Binding affinities (Kd) — source-verified (view)
Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target
- target_name_canonical
- Target as named in the source paper.
- target_type
- protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
- target_uniprot
- UniProt accession when a human protein (sparse for now; links to apt-scout target).
- aptamer_name
- Aptamer identifier as reported.
- kd_reported
- Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
- kd_log10_molar
- log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
- measurement_class
- intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
- binding_constant_type
- Kd / apparent-Kd etc. as reported.
- assay_method
- SPR / filter binding / flow cytometry / ITC / BLI …
- assay_temperature_k
- Assay temperature (K) — a reason the same pair can have several rows.
- source_pmid
- PubMed ID of the source paper (links out).
- verbatim_quote
- The exact sentence the value was taken from.
- verification_level
- QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
- sequence_status
- Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
- pi_provenance_flag
- PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
- seq_source
- original (already in source DB) / backfill_text_verified (recovered from paper or SI text).
54 rows where assay_method = "SPR", sequence_status = "verified_in_text_or_SI" and tier = "Gold" sorted by kd_log10_molar
This data as json, CSV (advanced)
Suggested facets: target_name_canonical, target_uniprot, aptamer_name, aptamer_seq, seq_source, assay_temperature_k, assay_ph, assay_buffer, aptamer_chemistry, aptamer_modifications, source_pmid, doi, source_db
verification_level 2
target_type 2
- protein 49
- glycan/conjugate 5
measurement_class 2
- intrinsic 37
- non_intrinsic 17
tier 1
- Gold · 54 ✖
sequence_status 1
- verified_in_text_or_SI · 54 ✖
assay_method 1
- SPR · 54 ✖
| id | target_name_canonical | target_type | target_uniprot | aptamer_name | aptamer_seq | kd_reported | kd_log10_molar ▼ | measurement_class | binding_constant_type | tier | source_origin | verification_level | sequence_status | seq_source | pi_provenance_flag | assay_method | assay_temperature_k | assay_ph | assay_buffer | assay_cations | aptamer_chemistry | aptamer_modifications | source_pmid | doi | verbatim_quote | source_db |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 44 | IL-8 | protein | P10145 | 8A-35 | GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC | 1.72e-12 M | -11.764 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.0 | 7.4 | HBST running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, and 0.005% Tween 20) | 2'F-RNA | 2'-fluoro-pyrimidine modified | 24129312 | 10.1016/j.biomaterials.2013.09.107 | | 8A-35 | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80 | 3.11 x 10 1 | | step2c_literal_v3 | ||
| 140 | PDGF-C | protein | P01127 | α-PC | CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC | 20.0 pM | -10.699 | intrinsic | KD | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 7.4 | HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4) | DNA | PEG | 42138517 | 10.1167/iovs.67.5.36 | SPR analysis demonstrated that the α -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM | step2c_literal_v3 | |||
| 9 | sLe X -BSA | glycan/conjugate | Q9NSU2 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 5.7e-11 M | -10.244 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 298.15 | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11 | step2c_literal_v3 | |
| 3 | sLe X -BSA | glycan/conjugate | Q9NSU2 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 8.5e-11 M | -10.071 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 298.15 | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11 | step2c_literal_v3 | |
