Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

47 rows where assay_method = "fluorescence" and tier = "Gold" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: target_name_canonical, target_uniprot, aptamer_seq, seq_source, assay_temperature_k, assay_ph, assay_buffer, assay_cations, aptamer_modifications, source_pmid, doi, source_db

measurement_class 3

verification_level 2

target_type 2

tier 1

  • Gold · 47 ✖

binding_constant_type 1

assay_method 1

  • fluorescence · 47 ✖
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
219 CCRF-CEM cells cell/EV Q9NRR3 CDN-sgc8   0.08 nM -10.097 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     fluorescence     1 × PBS, 5 mM MgCl2 5.0 DNA biotinylated 35670775 10.1021/acs.analchem.2c01359 Kd=0.08±0.01 nM step2c_literal_v3
218 CCRF-CEM cells cell/EV Q9NRR3 mono-CDN-sgc8   0.48 nM -9.319 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     fluorescence     1 × PBS, 5 mM MgCl2 5.0 DNA biotinylated 35670775 10.1021/acs.analchem.2c01359 Kd= 0.48 ± 0.04 nM step2c_literal_v3
217 CCRF-CEM cells cell/EV Q9NRR3 individual sgc8   0.82 nM -9.086 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     fluorescence     1 × PBS, 5 mM MgCl2 5.0 DNA biotinylated 35670775 10.1021/acs.analchem.2c01359 Kd=0.82 ± 0.12 nM step2c_literal_v3
432 Sc3+ protein Q96PL5 Sc-1 CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC 1e-09 M -9.0 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence     SELEX buffer   DNA   39743479 10.1021/jacs.4c13768 true K d for the binding of Sc-1 to Sc 3+ to be 1.0 nM step2c_acs_v1
328 ATP protein P00846 Huizenga-Szostak ATP aptamer   1.3e-09 M -8.886 intrinsic Kd Gold v4 multi_agent_verified pending_supp_oa     fluorescence         DNA   25170558 10.1021/bc500286r binding a ffi nity can be tuned over 4 orders of magnitude (1.3 nM -203 μ M) step2c_acs_v1
348 NP protein Q16612 NP-C04   8.1e-09 M -8.092 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence   7.4 20 mM HEPES, 150 mM NaCl, 2 mM KCl, 2 mM MgCl2, and 2 mM CaCl2 (pH 7.4)   DNA FAM 30740973 10.1021/acs.analchem.8b04623 the K d values of NP-D01, NP-C04, and NP-D02 were 76..1 ± 10.9, 8.1 ± 2.4, and 41.3 ± 9.5 nM, respectively. step2c_acs_v1
431 Sc3+ protein Q96PL5 Sc-1 CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC 1.0300000000000001e-08 M -7.987 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence     SELEX buffer   DNA   39743479 10.1021/jacs.4c13768 an apparent K d value of 10.3 nM was obtained step2c_acs_v1
476 Escherichia coli O157:H7 protein   E. coli O157:H7-specific aptamer CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG 1.4400000000000002e-08 M -7.842 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence 298.15   15% (v/v) PEG200   DNA FAM 41850902 10.1021/acs.analchem.5c07364 the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM). step2c_acs_v1
475 Escherichia coli O157:H7 protein   E. coli O157:H7-specific aptamer CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG 1.92e-08 M -7.717 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence 298.15   liquid milk-based matrices (0% lactalbumin/lactose/casein)   DNA FAM 41850902 10.1021/acs.analchem.5c07364 the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM). step2c_acs_v1
424 verrucarin A protein   Ver1_JYP   2.9500000000000003e-08 M -7.53 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence   7.4 SELEX buffer   DNA   39404132 10.1021/acs.analchem.4c03307 The novel ssDNA aptamer exhibited a binding affinity of 29.5 nM step2c_acs_v1
354 paramylon protein   Par-15   3.49e-08 M -7.457 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence   7.5 binding buffer (50 mM Tris, 150 mM NaCl, 5 mM MgCl2, 1 mM EDTA, pH 7.5)   DNA FAM 31809034 10.1021/acs.jafc.9b04588 The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 ± 2.61, 34.90 ± 5.83, 64.06 ± 6.72, 123.81 ± 13.41, and 249.52 ± 46.39 nM, respectively. step2c_acs_v1
