0.05% (w/v) Nonidet P-40   DNA Ds (7-(2-thienyl)imidazo[4,5b]pyridine); mini-hairpin DNA 27966933 10.1021/jacs.6b10767 Rn-DsDs-51mh2 ( K D = 182 pM) step2c_literal_v3
55 von Willebrand factor A1-domain protein P04275 ARC1172-41   326.0 pM -9.487 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR 310.15   1 × PBS supplemented with 0.05% (w/v) Nonidet P-40   DNA   27966933 10.1021/jacs.6b10767 ARC1172-41 ( K D = 326 pM) step2c_literal_v3
478 FLRPp (O serotype) protein   FMD_1   3.46e-10 M -9.461 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     SPR         DNA   42010751 10.1021/acs.analchem.5c04748 dissociation constants ( KD ) of 3.46 × 10 -10 M step2c_acs_v1
247 Human thrombin protein P00734 Lin08-08   0.4 nM -9.398 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa   KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Lin(08-08) | 1.63 10^6 | 6.94 10^-4 | 0.4 step2c_literal_v3
249 Human thrombin protein P00734 Pse08-08   0.4 nM -9.398 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa   KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Pse(08-08) | 1.19 10^6 | 5.10 10^-4 | 0.4 step2c_literal_v3
2 sLe X -BSA glycan/conjugate Q9NSU2 Selected pool   5.8e-10 M -9.237 intrinsic Kd Gold v4 extraction_verified no_single_sequence_pool   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Selected pool | 2.4 3 10 5 | 1.4 3 10 2 3 | 1.7 3 10 9 | 5.8 3 10 2 10 step2c_literal_v3
154 thrombin protein P00734 HD1-22 GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT 6.5e-10 M -9.187 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR         DNA bivalent fusion; poly-dA linker 18826387 10.1111/j.1538-7836.2008.03162.x HD1-22 | Thrombin | K D ( M) | 6.5 · 10 ) 10 step2c_literal_v3
4 sLe X -BSA glycan/conjugate Q9NSU2 Clone 2   8e-10 M -9.097 intrinsic Kd Gold v4 extraction_verified pending_manual_figure   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 2 | 9.8 3 10 5 | 7.3 3 10 2 5 | 1.2 3 10 9 | 8.0 3 10 2 10 step2c_literal_v3
54 von Willebrand factor A1-domain protein P04275 Pr-DsDsDs-40   1.03 nM -8.987 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR 310.15   1 × PBS supplemented with 0.05% (w/v) Nonidet P-40   DNA Ds (7-(2-thienyl)imidazo[4,5b]pyridine) 27966933 10.1021/jacs.6b10767 Pr-DsDsDs-40 ( K D = 1.03 nM) step2c_literal_v3
39 prothrombin protein P00734 RNAR9D-14T GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC 1.4 nM -8.854 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15 7.4 Hepes-saline buffer   2'F-RNA 2' Fluorocytosine; 2' Fluorouracil 22385910 10.1111/j.1538-7836.2012.04679.x Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM step2c_literal_v3
108 thrombin protein P00734 T.7   1.5 nM -8.824 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR     binding buffer supplemented with 0.05% of Tween-20   DNA   37798416 10.1038/s41587-023-01973-8 T.7 exhibited the strongest binding signal with a 1.5 nM K d step2c_literal_v3
337 human α-thrombin protein P00734 LOOPER modified thrombin aptamer   1.6000000000000003e-09 M -8.796 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     SPR         DNA diversely functionalized; heteromultivalent 28938065 10.1021/jacs.7b07241 Using single-cycle kinetics surface plasmon resonance (SPR), the LOOPER aptamer exhibited a Kd of 1.6 nM step2c_acs_v1
5 sLe X -BSA glycan/conjugate Q9NSU2 Clone 15   2.3e-09 M -8.638 intrinsic Kd Gold v4 extraction_verified pending_manual_figure   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 15 | 3.5 3 10 5 | 8.1 3 10 2 4 | 4.3 3 10 8 | 2.3 3 10 2 9 step2c_literal_v3
30 thrombin protein P00734 HD22 AGTCCGTGGTAGGGCAGGTTGGGGTGACT 2.4e-09 M -8.62 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR         DNA   18826387 10.1111/j.1538-7836.2008.03162.x HD22 | Thrombin | K D ( M) | 2.4 · 10 ) 9 step2c_literal_v3
251 Human thrombin protein P00734 Pse08-29 TGACCTCTAGTGACTGATTTACGAGTC 2.6 nM -8.585 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Pse(08 - 29) | 1.33 10^6 | 3.47 10^-3 | 2.6 step2c_literal_v3