| 154 | thrombin | protein | P00734 | HD1-22 | GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT | 6.5e-10 M | -9.187 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | DNA | bivalent fusion; poly-dA linker | 18826387 | 10.1111/j.1538-7836.2008.03162.x | HD1-22 | Thrombin | K D ( M) | 6.5 · 10 ) 10 | step2c_literal_v3 | |||||
| 39 | prothrombin | protein | P00734 | RNAR9D-14T | GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC | 1.4 nM | -8.854 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | Hepes-saline buffer | 2'F-RNA | 2' Fluorocytosine; 2' Fluorouracil | 22385910 | 10.1111/j.1538-7836.2012.04679.x | Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM | step2c_literal_v3 | ||
| 30 | thrombin | protein | P00734 | HD22 | AGTCCGTGGTAGGGCAGGTTGGGGTGACT | 2.4e-09 M | -8.62 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | DNA | 18826387 | 10.1111/j.1538-7836.2008.03162.x | HD22 | Thrombin | K D ( M) | 2.4 · 10 ) 9 | step2c_literal_v3 | ||||||
| 251 | Human thrombin | protein | P00734 | Pse08-29 | TGACCTCTAGTGACTGATTTACGAGTC | 2.6 nM | -8.585 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | KEEP_seq_in_figure | SPR | 7.4 | PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20 | DNA | 37621412 | 10.1016/j.omtn.2023.07.038 | Pse(08 - 29) | 1.33 10^6 | 3.47 10^-3 | 2.6 | step2c_literal_v3 | |||
| 16 | thrombin | protein | P00734 | TBA | GGTTGGTGTGGTTGG | 2.86e-09 M | -8.544 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | DNA | biotin at 3' end; six-carbon spacer | 16053288 | 10.1021/ac0502450 | thrombin | 2.2 10 5 | 6.3 10 - 4 | 3.4 10 8 | 2.86 10 - 9 | step2c_literal_v3 | |||||
| 11 | sLe X | glycan/conjugate | Q9NSU2 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 3.3e-09 M | -8.481 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | sLe X | 1.7 3 10 5 | 5.5 3 10 2 4 | 3.0 3 10 8 | 3.3 3 10 2 9 | step2c_literal_v3 | ||
| 156 | prothrombin | protein | P00734 | HD1 | GGTTGGTGTGGTTGG | 3.5e-09 M | -8.456 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | DNA | 18826387 | 10.1111/j.1538-7836.2008.03162.x | HD1 | Prothrombin+ phospholipids | K D ( M) | 3.5 · 10 ) 9 | step2c_literal_v3 | ||||||
| 320 | VEGF165 | protein | P15692 | VEap121 | TGTGGGGGTGGACGGGCCGGGTAGA | 4.700000000000001e-09 M | -8.328 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | 293.15 | 7.4 | Tris-buffered saline (TBS: 10 mM Tris-HCl, 100 mM NaCl, 5 mM KCl, pH 7.4) | DNA | 23237717 | 10.1021/ac303023d | As the calculated K d value of VEap121 was 4.7 nM | step2c_acs_v1 | |||
| 252 | Mouse thrombin | protein | Pse08-29 | TGACCTCTAGTGACTGATTTACGAGTC | 6.3 nM | -8.201 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | KEEP_seq_in_figure | SPR | 7.4 | PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20 | DNA | 37621412 | 10.1016/j.omtn.2023.07.038 | Pse(08 - 29) | 6.72 10^5 | 4.26 10^-3 | 6.3 | step2c_literal_v3 | ||||
| 28 | thrombin | protein | P00734 | HD1 | GGTTGGTGTGGTTGG | 7.1e-09 M | -8.149 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | DNA | 18826387 | 10.1111/j.1538-7836.2008.03162.x | HD1 | Thrombin | K D ( M) | 7.1 · 10 ) 9 | step2c_literal_v3 | ||||||
| 194 | α-thrombin | protein | P00734 | TBA-iT7 | GGTTGGTGTGGTTGG | 9.9 nM | -8.004 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 100 mM KCl | DNA | 3'-inverted thymidine at position 7 | 30735210 | 10.1039/c9ob00053d | TBA-iT7 | 9.9 | step2c_literal_v3 | |||
| 17 | thrombin-HRP | protein | TBA | GGTTGGTGTGGTTGG | 1.13e-08 M | -7.947 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | DNA | biotin at 3' end; six-carbon spacer | 16053288 | 10.1021/ac0502450 | thrombin-HRP | 6.7 10 4 | 7.6 10 - 4 | 8.7 10 7 | 1.13 10 - 8 | step2c_literal_v3 | ||||||
| 198 | α-thrombin | protein | P00734 | TBA-iT9 | GGTTGGTGTGGTTGG | 11.5 nM | -7.939 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 100 mM KCl | DNA | 3'-inverted thymidine at position 9 | 30735210 | 10.1039/c9ob00053d | TBA-iT9 | 11.5 | step2c_literal_v3 | |||
