home / scout

Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

28 rows where assay_method = "filter_binding" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: target_name_canonical, target_uniprot, aptamer_name, aptamer_seq, kd_reported, kd_log10_molar, seq_source, assay_temperature_k, assay_ph, assay_buffer, aptamer_chemistry, aptamer_modifications, source_pmid, doi

sequence_status 3

  • verified_in_text_or_SI 14
  • pending_manual_figure 12
  • pending_manual_supp 2

measurement_class 2

  • intrinsic 25
  • non_intrinsic 3

verification_level 1

  • extraction_verified 28

tier 1

  • Gold 28

target_type 1

  • protein 28

binding_constant_type 1

  • Kd 28

assay_method 1

  • filter_binding · 28 ✖
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
269 thrombin protein P00734 HD1-12A-DAB   13.1 pM -10.883 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     filter_binding     selection buffer   DNA   41053535 10.1002/advs.202509867 HD1-12A-DAB EXACT inhibitor bound to thrombin and prothrombin with K D s of 13.1 pm step2c_literal_v3
143 P-selectin protein Q14242 PF377   14.0 pM -10.854 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377 | 14 step2c_literal_v3
147 P-selectin protein Q14242 PF377sl   14.0 pM -10.854 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 296.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377sl | 14 step2c_literal_v3
142 P-selectin protein Q14242 PF377   16.0 pM -10.796 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377 | 16 step2c_literal_v3
144 P-selectin protein Q14242 PF377   18.0 pM -10.745 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 277.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377 | 18 step2c_literal_v3
146 P-selectin protein Q14242 PF377sl   29.0 pM -10.538 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377sl | 29 step2c_literal_v3
145 P-selectin protein Q14242 PF377sl   46.0 pM -10.337 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377sl | 46 step2c_literal_v3
148 P-selectin protein Q14242 PF373sl   56.0 pM -10.252 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF373sl | 56 step2c_literal_v3
152 PDGF-BB protein P01127 PDGF-B aptamer   0.1 nM -10.0 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding         DNA 2'-fluoro; 2'-O-methyl; hexaethylene glycol spacer; inverted 3'-3' thymidine cap; 40-kd PEG conjugated 9916931 10.1016/S0002-9440(10)65263-7 the binding affinity of the aptamer used in the experiments described below ( K d ≈ 0.1 nM) step2c_literal_v3
149 P-selectin protein Q14242 PF398sl   178.0 pM -9.75 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF398sl | 178 step2c_literal_v3
38 alpha-thrombin protein P05154 RNAR9D-14T GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC 1.0 nM -9.0 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding 310.15 7.4 Hepes-saline buffer with 0.01% BSA   2'F-RNA 2' Fluorocytosine; 2' Fluorouracil 22385910 10.1111/j.1538-7836.2012.04679.x Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) and α-thrombin (apparent Kd =1 nM) step2c_literal_v3
150 P-selectin protein Q14242 PF422sl   1000.0 pM -9.0 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF422sl | 1 X 103 step2c_literal_v3
41 hOX40 protein   9C7 GGGAGGACGATGCGGAAAAAAGAACACUUCCGAUUAGGGCCCACCCUAACGGCCGCAGACGACTCGCCCGA 1.7 nM -8.77 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding 310.15 7.5 selection buffer F (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2, and 0.01% BSA)   2'F-RNA   23113766 10.1089/nat.2012.0388 9C7 | 11 | 1.7 step2c_literal_v3
31 VWF A1-domain protein P04275 ARC1779   2.0 nM -8.699 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 298.15   Dulbecco's PBS containing 0.1 mg mL-1 BSA   DNA/RNA 2'-O-methyl; phosphorothioate; inverted deoxythymidine; 20-kDa PEG conjugation 19422452 10.1111/j.1538-7836.2009.03459.x This resulted in a final aptamer (ARC1779) that is a 40-nucleotide modified DNA/RNA oligonucleotide with a K D of 2 nM for the A1-domain. step2c_literal_v3
165 porcine thrombin protein   RNAR9D-14T GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC 5.0 nM -8.301 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding         2'F-RNA 2' Fluorocytosine; 2' Fluorouracil 22385910 10.1111/j.1538-7836.2012.04679.x RNAR9D-14T binds to porcine thrombin (apparent K d=5 nM) step2c_literal_v3