16 thrombin protein P00734 TBA GGTTGGTGTGGTTGG 2.86e-09 M -8.544 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR         DNA biotin at 3' end; six-carbon spacer 16053288 10.1021/ac0502450 thrombin | 2.2 10 5 | 6.3 10 - 4 | 3.4 10 8 | 2.86 10 - 9 step2c_literal_v3
11 sLe X glycan/conjugate Q9NSU2 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 3.3e-09 M -8.481 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 sLe X | 1.7 3 10 5 | 5.5 3 10 2 4 | 3.0 3 10 8 | 3.3 3 10 2 9 step2c_literal_v3
156 prothrombin protein P00734 HD1 GGTTGGTGTGGTTGG 3.5e-09 M -8.456 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR         DNA   18826387 10.1111/j.1538-7836.2008.03162.x HD1 | Prothrombin+ phospholipids | K D ( M) | 3.5 · 10 ) 9 step2c_literal_v3
6 sLe X -BSA glycan/conjugate Q9NSU2 Clone 18   3.9e-09 M -8.409 intrinsic Kd Gold v4 extraction_verified pending_manual_figure   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 18 | 5.1 3 10 5 | 2.0 3 10 2 3 | 2.5 3 10 8 | 3.9 3 10 2 9 step2c_literal_v3
250 Mouse thrombin protein   Pse08-08   4.2 nM -8.377 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa   KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Pse(08-08) | 7.35 10^5 | 3.06 10^-3 | 4.2 step2c_literal_v3
320 VEGF165 protein P15692 VEap121 TGTGGGGGTGGACGGGCCGGGTAGA 4.700000000000001e-09 M -8.328 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   SPR 293.15 7.4 Tris-buffered saline (TBS: 10 mM Tris-HCl, 100 mM NaCl, 5 mM KCl, pH 7.4)   DNA   23237717 10.1021/ac303023d As the calculated K d value of VEap121 was 4.7 nM step2c_acs_v1
252 Mouse thrombin protein   Pse08-29 TGACCTCTAGTGACTGATTTACGAGTC 6.3 nM -8.201 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Pse(08 - 29) | 6.72 10^5 | 4.26 10^-3 | 6.3 step2c_literal_v3
248 Mouse thrombin protein   Lin08-08   6.7 nM -8.174 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa   KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Lin(08-08) | 6.41 10^5 | 4.30 10^-3 | 6.7 step2c_literal_v3
28 thrombin protein P00734 HD1 GGTTGGTGTGGTTGG 7.1e-09 M -8.149 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR         DNA   18826387 10.1111/j.1538-7836.2008.03162.x HD1 | Thrombin | K D ( M) | 7.1 · 10 ) 9 step2c_literal_v3
139 PTK7 protein Q13308 4AsF   7.2 nM -8.143 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR 310.15 7.4 1 × DPBS 5.0 DNA SF at positions A23, A24, A25, A26 41065179 10.1021/jacs.5c11823 4AsF, which exhibited a 10-fold reduction compared to 4APS (0.77 vs 7.20 nM) step2c_literal_v3
7 sLe X -BSA glycan/conjugate Q9NSU2 Clone 4   7.4e-09 M -8.131 intrinsic Kd Gold v4 extraction_verified pending_manual_figure   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 4 | 4.1 3 10 5 | 3.1 3 10 2 3 | 1.3 3 10 8 | 7.4 3 10 2 9 step2c_literal_v3
194 α-thrombin protein P00734 TBA-iT7 GGTTGGTGTGGTTGG 9.9 nM -8.004 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15   100 mM KCl   DNA 3'-inverted thymidine at position 7 30735210 10.1039/c9ob00053d TBA-iT7 | 9.9 step2c_literal_v3
8 sLe X -BSA glycan/conjugate Q9NSU2 Clone 9   1e-08 M -8.0 intrinsic Kd Gold v4 extraction_verified pending_manual_figure   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 9 | 3.5 3 10 5 | 3.1 3 10 2 3 | 9.5 3 10 7 | 1.0 3 10 2 8 step2c_literal_v3
17 thrombin-HRP protein   TBA GGTTGGTGTGGTTGG 1.13e-08 M -7.947 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR         DNA biotin at 3' end; six-carbon spacer 16053288 10.1021/ac0502450 thrombin-HRP | 6.7 10 4 | 7.6 10 - 4 | 8.7 10 7 | 1.13 10 - 8 step2c_literal_v3
198 α-thrombin protein P00734 TBA-iT9 GGTTGGTGTGGTTGG 11.5 nM -7.939 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15   100 mM KCl   DNA 3'-inverted thymidine at position 9 30735210 10.1039/c9ob00053d TBA-iT9 | 11.5 step2c_literal_v3
196 α-thrombin protein P00734 TBA-G8-iT8 GGTTGGTTTGGTTGG 12.4 nM -7.907 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15   100 mM KCl   DNA 3'-inverted thymidine at position 8 30735210 10.1039/c9ob00053d TBA-G8-iT8 | 12.4 step2c_literal_v3
