Binding affinities (Kd) — source-verified (view)
Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target
- target_name_canonical
- Target as named in the source paper.
- target_type
- protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
- target_uniprot
- UniProt accession when a human protein (sparse for now; links to apt-scout target).
- aptamer_name
- Aptamer identifier as reported.
- kd_reported
- Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
- kd_log10_molar
- log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
- measurement_class
- intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
- binding_constant_type
- Kd / apparent-Kd etc. as reported.
- assay_method
- SPR / filter binding / flow cytometry / ITC / BLI …
- assay_temperature_k
- Assay temperature (K) — a reason the same pair can have several rows.
- source_pmid
- PubMed ID of the source paper (links out).
- verbatim_quote
- The exact sentence the value was taken from.
- verification_level
- QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
- sequence_status
- Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
- pi_provenance_flag
- PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
- seq_source
- original (already in source DB) / backfill_text_verified (recovered from paper or SI text).
27 rows where assay_method = "fluorescence", measurement_class = "intrinsic" and verification_level = "multi_agent_verified" sorted by kd_log10_molar
This data as json, CSV (advanced)
Suggested facets: target_name_canonical, target_uniprot, aptamer_name, aptamer_seq, seq_source, assay_temperature_k, assay_ph, assay_buffer, aptamer_modifications, source_pmid, doi, verbatim_quote
sequence_status 3
verification_level 1
- multi_agent_verified · 27 ✖
tier 1
- Gold 27
target_type 1
- protein 27
measurement_class 1
- intrinsic · 27 ✖
binding_constant_type 1
- Kd 27
assay_method 1
- fluorescence · 27 ✖
| id | target_name_canonical | target_type | target_uniprot | aptamer_name | aptamer_seq | kd_reported | kd_log10_molar ▼ | measurement_class | binding_constant_type | tier | source_origin | verification_level | sequence_status | seq_source | pi_provenance_flag | assay_method | assay_temperature_k | assay_ph | assay_buffer | assay_cations | aptamer_chemistry | aptamer_modifications | source_pmid | doi | verbatim_quote | source_db |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 432 | Sc3+ | protein | Q96PL5 | Sc-1 | CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC | 1e-09 M | -9.0 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | SELEX buffer | DNA | 39743479 | 10.1021/jacs.4c13768 | true K d for the binding of Sc-1 to Sc 3+ to be 1.0 nM | step2c_acs_v1 | |||||
| 328 | ATP | protein | P00846 | Huizenga-Szostak ATP aptamer | 1.3e-09 M | -8.886 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_supp_oa | fluorescence | DNA | 25170558 | 10.1021/bc500286r | binding a ffi nity can be tuned over 4 orders of magnitude (1.3 nM -203 μ M) | step2c_acs_v1 | ||||||||
| 348 | NP | protein | Q16612 | NP-C04 | 8.1e-09 M | -8.092 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | 7.4 | 20 mM HEPES, 150 mM NaCl, 2 mM KCl, 2 mM MgCl2, and 2 mM CaCl2 (pH 7.4) | DNA | FAM | 30740973 | 10.1021/acs.analchem.8b04623 | the K d values of NP-D01, NP-C04, and NP-D02 were 76..1 ± 10.9, 8.1 ± 2.4, and 41.3 ± 9.5 nM, respectively. | step2c_acs_v1 | |||||
| 431 | Sc3+ | protein | Q96PL5 | Sc-1 | CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC | 1.0300000000000001e-08 M | -7.987 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | SELEX buffer | DNA | 39743479 | 10.1021/jacs.4c13768 | an apparent K d value of 10.3 nM was obtained | step2c_acs_v1 | |||||
| 424 | verrucarin A | protein | Ver1_JYP | 2.9500000000000003e-08 M | -7.53 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | 7.4 | SELEX buffer | DNA | 39404132 | 10.1021/acs.analchem.4c03307 | The novel ssDNA aptamer exhibited a binding affinity of 29.5 nM | step2c_acs_v1 | |||||||