22 murine OX40 protein   9.8 GGGAGGACGATGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCACAGACGACTCGCTGAGGATCCGAGA 8.0 nM -8.097 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding   7.4 20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2   RNA 2'F-pyrimidine 18635004 10.1016/j.chembiol.2008.05.016 Aptamer 9.8 was chosen for further study, since it had the highest affinity for the OX40 fusion protein. step2c_literal_v3
47 PDGFR β protein P09619 Gint4.T UGUCGUGGGGCAUCGAGUAAAUGCAAUUCGACA 9.6 nM -8.018 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding         2'F-RNA 2'-fluoropyrimidine; nuclease-resistant 24566984 10.1038/mt.2013.300 This aptamer is able to specifically bind to the human PDGFR β ectodomain (Kd: 9.6 nM) step2c_literal_v3
37 prothrombin protein P00734 RNAR9D-14T GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC 10.0 nM -8.0 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding 310.15 7.4 Hepes-saline buffer with 0.01% BSA   2'F-RNA 2' Fluorocytosine; 2' Fluorouracil 22385910 10.1111/j.1538-7836.2012.04679.x Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) step2c_literal_v3
42 hOX40 protein   11F11 GGGAGGACGATGCGGAACGGGACCACCCAUGCCAGGGGACCACCUCAGGCAGCGCCAGACGAC 10.0 nM -8.0 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding 310.15 7.5 selection buffer F (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2, and 0.01% BSA)   2'F-RNA   23113766 10.1089/nat.2012.0388 11F11 | 8 | 10 step2c_literal_v3
23 murine OX40 protein   11.2 GGGAGGACGATGCGGGAUACCAGGAUCACAUCCUGAGGAACCCCGGCUCCCAACCUAGACGACTCGCTGAGGATCCGAGA 25.0 nM -7.602 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding   7.4 20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2   RNA 2'F-pyrimidine 18635004 10.1016/j.chembiol.2008.05.016 11.2 | AUACCAGGAUCACAUCCUGAGGAACCCCGGCUCCCAACCU | 25 | 4 step2c_literal_v3
24 murine OX40 protein   11.4 GGGAGGACGATGCGGACUUUAAUCCUCGCACUCAGCGCGCAUCACCCUUGACAUCAAGACGACTCGCTGAGGATCCGAGA 25.0 nM -7.602 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding   7.4 20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2   RNA 2'F-pyrimidine 18635004 10.1016/j.chembiol.2008.05.016 11.4 | CUUUAAUCCUCGCACUCAGCGCGCAUCACCCUUGACAUCA | 25 | 5 step2c_literal_v3
25 murine OX40 protein   9.3 GGGAGGACGATGCGGACAAACCAGCUAUUUCCUGAGGUACCCCGGCUCUCCAUGGAGACGACTCGCTGAGGATCCGAGA 25.0 nM -7.602 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding   7.4 20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2   RNA 2'F-pyrimidine 18635004 10.1016/j.chembiol.2008.05.016 9.3 | CAAACCAGCUAUUUCCUGAGGUACCCCGGCUCUCCAUGG | 25 | 4 step2c_literal_v3
43 hOX40 protein   9C7T GGGGGAATTCTAATACGACTCACTATAGGGATGCGGAAAAAAGAACACT 29.0 nM -7.538 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   filter_binding 310.15 7.5 selection buffer F (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2, and 0.01% BSA)   2'F-RNA 5'-biotin 23113766 10.1089/nat.2012.0388 observed Kd of * 29nM step2c_literal_v3
26 murine OX40 protein   11.8 GGGAGGACGATGCGGAUACCAGCGAAUAACUCGCUGAGGAACCCGACUCACAAAAGACGACTCGCTGAGGATCCGAGA 50.0 nM -7.301 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding   7.4 20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2   RNA 2'F-pyrimidine 18635004 10.1016/j.chembiol.2008.05.016 11.8 | AUACCAGCGAAUAACUCGCUGAGGAACCCGACUCACAAA | 50 | 1 step2c_literal_v3
137 thrombin protein P00734 HD1 GGTTGGTGTGGTTGG 110.0 nM -6.959 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding     selection buffer   DNA   41053535 10.1002/advs.202509867 HD1 binds both thrombin (K D = 110 nm) step2c_literal_v3
270 prothrombin protein P00734 HD1-12A-DAB   296.0 nM -6.529 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     filter_binding     selection buffer   DNA   41053535 10.1002/advs.202509867 and prothrombin with K D s of 13.1 pm and 296 nm step2c_literal_v3
138 prothrombin protein P00734 HD1 GGTTGGTGTGGTTGG 992.0 nM -6.003 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding     selection buffer   DNA   41053535 10.1002/advs.202509867 and prothrombin (K D = 992 nm) step2c_literal_v3
151 P-selectin protein Q14242 NX244   9000000.0 pM -5.046 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 NX244 | 9 X 106 step2c_literal_v3

Advanced export

JSON shape: default, array, newline-delimited

CSV options:

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';
Powered by Datasette · Queries took 57.669ms · Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target