355 paramylon protein   Par-18   6.406e-08 M -7.193 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence   7.5 binding buffer (50 mM Tris, 150 mM NaCl, 5 mM MgCl2, 1 mM EDTA, pH 7.5)   DNA FAM 31809034 10.1021/acs.jafc.9b04588 The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 ± 2.61, 34.90 ± 5.83, 64.06 ± 6.72, 123.81 ± 13.41, and 249.52 ± 46.39 nM, respectively. step2c_acs_v1
135 SCAF4 protein O95104 PTf-SRiApt TTAAAGGGGTGGGGAGTCAT 0.073 µM -7.137 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence   6.5 30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm β-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA   DNA phosphorothioate 40574704 10.1002/advs.202500433 0.073 ± 0.003 µ m for PTf -SRiApt step2c_literal_v3
52 hemagglutinin (HA) protein of H1N1 influenza virus (A/Puerto Rico/8/1934) protein   aptamer 1 GGGAGCTCAGAATAAACGCTCAAGGCACGGCATGTGTGGTATGTGGTGCCTGTACTCGTTCGACATGAGGCCCGGATC 78.0 nM -7.108 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence 310.15 7.35 binding buffer (20 mM HEPES buffer pH 7.35, 120 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, and 5 mM KCl) 1.0 DNA   26904922 10.1089/nat.2015.0564 As it showed a higher binding affinity for HA protein (Kd = 78 -1nM), aptamer 1 was tested step2c_literal_v3
400 6'-sialyllactose protein Q9Y3R4 Apt9-1   9.175000000000001e-08 M -7.037 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence 298.15 7.4 10 mM PBS (pH 7.4)   DNA   36700646 10.1021/acs.jafc.2c07784 A 35 nt truncated aptamer Apt9-1 ( K d = 91.75 nM) with higher affinity than Apt9 was finally obtained. step2c_acs_v1
102 CD9 protein P21926 CD9-26 ATAGTCCCTTGGCGTGCTTCACAACCTTGAACTTGACGCAGGATCGTTCAGTGCGCACTAGAGCAGGTACGGTGTCA 101.96 nM -6.992 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence 277.15   1 × SELEX buffer   DNA   37585601 10.1021/acssensors.3c00879 CD9-26 | 5 ′ -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG TGC GCA CTA GAG CAG GTA CGG TGT CA-3 ′ | - 8.92 step2c_literal_v3
474 Moraxella osloensis protein   MO9 GCATTCAGAGCCATCCACCCTGAAGGTGGCGTATATCGATGTTCGGGACGCCGTGCCTGTTGCGTACGAATGG 1.1890000000000001e-07 M -6.925 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence         DNA thiolated 41784024 10.1021/acssensors.5c03424 high-a ffi nity aptamer (K d = 118.9 nM) step2c_acs_v1
134 SCAF4 protein O95104 PT1/2-SRiApt TTAAAGGGGTGGGGAGTCAT 0.121 µM -6.917 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence   6.5 30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm β-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA   DNA phosphorothioate 40574704 10.1002/advs.202500433 0.121 ± 0.054 µ m for PT1/2 -SRiApt step2c_literal_v3
436 SIRT2 protein Q8IXJ6 Apt 45   1.233e-07 M -6.909 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence 310.15       DNA FAM 40200675 10.1021/acs.analchem.5c00066 selected Apt 45 ( K d = 123.3 nM) to fabricate the 'turn-on' fluorescent biosensor step2c_acs_v1
399 6'-sialyllactose protein Q9Y3R4 Apt9   1.5230000000000003e-07 M -6.817 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence 298.15 7.4 10 mM PBS (pH 7.4)   DNA   36700646 10.1021/acs.jafc.2c07784 The ssDNA aptamer Apt9 ( K d = 152.3 nM) with a length of 79 nucleotides (nt) was demonstrated as the optimal aptamer candidate step2c_acs_v1
133 SCAF4 protein O95104 PT1/3-SRiApt TTAAAGGGGTGGGGAGTCAT 0.223 µM -6.652 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence   6.5 30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm β-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA   DNA phosphorothioate 40574704 10.1002/advs.202500433 0.223 ± 0.030 µ m for PT 1/3 -SRiApt step2c_literal_v3
467 benzovindiflupyr protein   Apt.BZF01   2.2650000000000002e-07 M -6.645 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence         DNA   41614999 10.1021/acs.jafc.5c15044 corrected KDs of 226.5 nM (Apt.BZF01) step2c_acs_v1
103 CD9 protein P21926 CD9-28 ATAGTCCCTTGGCGTGCTTCACAACCTTGAACTTGACGCAGGATCGTTCAGGGCGCACTAGAGCAGGTACGGTGTCA 289.67 nM -6.538 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence 277.15   1 × SELEX buffer   DNA   37585601 10.1021/acssensors.3c00879 CD9-28 | 5 ′ -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG GGC GCA CTA GAG CAG GTA CGG TGT CA-3 ′ | - 8.80 step2c_literal_v3
