Binding affinities (Kd) — source-verified (view)
Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target
- target_name_canonical
- Target as named in the source paper.
- target_type
- protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
- target_uniprot
- UniProt accession when a human protein (sparse for now; links to apt-scout target).
- aptamer_name
- Aptamer identifier as reported.
- kd_reported
- Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
- kd_log10_molar
- log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
- measurement_class
- intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
- binding_constant_type
- Kd / apparent-Kd etc. as reported.
- assay_method
- SPR / filter binding / flow cytometry / ITC / BLI …
- assay_temperature_k
- Assay temperature (K) — a reason the same pair can have several rows.
- source_pmid
- PubMed ID of the source paper (links out).
- verbatim_quote
- The exact sentence the value was taken from.
- verification_level
- QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
- sequence_status
- Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
- pi_provenance_flag
- PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
- seq_source
- original (already in source DB) / backfill_text_verified (recovered from paper or SI text).
23 rows where assay_method = "fluorescence", sequence_status = "verified_in_text_or_SI" and tier = "Gold" sorted by kd_log10_molar
This data as json, CSV (advanced)
Suggested facets: target_name_canonical, target_uniprot, aptamer_name, aptamer_seq, seq_source, assay_temperature_k, assay_ph, assay_buffer, aptamer_modifications, source_pmid, doi, verbatim_quote, source_db
measurement_class 3
verification_level 2
tier 1
- Gold · 23 ✖
target_type 1
- protein 23
sequence_status 1
- verified_in_text_or_SI · 23 ✖
binding_constant_type 1
- Kd 23
assay_method 1
- fluorescence · 23 ✖
| id | target_name_canonical | target_type | target_uniprot | aptamer_name | aptamer_seq | kd_reported | kd_log10_molar ▼ | measurement_class | binding_constant_type | tier | source_origin | verification_level | sequence_status | seq_source | pi_provenance_flag | assay_method | assay_temperature_k | assay_ph | assay_buffer | assay_cations | aptamer_chemistry | aptamer_modifications | source_pmid | doi | verbatim_quote | source_db |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 432 | Sc3+ | protein | Q96PL5 | Sc-1 | CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC | 1e-09 M | -9.0 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | SELEX buffer | DNA | 39743479 | 10.1021/jacs.4c13768 | true K d for the binding of Sc-1 to Sc 3+ to be 1.0 nM | step2c_acs_v1 | |||||
| 431 | Sc3+ | protein | Q96PL5 | Sc-1 | CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC | 1.0300000000000001e-08 M | -7.987 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | SELEX buffer | DNA | 39743479 | 10.1021/jacs.4c13768 | an apparent K d value of 10.3 nM was obtained | step2c_acs_v1 | |||||
| 476 | Escherichia coli O157:H7 | protein | E. coli O157:H7-specific aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 1.4400000000000002e-08 M | -7.842 | apparent_cellular | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | 298.15 | 15% (v/v) PEG200 | DNA | FAM | 41850902 | 10.1021/acs.analchem.5c07364 | the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM). | step2c_acs_v1 | ||||
| 475 | Escherichia coli O157:H7 | protein | E. coli O157:H7-specific aptamer | CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG | 1.92e-08 M | -7.717 | apparent_cellular | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | 298.15 | liquid milk-based matrices (0% lactalbumin/lactose/casein) | DNA | FAM | 41850902 | 10.1021/acs.analchem.5c07364 | the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM). | step2c_acs_v1 | ||||
| 135 | SCAF4 | protein | O95104 | PTf-SRiApt | TTAAAGGGGTGGGGAGTCAT | 0.073 µM | -7.137 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | fluorescence | 6.5 | 30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm β-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA | DNA | phosphorothioate | 40574704 | 10.1002/advs.202500433 | 0.073 ± 0.003 µ m for PTf -SRiApt | step2c_literal_v3 | |||