| 354 | paramylon | protein | Par-15 | 3.49e-08 M | -7.457 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | 7.5 | binding buffer (50 mM Tris, 150 mM NaCl, 5 mM MgCl2, 1 mM EDTA, pH 7.5) | DNA | FAM | 31809034 | 10.1021/acs.jafc.9b04588 | The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 ± 2.61, 34.90 ± 5.83, 64.06 ± 6.72, 123.81 ± 13.41, and 249.52 ± 46.39 nM, respectively. | step2c_acs_v1 | ||||||
| 355 | paramylon | protein | Par-18 | 6.406e-08 M | -7.193 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | 7.5 | binding buffer (50 mM Tris, 150 mM NaCl, 5 mM MgCl2, 1 mM EDTA, pH 7.5) | DNA | FAM | 31809034 | 10.1021/acs.jafc.9b04588 | The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 ± 2.61, 34.90 ± 5.83, 64.06 ± 6.72, 123.81 ± 13.41, and 249.52 ± 46.39 nM, respectively. | step2c_acs_v1 | ||||||
| 400 | 6'-sialyllactose | protein | Q9Y3R4 | Apt9-1 | 9.175000000000001e-08 M | -7.037 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | 298.15 | 7.4 | 10 mM PBS (pH 7.4) | DNA | 36700646 | 10.1021/acs.jafc.2c07784 | A 35 nt truncated aptamer Apt9-1 ( K d = 91.75 nM) with higher affinity than Apt9 was finally obtained. | step2c_acs_v1 | |||||
| 436 | SIRT2 | protein | Q8IXJ6 | Apt 45 | 1.233e-07 M | -6.909 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | 310.15 | DNA | FAM | 40200675 | 10.1021/acs.analchem.5c00066 | selected Apt 45 ( K d = 123.3 nM) to fabricate the 'turn-on' fluorescent biosensor | step2c_acs_v1 | ||||||
| 399 | 6'-sialyllactose | protein | Q9Y3R4 | Apt9 | 1.5230000000000003e-07 M | -6.817 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | 298.15 | 7.4 | 10 mM PBS (pH 7.4) | DNA | 36700646 | 10.1021/acs.jafc.2c07784 | The ssDNA aptamer Apt9 ( K d = 152.3 nM) with a length of 79 nucleotides (nt) was demonstrated as the optimal aptamer candidate | step2c_acs_v1 | |||||
| 467 | benzovindiflupyr | protein | Apt.BZF01 | 2.2650000000000002e-07 M | -6.645 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | DNA | 41614999 | 10.1021/acs.jafc.5c15044 | corrected KDs of 226.5 nM (Apt.BZF01) | step2c_acs_v1 | |||||||||
| 450 | biliverdin | protein | P53004 | Bvd4 | GACGACGGGTGTGGAACAGTGCGAATACTTTCGAGTCGTC | 4.0999999999999994e-07 M | -6.387 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | 7.6 | selection buffer | DNA | 40669049 | 10.1021/acschembio.5c00438 | Titration of biliverdin into 1 μM Bvd4 aptamer led to an approximate 90% fluorescence drop (Figure 3A), and the fitted dissociation constant ( K d ) was 0.41 μM | step2c_acs_v1 | ||||
| 453 | bilirubin | protein | P22309 | Brb7 | GACGACATAAGCTCTTAGCGCGTGTTTACCACCTTTGTCGTC | 1.4e-06 M | -5.854 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | 7.6 | selection buffer | DNA | 40669049 | 10.1021/acschembio.5c00438 | After titrating bilirubin into 1.0 μM Brb7 aptamer, the saturation fluorescence decrease reached 99% (Figure 6A) and its K d was fitted to be 1.4 μM | step2c_acs_v1 | ||||
| 451 | biliverdin | protein | P53004 | Bvd1 | GACGACGAACGGAGTAGGTTTTAACGAATGAAATGGGTCGTC | 2e-06 M | -5.699 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | 7.6 | selection buffer | DNA | 40669049 | 10.1021/acschembio.5c00438 | The same trend was also observed for the Bvd1 aptamer (Figure S1), and the fitted K d was 2.0 μM. | step2c_acs_v1 | ||||
| 425 | verrucarin A | protein | 14_Ver1 | 2.2e-06 M | -5.658 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | 7.4 | SELEX buffer | DNA | 6-FAM at 5'-end; dabcyl at 3'-end | 39404132 | 10.1021/acs.analchem.4c03307 | The binding test demonstrated that the decrease in fluorescence was correlated with increasing verrucarin A concentration with K D = 2.2 μM. | step2c_acs_v1 | ||||||
| 426 | verrucarin A | protein | Ver1_JYP (C32G mutant) | 2.2999999999999996e-06 M | -5.638 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | 7.4 | SELEX buffer | DNA | C32G mutation | 39404132 | 10.1021/acs.analchem.4c03307 | guanine with both functional groups exhibited partially recovered binding activity ( K D = 2.3 μM). | step2c_acs_v1 | ||||||
| 454 | bilirubin | protein | P22309 | Brb9 | GACGACGAATGCAATGGGGCCTGCCGAACGTCTTTAGGATTT | 9e-06 M | -5.046 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | 7.6 | selection buffer | DNA | 40669049 | 10.1021/acschembio.5c00438 | The same trend was also observed in the Brb9 aptamer (Figure S4), which showed a K d of 9.0 μM. | step2c_acs_v1 | ||||