450 biliverdin protein P53004 Bvd4 GACGACGGGTGTGGAACAGTGCGAATACTTTCGAGTCGTC 4.0999999999999994e-07 M -6.387 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence   7.6 selection buffer   DNA   40669049 10.1021/acschembio.5c00438 Titration of biliverdin into 1 μM Bvd4 aptamer led to an approximate 90% fluorescence drop (Figure 3A), and the fitted dissociation constant ( K d ) was 0.41 μM step2c_acs_v1
132 SCAF4 protein O95104 SRiApt TTAAAGGGGTGGGGAGTCAT 0.469 µM -6.329 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence   6.5 30 mM MES buffer pH 6.5, 25 mm NaCl, 2 mm β-ME, 1 mm CHAPS, and 0.002 mg mL -1 BSA   DNA   40574704 10.1002/advs.202500433 The binding affinities (K D ) were determined to be 0.469 ± 0.010 µ m for unmodified SRiApt step2c_literal_v3
246 CD9 protein P21926 CD9-08 TGACACCGTACCTGCTCTAGTGCGCACTGAACGATCCTGCGTCAAGTTCAAGGTTGTGAAGCACGCCAAGGGACTAT 494.37 nM -6.306 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence 277.15   1 × SELEX buffer   DNA   37585601 10.1021/acssensors.3c00879 CD9-08 | 5 ′ -TGA CAC CGT ACC TGC TCT AGT GCG CAC TGA ACG ATC CTG CGT CAA GTT CAA GGT TGT GAA GCA CGC CAA GGG ACT AT-3 ′ | - 11.71 step2c_literal_v3
453 bilirubin protein P22309 Brb7 GACGACATAAGCTCTTAGCGCGTGTTTACCACCTTTGTCGTC 1.4e-06 M -5.854 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence   7.6 selection buffer   DNA   40669049 10.1021/acschembio.5c00438 After titrating bilirubin into 1.0 μM Brb7 aptamer, the saturation fluorescence decrease reached 99% (Figure 6A) and its K d was fitted to be 1.4 μM step2c_acs_v1
451 biliverdin protein P53004 Bvd1 GACGACGAACGGAGTAGGTTTTAACGAATGAAATGGGTCGTC 2e-06 M -5.699 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence   7.6 selection buffer   DNA   40669049 10.1021/acschembio.5c00438 The same trend was also observed for the Bvd1 aptamer (Figure S1), and the fitted K d was 2.0 μM. step2c_acs_v1
425 verrucarin A protein   14_Ver1   2.2e-06 M -5.658 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence   7.4 SELEX buffer   DNA 6-FAM at 5'-end; dabcyl at 3'-end 39404132 10.1021/acs.analchem.4c03307 The binding test demonstrated that the decrease in fluorescence was correlated with increasing verrucarin A concentration with K D = 2.2 μM. step2c_acs_v1
426 verrucarin A protein   Ver1_JYP (C32G mutant)   2.2999999999999996e-06 M -5.638 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence   7.4 SELEX buffer   DNA C32G mutation 39404132 10.1021/acs.analchem.4c03307 guanine with both functional groups exhibited partially recovered binding activity ( K D = 2.3 μM). step2c_acs_v1
122 hemin protein Q9NP58 Sequence D GGTTGGTGTGGTTGG 2.9 μM -5.538 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence   7.4 10 mM K-phosphate, pH 7.4, 0.1 M KCl, and 1% DMSO   DNA phosphorothioate (Sp, stereopure) 40368877 10.1021/acs.molpharmaceut.5c00117 Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 μ M for sequences C and D, respectively. step2c_literal_v3
123 hemin protein Q9NP58 Sequence C GGTTGGTGTGGTTGG 8.3 μM -5.081 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   fluorescence   7.4 10 mM K-phosphate, pH 7.4, 0.1 M KCl, and 1% DMSO   DNA phosphorothioate (Rp, stereopure) 40368877 10.1021/acs.molpharmaceut.5c00117 Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 μ M for sequences C and D, respectively. step2c_literal_v3
454 bilirubin protein P22309 Brb9 GACGACGAATGCAATGGGGCCTGCCGAACGTCTTTAGGATTT 9e-06 M -5.046 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence   7.6 selection buffer   DNA   40669049 10.1021/acschembio.5c00438 The same trend was also observed in the Brb9 aptamer (Figure S4), which showed a K d of 9.0 μM. step2c_acs_v1
463 Patulin protein   PTL-1   1.8399999999999997e-05 M -4.735 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence   6.0 selection buffer (10 mM MES, pH 6.0, 150 mM NaCl, 5 mM MgCl2)   DNA   41473783 10.1186/s44280-025-00101-2 yielding an apparent K d of 18.4 μM step2c_acs_v1