| 52 | hemagglutinin (HA) protein of H1N1 influenza virus (A/Puerto Rico/8/1934) | protein | aptamer 1 | GGGAGCTCAGAATAAACGCTCAAGGCACGGCATGTGTGGTATGTGGTGCCTGTACTCGTTCGACATGAGGCCCGGATC | 78.0 nM | -7.108 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | fluorescence | 310.15 | 7.35 | binding buffer (20 mM HEPES buffer pH 7.35, 120 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, and 5 mM KCl) | 1.0 | DNA | 26904922 | 10.1089/nat.2015.0564 | As it showed a higher binding affinity for HA protein (Kd = 78 -1nM), aptamer 1 was tested | step2c_literal_v3 | |||
| 102 | CD9 | protein | P21926 | CD9-26 | ATAGTCCCTTGGCGTGCTTCACAACCTTGAACTTGACGCAGGATCGTTCAGTGCGCACTAGAGCAGGTACGGTGTCA | 101.96 nM | -6.992 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | fluorescence | 277.15 | 1 × SELEX buffer | DNA | 37585601 | 10.1021/acssensors.3c00879 | CD9-26 | 5 ′ -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG TGC GCA CTA GAG CAG GTA CGG TGT CA-3 ′ | - 8.92 | step2c_literal_v3 | ||||
| 474 | Moraxella osloensis | protein | MO9 | GCATTCAGAGCCATCCACCCTGAAGGTGGCGTATATCGATGTTCGGGACGCCGTGCCTGTTGCGTACGAATGG | 1.1890000000000001e-07 M | -6.925 | apparent_cellular | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | DNA | thiolated | 41784024 | 10.1021/acssensors.5c03424 | high-a ffi nity aptamer (K d = 118.9 nM) | step2c_acs_v1 | ||||||
| 134 | SCAF4 | protein | O95104 | PT1/2-SRiApt | TTAAAGGGGTGGGGAGTCAT | 0.121 µM | -6.917 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | fluorescence | 6.5 | 30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm β-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA | DNA | phosphorothioate | 40574704 | 10.1002/advs.202500433 | 0.121 ± 0.054 µ m for PT1/2 -SRiApt | step2c_literal_v3 | |||
| 133 | SCAF4 | protein | O95104 | PT1/3-SRiApt | TTAAAGGGGTGGGGAGTCAT | 0.223 µM | -6.652 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | fluorescence | 6.5 | 30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm β-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA | DNA | phosphorothioate | 40574704 | 10.1002/advs.202500433 | 0.223 ± 0.030 µ m for PT 1/3 -SRiApt | step2c_literal_v3 | |||
| 103 | CD9 | protein | P21926 | CD9-28 | ATAGTCCCTTGGCGTGCTTCACAACCTTGAACTTGACGCAGGATCGTTCAGGGCGCACTAGAGCAGGTACGGTGTCA | 289.67 nM | -6.538 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | fluorescence | 277.15 | 1 × SELEX buffer | DNA | 37585601 | 10.1021/acssensors.3c00879 | CD9-28 | 5 ′ -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG GGC GCA CTA GAG CAG GTA CGG TGT CA-3 ′ | - 8.80 | step2c_literal_v3 | ||||
| 450 | biliverdin | protein | P53004 | Bvd4 | GACGACGGGTGTGGAACAGTGCGAATACTTTCGAGTCGTC | 4.0999999999999994e-07 M | -6.387 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | 7.6 | selection buffer | DNA | 40669049 | 10.1021/acschembio.5c00438 | Titration of biliverdin into 1 μM Bvd4 aptamer led to an approximate 90% fluorescence drop (Figure 3A), and the fitted dissociation constant ( K d ) was 0.41 μM | step2c_acs_v1 | ||||
| 132 | SCAF4 | protein | O95104 | SRiApt | TTAAAGGGGTGGGGAGTCAT | 0.469 µM | -6.329 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | fluorescence | 6.5 | 30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm β-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA | DNA | 40574704 | 10.1002/advs.202500433 | The binding affinities (K D ) were determined to be 0.469 ± 0.010 µ m for unmodified SRiApt | step2c_literal_v3 | ||||
| 246 | CD9 | protein | P21926 | CD9-08 | TGACACCGTACCTGCTCTAGTGCGCACTGAACGATCCTGCGTCAAGTTCAAGGTTGTGAAGCACGCCAAGGGACTAT | 494.37 nM | -6.306 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | fluorescence | 277.15 | 1 × SELEX buffer | DNA | 37585601 | 10.1021/acssensors.3c00879 | CD9-08 | 5 ′ -TGA CAC CGT ACC TGC TCT AGT GCG CAC TGA ACG ATC CTG CGT CAA GTT CAA GGT TGT GAA GCA CGC CAA GGG ACT AT-3 ′ | - 11.71 | step2c_literal_v3 | ||||