| 196 | α-thrombin | protein | P00734 | TBA-G8-iT8 | GGTTGGTTTGGTTGG | 12.4 nM | -7.907 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 100 mM KCl | DNA | 3'-inverted thymidine at position 8 | 30735210 | 10.1039/c9ob00053d | TBA-G8-iT8 | 12.4 | step2c_literal_v3 | |||
| 14 | Le A | protein | P00488 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 1.4e-08 M | -7.854 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | Le A | 7.3 3 10 2 | 1.0 3 10 2 5 | 7.2 3 10 7 | 1.4 3 10 2 8 | step2c_literal_v3 | ||
| 193 | α-thrombin | protein | P00734 | TBA-iT7 | GGTTGGTGTGGTTGG | 15.9 nM | -7.799 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | 138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20 | DNA | 3'-inverted thymidine at position 7 | 30735210 | 10.1039/c9ob00053d | TBA-iT7 | 15.9 | step2c_literal_v3 | ||
| 12 | sLe A | glycan/conjugate | P0C0L4 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 1.7e-08 M | -7.77 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | sLe A | 1.2 3 10 3 | 1.9 3 10 2 5 | 5.9 3 10 7 | 1.7 3 10 2 8 | step2c_literal_v3 | ||
| 107 | Mouse thrombin | protein | TBA29 | TGACCCTAGTGACTGATTTACGAGGTC | 22.0 nM | -7.658 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | KEEP_seq_in_figure | SPR | 7.4 | PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20 | DNA | 37621412 | 10.1016/j.omtn.2023.07.038 | TBA29 | 2.76 10^5 | 6.07 10^-3 | 22.0 | step2c_literal_v3 | ||||
| 13 | Le X | protein | O15496 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 2.4e-08 M | -7.62 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | Le X | 6.7 3 10 2 | 1.6 3 10 2 5 | 4.1 3 10 7 | 2.4 3 10 2 8 | step2c_literal_v3 | ||
| 189 | α-thrombin | protein | P00734 | TBA | GGTTGGTGTGGTTGG | 27.2 nM | -7.565 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | 138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20 | DNA | 30735210 | 10.1039/c9ob00053d | TBA | 27.2 | step2c_literal_v3 | |||
| 352 | FGFR3 K650E | protein | SU-3 | CAGAGGCTGACGTAAACAGACATTGATGGGACCCACCCTTCCGCTGGCAA | 2.82e-08 M | -7.55 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | 1 × PBS | DNA | 31265241 | 10.1021/acscombsci.9b00059 | The predicted K D was 28.2 × 10 -9 ± 19.6 × 10 -9 M( n = 5) in 1 × PBS bu ff er, using 1:1 Langmuir binding model. | step2c_acs_v1 | ||||||
| 365 | Thrombin | protein | P00734 | aptamer 2S | TATGGTTGGTGTGGTTGGATA | 2.9400000000000002e-08 M | -7.532 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | 7.6 | PBS buffer (pH 7.6) containing 138 mM NaCl and 2.7 mM KCl | DNA | 32268723 | 10.1021/acs.analchem.0c00380 | The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 μM and 29.4 nM, respectively | step2c_acs_v1 | ||||
| 141 | PDGF-C | protein | P01127 | α-PC | CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC | 33.0 nM | -7.481 | intrinsic | KD | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 7.4 | HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4) | DNA | 42138517 | 10.1167/iovs.67.5.36 | SPR analysis demonstrated that the α -PC aptamer bound tightly to mouse PDGF-C with a high affinity ( KD = 33 nM | step2c_literal_v3 | ||||
| 192 | α-thrombin | protein | P00734 | TBA-iT3 | GGTTGGTGTGGTTGG | 33.9 nM | -7.47 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 100 mM KCl | DNA | 3'-inverted thymidine at position 3 | 30735210 | 10.1039/c9ob00053d | TBA-iT3 | 33.9 | step2c_literal_v3 | |||
| 106 | Human thrombin | protein | P00734 | TBA29 | TGACCCTAGTGACTGATTTACGAGGTC | 36.9 nM | -7.433 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | KEEP_seq_in_figure | SPR | 7.4 | PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20 | DNA | 37621412 | 10.1016/j.omtn.2023.07.038 | TBA29 | 1.34 10^5 | 4.94 10^-3 | 36.9 | step2c_literal_v3 | |||