124 dehydroepiandrosterone sulfate protein Q06520 DHEAS aptamer (stem, Rp)   32.03 μM -4.494 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     fluorescence   8.0 20 mM Tris Buffer, 1 M NaCl, 10 mM MgCl2, pH 8.0 10.0 DNA phosphorothioate (Rp, stereopure); fluorescein 40368877 10.1021/acs.molpharmaceut.5c00117 Values calculated are 32.03 μ M for stem Rp step2c_literal_v3
126 dehydroepiandrosterone sulfate protein Q06520 DHEAS aptamer (loop, Rp)   33.28 μM -4.478 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     fluorescence   8.0 20 mM Tris Buffer, 1 M NaCl, 10 mM MgCl2, pH 8.0 10.0 DNA phosphorothioate (Rp, stereopure); fluorescein 40368877 10.1021/acs.molpharmaceut.5c00117 33.28 μ M for loop Rp step2c_literal_v3
125 dehydroepiandrosterone sulfate protein Q06520 DHEAS aptamer (stem, Sp)   36.57 μM -4.437 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     fluorescence   8.0 20 mM Tris Buffer, 1 M NaCl, 10 mM MgCl2, pH 8.0 10.0 DNA phosphorothioate (Sp, stereopure); fluorescein 40368877 10.1021/acs.molpharmaceut.5c00117 36.57 μ M for stem Sp step2c_literal_v3
464 Patulin protein   PAT-6   4.8e-05 M -4.319 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence   6.0 20 mM MES buffer, pH = 6.0, with 150 mM NaCl and 2.0 mM MgCl2   DNA   41473783 10.1186/s44280-025-00101-2 PAT-6 has weaker binding affinities ( Kd = 48 μM by ThT, Fig. 4S) step2c_acs_v1
127 dehydroepiandrosterone sulfate protein Q06520 DHEAS aptamer (loop, Sp)   59.62 μM -4.225 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     fluorescence   8.0 20 mM Tris Buffer, 1 M NaCl, 10 mM MgCl2, pH 8.0 10.0 DNA phosphorothioate (Sp, stereopure); fluorescein 40368877 10.1021/acs.molpharmaceut.5c00117 59.62 μ M for loop Sp step2c_literal_v3
468 L-lactate protein Q9BYZ2 D-Lac1103 TGATGTCGTC 8.999999999999999e-05 M -4.046 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI backfill_text_verified   fluorescence         DNA FAM 41779931 10.1021/acs.analchem.5c07149 The true K d for D-Lac1103 was calculated to be 0.09 mM for L-lactate step2c_acs_v1
471 L-lactate protein Q9BYZ2 Lac201   0.0009000000000000001 M -3.046 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence 296.15   SELEX buffer   DNA 2AP 41779931 10.1021/acs.analchem.5c07149 the fitted K d was 0.9 mM (Figure 5C, black line) step2c_acs_v1
469 D-lactate protein Q86WU2 D-Lac1103 TGATGTCGTC 0.0025 M -2.602 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI backfill_text_verified   fluorescence 295.15   SELEX buffer   DNA FAM 41779931 10.1021/acs.analchem.5c07149 In addition, the apparent K d values for D-Lac1103 are 0.46 mMfor L-lactate and 2.5 mM for D-lactate step2c_acs_v1
457 Tris(hydroxymethyl)aminomethane protein   Tris aptamer   0.0026000000000000003 M -2.585 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence         DNA   40905906 10.1021/acs.analchem.5c03351 ThT yielded K d values changed modestly from 1.6 to 2.6 mM step2c_acs_v1
473 L-lactate protein Q9BYZ2 Lac2059   0.0033 M -2.481 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence 296.15   SELEX buffer   DNA 2AP 41779931 10.1021/acs.analchem.5c07149 The fitted K d was 3.3 mM for this 2AP-labeled aptamer step2c_acs_v1
472 L-lactate protein Q9BYZ2 Lac201   0.0043 M -2.367 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     fluorescence 296.15   SELEX buffer   DNA 2AP 41779931 10.1021/acs.analchem.5c07149 although the obtained K d (4.3 mM) was about 5-fold higher than that obtained using Mg 2+ . step2c_acs_v1
438 acrylamide protein P41145 AA-1 GACGACGGAATCCTGGTGCACGTTGGTGGAGGTCACGTCGTC 0.0047 M -2.328 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence   7.4 20 mM HEPES buffer (pH 7.4) with 100 mM NaCl and 1 mM MgCl2   DNA   40261307 10.1021/acs.analchem.5c00783 Similarly, the AA-1 aptamer exhibited a true K d value of 4.7 mM via the strand-displacement assay step2c_acs_v1
437 acrylamide protein P41145 AA-1 GACGACGGAATCCTGGTGCACGTTGGTGGAGGTCACGTCGTC 0.0105 M -1.979 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence   7.4 20 mM HEPES pH 7.4, 100 mM NaCl, and 1 mM MgCl2   DNA   40261307 10.1021/acs.analchem.5c00783 the fitted K d value was 10.5 mM step2c_acs_v1

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';