Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

19 rows where assay_method = "fluorescence", measurement_class = "intrinsic" and sequence_status = "verified_in_text_or_SI" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: target_name_canonical, target_uniprot, aptamer_name, aptamer_seq, seq_source, assay_temperature_k, assay_ph, assay_buffer, aptamer_modifications, source_pmid, doi, verbatim_quote, source_db

verification_level 2

tier 1

target_type 1

sequence_status 1

  • verified_in_text_or_SI · 19 ✖

measurement_class 1

  • intrinsic · 19 ✖

binding_constant_type 1

assay_method 1

  • fluorescence · 19 ✖
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
432 Sc3+ protein Q96PL5 Sc-1 CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC 1e-09 M -9.0 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence     SELEX buffer   DNA   39743479 10.1021/jacs.4c13768 true K d for the binding of Sc-1 to Sc 3+ to be 1.0 nM step2c_acs_v1
431 Sc3+ protein Q96PL5 Sc-1 CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC 1.0300000000000001e-08 M -7.987 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence     SELEX buffer   DNA   39743479 10.1021/jacs.4c13768 an apparent K d value of 10.3 nM was obtained step2c_acs_v1
135 SCAF4 protein O95104 PTf-SRiApt TTAAAGGGGTGGGGAGTCAT 0.073 µM -7.137 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence   6.5 30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm β-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA   DNA phosphorothioate 40574704 10.1002/advs.202500433 0.073 ± 0.003 µ m for PTf -SRiApt step2c_literal_v3
52 hemagglutinin (HA) protein of H1N1 influenza virus (A/Puerto Rico/8/1934) protein   aptamer 1 GGGAGCTCAGAATAAACGCTCAAGGCACGGCATGTGTGGTATGTGGTGCCTGTACTCGTTCGACATGAGGCCCGGATC 78.0 nM -7.108 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence 310.15 7.35 binding buffer (20 mM HEPES buffer pH 7.35, 120 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, and 5 mM KCl) 1.0 DNA   26904922 10.1089/nat.2015.0564 As it showed a higher binding affinity for HA protein (Kd = 78 -1nM), aptamer 1 was tested step2c_literal_v3
102 CD9 protein P21926 CD9-26 ATAGTCCCTTGGCGTGCTTCACAACCTTGAACTTGACGCAGGATCGTTCAGTGCGCACTAGAGCAGGTACGGTGTCA 101.96 nM -6.992 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence 277.15   1 × SELEX buffer   DNA   37585601 10.1021/acssensors.3c00879 CD9-26 | 5 ′ -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG TGC GCA CTA GAG CAG GTA CGG TGT CA-3 ′ | - 8.92 step2c_literal_v3
134 SCAF4 protein O95104 PT1/2-SRiApt TTAAAGGGGTGGGGAGTCAT 0.121 µM -6.917 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence   6.5 30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm β-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA   DNA phosphorothioate 40574704 10.1002/advs.202500433 0.121 ± 0.054 µ m for PT1/2 -SRiApt step2c_literal_v3
133 SCAF4 protein O95104 PT1/3-SRiApt TTAAAGGGGTGGGGAGTCAT 0.223 µM -6.652 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence   6.5 30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm β-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA   DNA phosphorothioate 40574704 10.1002/advs.202500433 0.223 ± 0.030 µ m for PT 1/3 -SRiApt step2c_literal_v3
103 CD9 protein P21926 CD9-28 ATAGTCCCTTGGCGTGCTTCACAACCTTGAACTTGACGCAGGATCGTTCAGGGCGCACTAGAGCAGGTACGGTGTCA 289.67 nM -6.538 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence 277.15   1 × SELEX buffer   DNA   37585601 10.1021/acssensors.3c00879 CD9-28 | 5 ′ -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG GGC GCA CTA GAG CAG GTA CGG TGT CA-3 ′ | - 8.80 step2c_literal_v3