| 453 | bilirubin | protein | P22309 | Brb7 | GACGACATAAGCTCTTAGCGCGTGTTTACCACCTTTGTCGTC | 1.4e-06 M | -5.854 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | 7.6 | selection buffer | DNA | 40669049 | 10.1021/acschembio.5c00438 | After titrating bilirubin into 1.0 μM Brb7 aptamer, the saturation fluorescence decrease reached 99% (Figure 6A) and its K d was fitted to be 1.4 μM | step2c_acs_v1 | ||||
| 451 | biliverdin | protein | P53004 | Bvd1 | GACGACGAACGGAGTAGGTTTTAACGAATGAAATGGGTCGTC | 2e-06 M | -5.699 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | 7.6 | selection buffer | DNA | 40669049 | 10.1021/acschembio.5c00438 | The same trend was also observed for the Bvd1 aptamer (Figure S1), and the fitted K d was 2.0 μM. | step2c_acs_v1 | ||||
| 122 | hemin | protein | Q9NP58 | Sequence D | GGTTGGTGTGGTTGG | 2.9 μM | -5.538 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | fluorescence | 7.4 | 10 mM K-phosphate, pH 7.4, 0.1 M KCl, and 1% DMSO | DNA | phosphorothioate (Sp, stereopure) | 40368877 | 10.1021/acs.molpharmaceut.5c00117 | Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 μ M for sequences C and D, respectively. | step2c_literal_v3 | |||
| 123 | hemin | protein | Q9NP58 | Sequence C | GGTTGGTGTGGTTGG | 8.3 μM | -5.081 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | fluorescence | 7.4 | 10 mM K-phosphate, pH 7.4, 0.1 M KCl, and 1% DMSO | DNA | phosphorothioate (Rp, stereopure) | 40368877 | 10.1021/acs.molpharmaceut.5c00117 | Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 μ M for sequences C and D, respectively. | step2c_literal_v3 | |||
| 454 | bilirubin | protein | P22309 | Brb9 | GACGACGAATGCAATGGGGCCTGCCGAACGTCTTTAGGATTT | 9e-06 M | -5.046 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | 7.6 | selection buffer | DNA | 40669049 | 10.1021/acschembio.5c00438 | The same trend was also observed in the Brb9 aptamer (Figure S4), which showed a K d of 9.0 μM. | step2c_acs_v1 | ||||
| 468 | L-lactate | protein | Q9BYZ2 | D-Lac1103 | TGATGTCGTC | 8.999999999999999e-05 M | -4.046 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | backfill_text_verified | fluorescence | DNA | FAM | 41779931 | 10.1021/acs.analchem.5c07149 | The true K d for D-Lac1103 was calculated to be 0.09 mM for L-lactate | step2c_acs_v1 | |||||
| 469 | D-lactate | protein | Q86WU2 | D-Lac1103 | TGATGTCGTC | 0.0025 M | -2.602 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | backfill_text_verified | fluorescence | 295.15 | SELEX buffer | DNA | FAM | 41779931 | 10.1021/acs.analchem.5c07149 | In addition, the apparent K d values for D-Lac1103 are 0.46 mMfor L-lactate and 2.5 mM for D-lactate | step2c_acs_v1 | |||
| 438 | acrylamide | protein | P41145 | AA-1 | GACGACGGAATCCTGGTGCACGTTGGTGGAGGTCACGTCGTC | 0.0047 M | -2.328 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | 7.4 | 20 mM HEPES buffer (pH 7.4) with 100 mM NaCl and 1 mM MgCl2 | DNA | 40261307 | 10.1021/acs.analchem.5c00783 | Similarly, the AA-1 aptamer exhibited a true K d value of 4.7 mM via the strand-displacement assay | step2c_acs_v1 | ||||
| 437 | acrylamide | protein | P41145 | AA-1 | GACGACGGAATCCTGGTGCACGTTGGTGGAGGTCACGTCGTC | 0.0105 M | -1.979 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | 7.4 | 20 mM HEPES pH 7.4, 100 mM NaCl, and 1 mM MgCl2 | DNA | 40261307 | 10.1021/acs.analchem.5c00783 | the fitted K d value was 10.5 mM | step2c_acs_v1 |
Advanced export
JSON shape: default, array, newline-delimited
CREATE VIEW v_kd AS
SELECT k.id,
target_name_canonical,
CASE
WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
ELSE 'protein'
END AS target_type,
target_uniprot, aptamer_name, aptamer_seq,
(COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
CASE
WHEN vh.verdict='confirmed' THEN 'human_verified'
WHEN vh.verdict='corrected' THEN 'human_corrected'
WHEN vh.verdict='rejected' THEN 'human_rejected'
WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
ELSE 'automated'
END AS verification_level,
sequence_status, seq_source, pi_provenance_flag,
assay_method,
CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';