| 463 | Patulin | protein | PTL-1 | 1.8399999999999997e-05 M | -4.735 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | 6.0 | selection buffer (10 mM MES, pH 6.0, 150 mM NaCl, 5 mM MgCl2) | DNA | 41473783 | 10.1186/s44280-025-00101-2 | yielding an apparent K d of 18.4 μM | step2c_acs_v1 | |||||||
| 464 | Patulin | protein | PAT-6 | 4.8e-05 M | -4.319 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | 6.0 | 20 mM MES buffer, pH = 6.0, with 150 mM NaCl and 2.0 mM MgCl2 | DNA | 41473783 | 10.1186/s44280-025-00101-2 | PAT-6 has weaker binding affinities ( Kd = 48 μM by ThT, Fig. 4S) | step2c_acs_v1 | |||||||
| 468 | L-lactate | protein | Q9BYZ2 | D-Lac1103 | TGATGTCGTC | 8.999999999999999e-05 M | -4.046 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | backfill_text_verified | fluorescence | DNA | FAM | 41779931 | 10.1021/acs.analchem.5c07149 | The true K d for D-Lac1103 was calculated to be 0.09 mM for L-lactate | step2c_acs_v1 | |||||
| 471 | L-lactate | protein | Q9BYZ2 | Lac201 | 0.0009000000000000001 M | -3.046 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | 296.15 | SELEX buffer | DNA | 2AP | 41779931 | 10.1021/acs.analchem.5c07149 | the fitted K d was 0.9 mM (Figure 5C, black line) | step2c_acs_v1 | |||||
| 469 | D-lactate | protein | Q86WU2 | D-Lac1103 | TGATGTCGTC | 0.0025 M | -2.602 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | backfill_text_verified | fluorescence | 295.15 | SELEX buffer | DNA | FAM | 41779931 | 10.1021/acs.analchem.5c07149 | In addition, the apparent K d values for D-Lac1103 are 0.46 mMfor L-lactate and 2.5 mM for D-lactate | step2c_acs_v1 | |||
| 457 | Tris(hydroxymethyl)aminomethane | protein | Tris aptamer | 0.0026000000000000003 M | -2.585 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | DNA | 40905906 | 10.1021/acs.analchem.5c03351 | ThT yielded K d values changed modestly from 1.6 to 2.6 mM | step2c_acs_v1 | |||||||||
| 473 | L-lactate | protein | Q9BYZ2 | Lac2059 | 0.0033 M | -2.481 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | 296.15 | SELEX buffer | DNA | 2AP | 41779931 | 10.1021/acs.analchem.5c07149 | The fitted K d was 3.3 mM for this 2AP-labeled aptamer | step2c_acs_v1 | |||||
| 472 | L-lactate | protein | Q9BYZ2 | Lac201 | 0.0043 M | -2.367 | intrinsic | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | fluorescence | 296.15 | SELEX buffer | DNA | 2AP | 41779931 | 10.1021/acs.analchem.5c07149 | although the obtained K d (4.3 mM) was about 5-fold higher than that obtained using Mg 2+ . | step2c_acs_v1 | |||||
| 438 | acrylamide | protein | P41145 | AA-1 | GACGACGGAATCCTGGTGCACGTTGGTGGAGGTCACGTCGTC | 0.0047 M | -2.328 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | 7.4 | 20 mM HEPES buffer (pH 7.4) with 100 mM NaCl and 1 mM MgCl2 | DNA | 40261307 | 10.1021/acs.analchem.5c00783 | Similarly, the AA-1 aptamer exhibited a true K d value of 4.7 mM via the strand-displacement assay | step2c_acs_v1 | ||||
| 437 | acrylamide | protein | P41145 | AA-1 | GACGACGGAATCCTGGTGCACGTTGGTGGAGGTCACGTCGTC | 0.0105 M | -1.979 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | 7.4 | 20 mM HEPES pH 7.4, 100 mM NaCl, and 1 mM MgCl2 | DNA | 40261307 | 10.1021/acs.analchem.5c00783 | the fitted K d value was 10.5 mM | step2c_acs_v1 |
Advanced export
JSON shape: default, array, newline-delimited
CREATE VIEW v_kd AS
SELECT k.id,
target_name_canonical,
CASE
WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
ELSE 'protein'
END AS target_type,
target_uniprot, aptamer_name, aptamer_seq,
(COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
CASE
WHEN vh.verdict='confirmed' THEN 'human_verified'
WHEN vh.verdict='corrected' THEN 'human_corrected'
WHEN vh.verdict='rejected' THEN 'human_rejected'
WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
ELSE 'automated'
END AS verification_level,
sequence_status, seq_source, pi_provenance_flag,
assay_method,
CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';