Binding affinities (Kd) — source-verified (view)
Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target
- target_name_canonical
- Target as named in the source paper.
- target_type
- protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
- target_uniprot
- UniProt accession when a human protein (sparse for now; links to apt-scout target).
- aptamer_name
- Aptamer identifier as reported.
- kd_reported
- Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
- kd_log10_molar
- log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
- measurement_class
- intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
- binding_constant_type
- Kd / apparent-Kd etc. as reported.
- assay_method
- SPR / filter binding / flow cytometry / ITC / BLI …
- assay_temperature_k
- Assay temperature (K) — a reason the same pair can have several rows.
- source_pmid
- PubMed ID of the source paper (links out).
- verbatim_quote
- The exact sentence the value was taken from.
- verification_level
- QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
- sequence_status
- Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
- pi_provenance_flag
- PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
- seq_source
- original (already in source DB) / backfill_text_verified (recovered from paper or SI text).
14 rows where assay_method = "SPR", tier = "Gold" and verification_level = "multi_agent_verified" sorted by kd_log10_molar
This data as json, CSV (advanced)
Suggested facets: target_name_canonical, target_uniprot, aptamer_name, aptamer_seq, assay_temperature_k, assay_ph, assay_buffer, aptamer_chemistry, aptamer_modifications, source_pmid, doi, verbatim_quote
sequence_status 3
verification_level 1
- multi_agent_verified · 14 ✖
tier 1
- Gold · 14 ✖
target_type 1
- protein 14
measurement_class 1
- intrinsic 14
binding_constant_type 1
- Kd 14
assay_method 1
- SPR · 14 ✖
| id | target_name_canonical | target_type | target_uniprot | aptamer_name | aptamer_seq | kd_reported | kd_log10_molar ▼ | measurement_class | binding_constant_type | tier | source_origin | verification_level | sequence_status | seq_source | pi_provenance_flag | assay_method | assay_temperature_k | assay_ph | assay_buffer | assay_cations | aptamer_chemistry | aptamer_modifications | source_pmid | doi | verbatim_quote | source_db |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 478 | FLRPp (O serotype) | protein | FMD_1 | 3.46e-10 M | -9.461 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | SPR | DNA | 42010751 | 10.1021/acs.analchem.5c04748 | dissociation constants ( KD ) of 3.46 × 10 -10 M | step2c_acs_v1 | |||||||||
| 337 | human α-thrombin | protein | P00734 | LOOPER modified thrombin aptamer | 1.6000000000000003e-09 M | -8.796 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | SPR | DNA | diversely functionalized; heteromultivalent | 28938065 | 10.1021/jacs.7b07241 | Using single-cycle kinetics surface plasmon resonance (SPR), the LOOPER aptamer exhibited a Kd of 1.6 nM | step2c_acs_v1 | |||||||
| 320 | VEGF165 | protein | P15692 | VEap121 | TGTGGGGGTGGACGGGCCGGGTAGA | 4.700000000000001e-09 M | -8.328 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | 293.15 | 7.4 | Tris-buffered saline (TBS: 10 mM Tris-HCl, 100 mM NaCl, 5 mM KCl, pH 7.4) | DNA | 23237717 | 10.1021/ac303023d | As the calculated K d value of VEap121 was 4.7 nM | step2c_acs_v1 | |||
| 314 | hMMP-9 | protein | F3Bomf | 2e-08 M | -7.699 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | SPR | 296.15 | PBS buffer | 2'-OMe-RNA | 2'-O-methyl purine; 2'-fluoro pyrimidine; 5'-hexylamino linker; 5'-MAG3 conjugate | 23043415 | 10.1021/bc300146c | The K d was taken as the concentration leading to half saturation, i.e., about 20 nM. | step2c_acs_v1 | ||||||
| 352 | FGFR3 K650E | protein | SU-3 | CAGAGGCTGACGTAAACAGACATTGATGGGACCCACCCTTCCGCTGGCAA | 2.82e-08 M | -7.55 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | 1 × PBS | DNA | 31265241 | 10.1021/acscombsci.9b00059 | The predicted K D was 28.2 × 10 -9 ± 19.6 × 10 -9 M( n = 5) in 1 × PBS bu ff er, using 1:1 Langmuir binding model. | step2c_acs_v1 | ||||||