| 200 | α-thrombin | protein | P00734 | TBA-iT12 | GGTTGGTGTGGTTGG | 37.0 nM | -7.432 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 100 mM KCl | DNA | 3'-inverted thymidine at position 12 | 30735210 | 10.1039/c9ob00053d | TBA-iT12 | 37.0 | step2c_literal_v3 | |||
| 195 | α-thrombin | protein | P00734 | TBA-G8-iT8 | GGTTGGTTTGGTTGG | 37.1 nM | -7.431 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | 138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20 | DNA | 3'-inverted thymidine at position 8 | 30735210 | 10.1039/c9ob00053d | TBA-G8-iT8 | 37.1 | step2c_literal_v3 | ||
| 112 | rmCD3 d ε -Fc | protein | CD3_Apt5 | CCTTGCCTGCTTTCACGTGTGATCCCTGCCCGT | 37.9 nM | -7.421 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | PBS and 0.005% (v/v) Tween 20, pH 7.4 | 2'F-RNA | 2' Fluoropyrimidines | 38745854 | 10.1016/j.omtn.2024.102198 | aptamer 5 was the strongest binder (37.9 nM) | step2c_literal_v3 | |||
| 197 | α-thrombin | protein | P00734 | TBA-iT9 | GGTTGGTGTGGTTGG | 41.0 nM | -7.387 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | 138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20 | DNA | 3'-inverted thymidine at position 9 | 30735210 | 10.1039/c9ob00053d | TBA-iT9 | 41.0 | step2c_literal_v3 | ||
| 190 | α-thrombin | protein | P00734 | TBA | GGTTGGTGTGGTTGG | 42.7 nM | -7.37 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 100 mM KCl | DNA | 30735210 | 10.1039/c9ob00053d | TBA | 42.7 | step2c_literal_v3 | ||||
| 199 | α-thrombin | protein | P00734 | TBA-iT12 | GGTTGGTGTGGTTGG | 46.8 nM | -7.33 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | 138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20 | DNA | 3'-inverted thymidine at position 12 | 30735210 | 10.1039/c9ob00053d | TBA-iT12 | 46.8 | step2c_literal_v3 | ||
| 104 | Human thrombin | protein | P00734 | M08s | ACTGGAGATCACTGACTAAATGCTCCAG | 47.2 nM | -7.326 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | KEEP_seq_in_figure | SPR | 7.4 | PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20 | DNA | 37621412 | 10.1016/j.omtn.2023.07.038 | M08s | 7.04 10^5 | 3.33 10^-2 | 47.2 | step2c_literal_v3 | |||
| 383 | Aβ42 oligomer | protein | Aβ-Apt | CGGTGGGGGACCAGTACAAAAGTGGGTAGGGCGGGTTGGAAAA | 5.33e-08 M | -7.273 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | 1 × BB: 150 mM NaCl, 10 mM Tris -HCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, pH 7.4 | DNA | 35019631 | 10.1021/acsabm.0c00996 | suggesting that the binding a ffi nity of A β -Apt with A β 42 oligomer ( K d = 53.3 nM) was stronger than that of A β -Apt with A β 42 monomer. | step2c_acs_v1 | ||||
| 191 | α-thrombin | protein | P00734 | TBA-iT3 | GGTTGGTGTGGTTGG | 57.3 nM | -7.242 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | 138 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.76 mM KH2PO4, pH 7.4, 0.05% Tween-20 | DNA | 3'-inverted thymidine at position 3 | 30735210 | 10.1039/c9ob00053d | TBA-iT3 | 57.3 | step2c_literal_v3 | ||
| 51 | CD63 | protein | P08962 | CD63 Aptamer | ACCACCCCACCTCGCTCCCGTGACACTAATGCTACTC | 5.8e-08 M | -7.237 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | HEPES buffer (10 mM HEPES, 150 mM NaCl) | DNA | 5' amine; 3' thiol; iSpC3 spacer; 3' thio modifier | 26500145 | 10.1016/j.ymeth.2015.10.012 | The equilibrium constant of the aptamer immobilized via 3 0 end was found to be KD = 5.8 -10 8 M. | step2c_literal_v3 | ||||
| 40 | prothrombin | protein | P00734 | ARC-183 | GGTTGGTGTGGTTGG | 60.7 nM | -7.217 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | Hepes-saline buffer | DNA | 22385910 | 10.1111/j.1538-7836.2012.04679.x | Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM and ARC-183 = 60.7 nM) | step2c_literal_v3 | |||
