Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

22 rows where assay_method = "SPR", measurement_class = "non_intrinsic" and verification_level = "extraction_verified" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: target_name_canonical, target_uniprot, aptamer_name, aptamer_seq, kd_reported, kd_log10_molar, seq_source, assay_buffer, aptamer_modifications, source_pmid, doi

target_type 2

sequence_status 2

verification_level 1

  • extraction_verified · 22 ✖

tier 1

measurement_class 1

  • non_intrinsic · 22 ✖

binding_constant_type 1

assay_method 1

  • SPR · 22 ✖
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
247 Human thrombin protein P00734 Lin08-08   0.4 nM -9.398 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa   KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Lin(08-08) | 1.63 10^6 | 6.94 10^-4 | 0.4 step2c_literal_v3
249 Human thrombin protein P00734 Pse08-08   0.4 nM -9.398 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa   KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Pse(08-08) | 1.19 10^6 | 5.10 10^-4 | 0.4 step2c_literal_v3
154 thrombin protein P00734 HD1-22 GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT 6.5e-10 M -9.187 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR         DNA bivalent fusion; poly-dA linker 18826387 10.1111/j.1538-7836.2008.03162.x HD1-22 | Thrombin | K D ( M) | 6.5 · 10 ) 10 step2c_literal_v3
251 Human thrombin protein P00734 Pse08-29 TGACCTCTAGTGACTGATTTACGAGTC 2.6 nM -8.585 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Pse(08 - 29) | 1.33 10^6 | 3.47 10^-3 | 2.6 step2c_literal_v3
156 prothrombin protein P00734 HD1 GGTTGGTGTGGTTGG 3.5e-09 M -8.456 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR         DNA   18826387 10.1111/j.1538-7836.2008.03162.x HD1 | Prothrombin+ phospholipids | K D ( M) | 3.5 · 10 ) 9 step2c_literal_v3
250 Mouse thrombin protein   Pse08-08   4.2 nM -8.377 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa   KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Pse(08-08) | 7.35 10^5 | 3.06 10^-3 | 4.2 step2c_literal_v3
252 Mouse thrombin protein   Pse08-29 TGACCTCTAGTGACTGATTTACGAGTC 6.3 nM -8.201 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Pse(08 - 29) | 6.72 10^5 | 4.26 10^-3 | 6.3 step2c_literal_v3
248 Mouse thrombin protein   Lin08-08   6.7 nM -8.174 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa   KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Lin(08-08) | 6.41 10^5 | 4.30 10^-3 | 6.7 step2c_literal_v3
194 α-thrombin protein P00734 TBA-iT7 GGTTGGTGTGGTTGG 9.9 nM -8.004 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15   100 mM KCl   DNA 3'-inverted thymidine at position 7 30735210 10.1039/c9ob00053d TBA-iT7 | 9.9 step2c_literal_v3
198 α-thrombin protein P00734 TBA-iT9 GGTTGGTGTGGTTGG 11.5 nM -7.939 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15   100 mM KCl   DNA 3'-inverted thymidine at position 9 30735210 10.1039/c9ob00053d TBA-iT9 | 11.5 step2c_literal_v3
196 α-thrombin protein P00734 TBA-G8-iT8 GGTTGGTTTGGTTGG 12.4 nM -7.907 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15   100 mM KCl   DNA 3'-inverted thymidine at position 8 30735210 10.1039/c9ob00053d TBA-G8-iT8 | 12.4 step2c_literal_v3
193 α-thrombin protein P00734 TBA-iT7 GGTTGGTGTGGTTGG 15.9 nM -7.799 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15 7.4 138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20   DNA 3'-inverted thymidine at position 7 30735210 10.1039/c9ob00053d TBA-iT7 | 15.9 step2c_literal_v3
302 prostate-cancer-derived small extracellular vesicles cell/EV Q99523 seq25   24.02 nM -7.619 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa     SPR     PBST buffer   DNA 5'-FAM 41646885 10.1016/j.omtn.2026.102836 The affinity of seq25 for positive selection was significantly higher than that of the other aptamers, with a KD of 24.02 nM step2c_literal_v3
189 α-thrombin protein P00734 TBA GGTTGGTGTGGTTGG 27.2 nM -7.565 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15 7.4 138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20   DNA   30735210 10.1039/c9ob00053d TBA | 27.2 step2c_literal_v3
192 α-thrombin protein P00734 TBA-iT3 GGTTGGTGTGGTTGG 33.9 nM -7.47 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15   100 mM KCl   DNA 3'-inverted thymidine at position 3 30735210 10.1039/c9ob00053d TBA-iT3 | 33.9 step2c_literal_v3
200 α-thrombin protein P00734 TBA-iT12 GGTTGGTGTGGTTGG 37.0 nM -7.432 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15   100 mM KCl   DNA 3'-inverted thymidine at position 12 30735210 10.1039/c9ob00053d TBA-iT12 | 37.0 step2c_literal_v3
195 α-thrombin protein P00734 TBA-G8-iT8 GGTTGGTTTGGTTGG 37.1 nM -7.431 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15 7.4 138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20   DNA 3'-inverted thymidine at position 8 30735210 10.1039/c9ob00053d TBA-G8-iT8 | 37.1 step2c_literal_v3
197 α-thrombin protein P00734 TBA-iT9 GGTTGGTGTGGTTGG 41.0 nM -7.387 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15 7.4 138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20   DNA 3'-inverted thymidine at position 9 30735210 10.1039/c9ob00053d TBA-iT9 | 41.0 step2c_literal_v3
190 α-thrombin protein P00734 TBA GGTTGGTGTGGTTGG 42.7 nM -7.37 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15   100 mM KCl   DNA   30735210 10.1039/c9ob00053d TBA | 42.7 step2c_literal_v3
199 α-thrombin protein P00734 TBA-iT12 GGTTGGTGTGGTTGG 46.8 nM -7.33 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15 7.4 138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20   DNA 3'-inverted thymidine at position 12 30735210 10.1039/c9ob00053d TBA-iT12 | 46.8 step2c_literal_v3
191 α-thrombin protein P00734 TBA-iT3 GGTTGGTGTGGTTGG 57.3 nM -7.242 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15 7.4 138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20   DNA 3'-inverted thymidine at position 3 30735210 10.1039/c9ob00053d TBA-iT3 | 57.3 step2c_literal_v3
155 prothrombin protein P00734 HD1-22 GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT 6.7e-08 M -7.174 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR         DNA bivalent fusion; poly-dA linker 18826387 10.1111/j.1538-7836.2008.03162.x HD1-22 | Prothrombin+ phospholipids | K D ( M) | 6.7 · 10 ) 8 step2c_literal_v3

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';