14 Le A protein P00488 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 1.4e-08 M -7.854 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Le A | 7.3 3 10 2 | 1.0 3 10 2 5 | 7.2 3 10 7 | 1.4 3 10 2 8 step2c_literal_v3
193 α-thrombin protein P00734 TBA-iT7 GGTTGGTGTGGTTGG 15.9 nM -7.799 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15 7.4 138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20   DNA 3'-inverted thymidine at position 7 30735210 10.1039/c9ob00053d TBA-iT7 | 15.9 step2c_literal_v3
12 sLe A glycan/conjugate P0C0L4 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 1.7e-08 M -7.77 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 sLe A | 1.2 3 10 3 | 1.9 3 10 2 5 | 5.9 3 10 7 | 1.7 3 10 2 8 step2c_literal_v3
314 hMMP-9 protein   F3Bomf   2e-08 M -7.699 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     SPR 296.15   PBS buffer   2'-OMe-RNA 2'-O-methyl purine; 2'-fluoro pyrimidine; 5'-hexylamino linker; 5'-MAG3 conjugate 23043415 10.1021/bc300146c The K d was taken as the concentration leading to half saturation, i.e., about 20 nM. step2c_acs_v1
107 Mouse thrombin protein   TBA29 TGACCCTAGTGACTGATTTACGAGGTC 22.0 nM -7.658 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 TBA29 | 2.76 10^5 | 6.07 10^-3 | 22.0 step2c_literal_v3
13 Le X protein O15496 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 2.4e-08 M -7.62 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Le X | 6.7 3 10 2 | 1.6 3 10 2 5 | 4.1 3 10 7 | 2.4 3 10 2 8 step2c_literal_v3
302 prostate-cancer-derived small extracellular vesicles cell/EV Q99523 seq25   24.02 nM -7.619 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa     SPR     PBST buffer   DNA 5'-FAM 41646885 10.1016/j.omtn.2026.102836 The affinity of seq25 for positive selection was significantly higher than that of the other aptamers, with a KD of 24.02 nM step2c_literal_v3
189 α-thrombin protein P00734 TBA GGTTGGTGTGGTTGG 27.2 nM -7.565 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15 7.4 138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20   DNA   30735210 10.1039/c9ob00053d TBA | 27.2 step2c_literal_v3
352 FGFR3 K650E protein   SU-3 CAGAGGCTGACGTAAACAGACATTGATGGGACCCACCCTTCCGCTGGCAA 2.82e-08 M -7.55 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   SPR     1 × PBS   DNA   31265241 10.1021/acscombsci.9b00059 The predicted K D was 28.2 × 10 -9 ± 19.6 × 10 -9 M( n = 5) in 1 × PBS bu ff er, using 1:1 Langmuir binding model. step2c_acs_v1
365 Thrombin protein P00734 aptamer 2S TATGGTTGGTGTGGTTGGATA 2.9400000000000002e-08 M -7.532 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   SPR   7.6 PBS buffer (pH 7.6) containing 138 mM NaCl and 2.7 mM KCl   DNA   32268723 10.1021/acs.analchem.0c00380 The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 μM and 29.4 nM, respectively step2c_acs_v1
141 PDGF-C protein P01127 α-PC CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC 33.0 nM -7.481 intrinsic KD Gold v4 extraction_verified verified_in_text_or_SI original   SPR   7.4 HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4)   DNA   42138517 10.1167/iovs.67.5.36 SPR analysis demonstrated that the α -PC aptamer bound tightly to mouse PDGF-C with a high affinity ( KD = 33 nM step2c_literal_v3
192 α-thrombin protein P00734 TBA-iT3 GGTTGGTGTGGTTGG 33.9 nM -7.47 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15   100 mM KCl   DNA 3'-inverted thymidine at position 3 30735210 10.1039/c9ob00053d TBA-iT3 | 33.9 step2c_literal_v3
106 Human thrombin protein P00734 TBA29 TGACCCTAGTGACTGATTTACGAGGTC 36.9 nM -7.433 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 TBA29 | 1.34 10^5 | 4.94 10^-3 | 36.9 step2c_literal_v3

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options:

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';
Powered by Datasette · Queries took 45.364ms · Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target