| 27 | prothrombin | protein | P00734 | HD1-22 | GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT | 6.1e-08 M | -7.215 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | DNA | bivalent fusion; poly-dA linker | 18826387 | 10.1111/j.1538-7836.2008.03162.x | HD1-22 | Prothrombin | K D ( M) | 6.1 · 10 ) 8 | step2c_literal_v3 | |||||
| 382 | Aβ42 monomer | protein | P12821 | Aβ-Apt | CGGTGGGGGACCAGTACAAAAGTGGGTAGGGCGGGTTGGAAAA | 6.34e-08 M | -7.198 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | 1 × BB: 150 mM NaCl, 10 mM Tris -HCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, pH 7.4 | DNA | 35019631 | 10.1021/acsabm.0c00996 | It was evaluated that A β -Apt showed the ability to bind A β 42 with a K d of 63.4 nM. | step2c_acs_v1 | |||
| 155 | prothrombin | protein | P00734 | HD1-22 | GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT | 6.7e-08 M | -7.174 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | DNA | bivalent fusion; poly-dA linker | 18826387 | 10.1111/j.1538-7836.2008.03162.x | HD1-22 | Prothrombin+ phospholipids | K D ( M) | 6.7 · 10 ) 8 | step2c_literal_v3 | |||||
| 29 | prothrombin | protein | P00734 | HD1 | GGTTGGTGTGGTTGG | 7.8e-08 M | -7.108 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | DNA | 18826387 | 10.1111/j.1538-7836.2008.03162.x | HD1 | Prothrombin | K D ( M) | 7.8 · 10 ) 8 | step2c_literal_v3 | ||||||
| 386 | patulin | protein | PAT C3 | CGAAATCGCGTCCAGTGTTGGGGCGTGCTTATCCTTACACGATTTACCTGAAACGCACCGTACTGAACTACGGCGAGGTC | 8.2e-08 M | -7.086 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | PBS | DNA | 5' biotin | 35546052 | 10.1021/acs.jafc.2c01591 | PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 × 10 -8 and 1.9 × 10 -7 M, respectively | step2c_acs_v1 | |||||
| 110 | rmCD3 d ε -Fc | protein | CD3_Apt1 | CCCGATTGATTCGCAATGTGCGTCCCCTCGTGCC | 91.3 nM | -7.04 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | PBS and 0.005% (v/v) Tween 20, pH 7.4 | 2'F-RNA | 2' Fluoropyrimidines | 38745854 | 10.1016/j.omtn.2024.102198 | aptamer 1 (91.3 nM) | step2c_literal_v3 | |||
| 10 | BSA | glycan/conjugate | O95870 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 1e-07 M | -7.0 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | BSA | 2.2 3 10 4 | 2.3 3 10 2 3 | 9.9 3 10 6 | 1.0 3 10 2 7 | step2c_literal_v3 | ||
| 387 | patulin | protein | PAT C4 | CGAAATCGCGTCCAGTGTTGCCGATCTCCGTATCTTTCCTGTTGTTGGTTAGAGATTAGGTACTGAACTACGGCGAGGTC | 1.9e-07 M | -6.721 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | PBS | DNA | 5' biotin | 35546052 | 10.1021/acs.jafc.2c01591 | PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 × 10 -8 and 1.9 × 10 -7 M, respectively | step2c_acs_v1 | |||||
| 113 | rmCD3 d ε -Fc | protein | CD3_Apt12 | TCCCCTGTCGATATCCACCGTCTGGCCCGCATTGA | 206.0 nM | -6.686 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | PBS and 0.005% (v/v) Tween 20, pH 7.4 | 2'F-RNA | 2' Fluoropyrimidines | 38745854 | 10.1016/j.omtn.2024.102198 | aptamer 12 (206 nM) | step2c_literal_v3 | |||
| 15 | Lactose | protein | P00709 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 2.9e-07 M | -6.538 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | Lactose | 6.3 3 10 2 | 1.8 3 10 2 4 | 3.4 3 10 6 | 2.9 3 10 2 7 | step2c_literal_v3 |
Advanced export
JSON shape: default, array, newline-delimited
CREATE VIEW v_kd AS
SELECT k.id,
target_name_canonical,
CASE
WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
ELSE 'protein'
END AS target_type,
target_uniprot, aptamer_name, aptamer_seq,
(COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
CASE
WHEN vh.verdict='confirmed' THEN 'human_verified'
WHEN vh.verdict='corrected' THEN 'human_corrected'
WHEN vh.verdict='rejected' THEN 'human_rejected'
WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
ELSE 'automated'
END AS verification_level,
sequence_status, seq_source, pi_provenance_flag,
assay_method,
CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';