| 365 | Thrombin | protein | P00734 | aptamer 2S | TATGGTTGGTGTGGTTGGATA | 2.9400000000000002e-08 M | -7.532 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | 7.6 | PBS buffer (pH 7.6) containing 138 mM NaCl and 2.7 mM KCl | DNA | 32268723 | 10.1021/acs.analchem.0c00380 | The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 μM and 29.4 nM, respectively | step2c_acs_v1 | ||||
| 370 | ODAM | protein | A1E959 | OD64 | 4.771e-08 M | -7.321 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_figure | SPR | DNA | 33455205 | 10.1021/acsbiomaterials.0c01203 | the obtained OD64 and OD35 (aptamer cognate pair) presented high a ffi nity and excellent speci fi city, along with dissociation constants ( K d ) of 47.71 nM (OD64) | step2c_acs_v1 | ||||||||
| 371 | ODAM | protein | A1E959 | OD35 | 5.1360000000000005e-08 M | -7.289 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_figure | SPR | DNA | 33455205 | 10.1021/acsbiomaterials.0c01203 | the obtained OD64 and OD35 (aptamer cognate pair) presented high a ffi nity and excellent speci fi city, along with dissociation constants ( K d ) of 47.71 nM (OD64) and 51.36 nM (OD35). | step2c_acs_v1 | ||||||||
| 383 | Aβ42 oligomer | protein | Aβ-Apt | CGGTGGGGGACCAGTACAAAAGTGGGTAGGGCGGGTTGGAAAA | 5.33e-08 M | -7.273 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | 1 × BB: 150 mM NaCl, 10 mM Tris -HCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, pH 7.4 | DNA | 35019631 | 10.1021/acsabm.0c00996 | suggesting that the binding a ffi nity of A β -Apt with A β 42 oligomer ( K d = 53.3 nM) was stronger than that of A β -Apt with A β 42 monomer. | step2c_acs_v1 | ||||
| 382 | Aβ42 monomer | protein | P12821 | Aβ-Apt | CGGTGGGGGACCAGTACAAAAGTGGGTAGGGCGGGTTGGAAAA | 6.34e-08 M | -7.198 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | 1 × BB: 150 mM NaCl, 10 mM Tris -HCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, pH 7.4 | DNA | 35019631 | 10.1021/acsabm.0c00996 | It was evaluated that A β -Apt showed the ability to bind A β 42 with a K d of 63.4 nM. | step2c_acs_v1 | |||
| 386 | patulin | protein | PAT C3 | CGAAATCGCGTCCAGTGTTGGGGCGTGCTTATCCTTACACGATTTACCTGAAACGCACCGTACTGAACTACGGCGAGGTC | 8.2e-08 M | -7.086 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | PBS | DNA | 5' biotin | 35546052 | 10.1021/acs.jafc.2c01591 | PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 × 10 -8 and 1.9 × 10 -7 M, respectively | step2c_acs_v1 | |||||
| 387 | patulin | protein | PAT C4 | CGAAATCGCGTCCAGTGTTGCCGATCTCCGTATCTTTCCTGTTGTTGGTTAGAGATTAGGTACTGAACTACGGCGAGGTC | 1.9e-07 M | -6.721 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | PBS | DNA | 5' biotin | 35546052 | 10.1021/acs.jafc.2c01591 | PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 × 10 -8 and 1.9 × 10 -7 M, respectively | step2c_acs_v1 | |||||
| 364 | Thrombin | protein | P00734 | aptamer 1S | TATGGTTGGTGTGGTTGGATA | 1.08e-06 M | -5.967 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | SPR | 7.6 | PBS buffer (pH 7.6) containing 138 mM NaCl and 2.7 mM KCl | DNA | azobenzene (X) | 32268723 | 10.1021/acs.analchem.0c00380 | The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 μM and 29.4 nM, respectively | step2c_acs_v1 | |||
| 388 | patulin | protein | PAT Rep | 4e-05 M | -4.398 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | SPR | PBS | DNA | 5' biotin | 35546052 | 10.1021/acs.jafc.2c01591 | PAT Rep showed a K D value of 4.0 × 10 -5 M | step2c_acs_v1 |
Advanced export
JSON shape: default, array, newline-delimited
CREATE VIEW v_kd AS
SELECT k.id,
target_name_canonical,
CASE
WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
ELSE 'protein'
END AS target_type,
target_uniprot, aptamer_name, aptamer_seq,
(COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
CASE
WHEN vh.verdict='confirmed' THEN 'human_verified'
WHEN vh.verdict='corrected' THEN 'human_corrected'
WHEN vh.verdict='rejected' THEN 'human_rejected'
WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
ELSE 'automated'
END AS verification_level,
sequence_status, seq_source, pi_provenance_flag,
assay_method,
CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';