450 biliverdin protein P53004 Bvd4 GACGACGGGTGTGGAACAGTGCGAATACTTTCGAGTCGTC 4.0999999999999994e-07 M -6.387 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence   7.6 selection buffer   DNA   40669049 10.1021/acschembio.5c00438 Titration of biliverdin into 1 μM Bvd4 aptamer led to an approximate 90% fluorescence drop (Figure 3A), and the fitted dissociation constant ( K d ) was 0.41 μM step2c_acs_v1
132 SCAF4 protein O95104 SRiApt TTAAAGGGGTGGGGAGTCAT 0.469 µM -6.329 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence   6.5 30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm β-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA   DNA   40574704 10.1002/advs.202500433 The binding affinities (K D ) were determined to be 0.469 ± 0.010 µ m for unmodified SRiApt step2c_literal_v3
453 bilirubin protein P22309 Brb7 GACGACATAAGCTCTTAGCGCGTGTTTACCACCTTTGTCGTC 1.4e-06 M -5.854 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence   7.6 selection buffer   DNA   40669049 10.1021/acschembio.5c00438 After titrating bilirubin into 1.0 μM Brb7 aptamer, the saturation fluorescence decrease reached 99% (Figure 6A) and its K d was fitted to be 1.4 μM step2c_acs_v1
451 biliverdin protein P53004 Bvd1 GACGACGAACGGAGTAGGTTTTAACGAATGAAATGGGTCGTC 2e-06 M -5.699 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence   7.6 selection buffer   DNA   40669049 10.1021/acschembio.5c00438 The same trend was also observed for the Bvd1 aptamer (Figure S1), and the fitted K d was 2.0 μM. step2c_acs_v1
122 hemin protein Q9NP58 Sequence D GGTTGGTGTGGTTGG 2.9 μM -5.538 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence   7.4 10 mM K-phosphate, pH 7.4, 0.1 M KCl, and 1% DMSO   DNA phosphorothioate (Sp, stereopure) 40368877 10.1021/acs.molpharmaceut.5c00117 Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 μ M for sequences C and D, respectively. step2c_literal_v3
123 hemin protein Q9NP58 Sequence C GGTTGGTGTGGTTGG 8.3 μM -5.081 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence   7.4 10 mM K-phosphate, pH 7.4, 0.1 M KCl, and 1% DMSO   DNA phosphorothioate (Rp, stereopure) 40368877 10.1021/acs.molpharmaceut.5c00117 Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 μ M for sequences C and D, respectively. step2c_literal_v3
454 bilirubin protein P22309 Brb9 GACGACGAATGCAATGGGGCCTGCCGAACGTCTTTAGGATTT 9e-06 M -5.046 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence   7.6 selection buffer   DNA   40669049 10.1021/acschembio.5c00438 The same trend was also observed in the Brb9 aptamer (Figure S4), which showed a K d of 9.0 μM. step2c_acs_v1
468 L-lactate protein Q9BYZ2 D-Lac1103 TGATGTCGTC 8.999999999999999e-05 M -4.046 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI backfill_text_verified   fluorescence         DNA FAM 41779931 10.1021/acs.analchem.5c07149 The true K d for D-Lac1103 was calculated to be 0.09 mM for L-lactate step2c_acs_v1
469 D-lactate protein Q86WU2 D-Lac1103 TGATGTCGTC 0.0025 M -2.602 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI backfill_text_verified   fluorescence 295.15   SELEX buffer   DNA FAM 41779931 10.1021/acs.analchem.5c07149 In addition, the apparent K d values for D-Lac1103 are 0.46 mMfor L-lactate and 2.5 mM for D-lactate step2c_acs_v1
438 acrylamide protein P41145 AA-1 GACGACGGAATCCTGGTGCACGTTGGTGGAGGTCACGTCGTC 0.0047 M -2.328 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence   7.4 20 mM HEPES buffer (pH 7.4) with 100 mM NaCl and 1 mM MgCl2   DNA   40261307 10.1021/acs.analchem.5c00783 Similarly, the AA-1 aptamer exhibited a true K d value of 4.7 mM via the strand-displacement assay step2c_acs_v1
437 acrylamide protein P41145 AA-1 GACGACGGAATCCTGGTGCACGTTGGTGGAGGTCACGTCGTC 0.0105 M -1.979 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence   7.4 20 mM HEPES pH 7.4, 100 mM NaCl, and 1 mM MgCl2   DNA   40261307 10.1021/acs.analchem.5c00783 the fitted K d value was 10.5 mM step2c_acs_v1

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';