Binding affinities (Kd) — source-verified (view)
Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target
- target_name_canonical
- Target as named in the source paper.
- target_type
- protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
- target_uniprot
- UniProt accession when a human protein (sparse for now; links to apt-scout target).
- aptamer_name
- Aptamer identifier as reported.
- kd_reported
- Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
- kd_log10_molar
- log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
- measurement_class
- intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
- binding_constant_type
- Kd / apparent-Kd etc. as reported.
- assay_method
- SPR / filter binding / flow cytometry / ITC / BLI …
- assay_temperature_k
- Assay temperature (K) — a reason the same pair can have several rows.
- source_pmid
- PubMed ID of the source paper (links out).
- verbatim_quote
- The exact sentence the value was taken from.
- verification_level
- QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
- sequence_status
- Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
- pi_provenance_flag
- PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
- seq_source
- original (already in source DB) / backfill_text_verified (recovered from paper or SI text).
739 rows where binding_constant_type = "Kd" sorted by kd_log10_molar
This data as json, CSV (advanced)
Suggested facets: source_origin, seq_source, pi_provenance_flag, assay_temperature_k, assay_ph, assay_cations, aptamer_chemistry, source_db
assay_method 27
- flow_cytometry 102
- SPR 78
- fluorescence 47
- MST 29
- filter_binding 28
- BLI 27
- ITC 12
- ELISA 11
- CE-LIF 10
- affinity_real_time_qPCR 8
- QCM 7
- BSI 4
- dot_blot 4
- PISA 3
- ELONA 2
- EMSA 2
- FACS 2
- mass_spectrometry 2
- microcantilever 2
- microscale thermophoresis 2
- ALISA 1
- DPV 1
- ELAA 1
- NECEEM 1
- qPCR 1
- qRT-PCR 1
- saturation_binding 1
sequence_status 5
measurement_class 4
- intrinsic 552
- non_intrinsic 155
- apparent_cellular 16
- avidity_multivalent 16
target_type 3
- protein 712
- cell/EV 15
- glycan/conjugate 12
verification_level 2
tier 1
- Gold 739
binding_constant_type 1
- Kd · 739 ✖
| id | target_name_canonical | target_type | target_uniprot | aptamer_name | aptamer_seq | kd_reported | kd_log10_molar ▼ | measurement_class | binding_constant_type | tier | source_origin | verification_level | sequence_status | seq_source | pi_provenance_flag | assay_method | assay_temperature_k | assay_ph | assay_buffer | assay_cations | aptamer_chemistry | aptamer_modifications | source_pmid | doi | verbatim_quote | source_db |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 188 | PDGF-BB | protein | P01127 | 36aApt | 0.036 pM | -13.444 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | ELISA | 298.0 | DNA | 28825469 | 10.1021/acscombsci.6b00163 | 36aApt | 0.036 ± 0.012 | - 18.33 | step2c_literal_v3 | |||||||
| 186 | PDGF-BB | protein | P01127 | 38aApt | 0.094 pM | -13.027 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | ELISA | 298.0 | DNA | 28825469 | 10.1021/acscombsci.6b00163 | 38aApt | 0.094 ± 0.008 | - 17.76 | step2c_literal_v3 | |||||||
| 44 | IL-8 | protein | P10145 | 8A-35 | GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC | 1.72e-12 M | -11.764 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.0 | 7.4 | HBST running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, and 0.005% Tween 20) | 2'F-RNA | 2'-fluoro-pyrimidine modified | 24129312 | 10.1016/j.biomaterials.2013.09.107 | | 8A-35 | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80 | 3.11 x 10 1 | | step2c_literal_v3 | ||
| 598 | human α-Thrombin | protein | P00734 | A1 | 2.0 pM | -11.699 | intrinsic | Kd | Gold | elsevier | extraction_verified | pending_manual_supp | text | 31129134 | 10.1016/j.ab.2019.05.012 | Also for aptamer A1 we measured with MST KD values in the pico- and nanomolar range (2 pM and 52 nM). The lowest KD value is determined with MST (shown as bar) for aptamer A1, which is 2 pM. | elsevier_step2c | |||||||||
| 406 | SARS-CoV-2 spike protein (wild type) | protein | DSA1N5 | 3e-12 M | -11.523 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | dot_blot | undiluted wastewater | DNA | dimeric | 36926840 | 10.1021/acssensors.2c02655 | DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B). | step2c_acs_v1 | |||||||
| 621 | nucleolin | protein | P19338 | Cy5-AT11-B0 | TGGTGGTGGTTGGTGGTGGTGGTGGT | 3.3e-12 M | -11.481 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 31301466 | 10.1016/j.ijpharm.2019.118511 | yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8 | elsevier_step2c | |||||||
| 208 | SW480 cells | cell/EV | Q16520 | Apt-nanovesicle | 3.66 pM | -11.437 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | DNA | cholesterol; multivalent | 32049531 | 10.1021/jacs.9b13782 | The dissociation constant ( K d ) value of Apt-nanovesicle against SW480 cells was found to be 3.66 ± 0.34 pM (Figure 2B) | step2c_literal_v3 | ||||||||
| 743 | SARS-CoV-2 spike protein (wild type) | protein | DSA1N5 | 3.9e-12 M | -11.409 | avidity_multivalent | Kd | Gold | ACS | multi_agent_verified | pending_manual_supp | dot_blot | undiluted wastewater | DNA | dimeric | 36926840 | 10.1021/acssensors.2c02655 | DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B). | step2c_acs_v1 | |||||||
| 404 | SARS-CoV-2 pseudotyped lentivirus (omicron variant) | protein | DSA1N5 | 4.8e-12 M | -11.319 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | dot_blot | deionized water | DNA | dimeric | 36926840 | 10.1021/acssensors.2c02655 | This study demonstrates that DSA1N5 has high affinity for recognizing OMPV with a K d value of 4.8 pM, which is in the same order of magnitude as that measured for the WTPV (2.1 pM) in deionized water (DI water) | step2c_acs_v1 | |||||||
| 405 | SARS-CoV-2 pseudotyped lentivirus (omicron variant) | protein | DSA1N5 | 5.1e-12 M | -11.292 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | dot_blot | wastewater (diluted 50% with binding buffer) | DNA | dimeric | 36926840 | 10.1021/acssensors.2c02655 | DSA1N5 preserves its binding affinity in 50% wastewater ( K d = 2.1 -4.1 pM for WTPV and 5.1 for OMPV in wastewater). | step2c_acs_v1 | |||||||
| 620 | nucleolin | protein | P19338 | Cy5-AT11 | TGGTGGTGGTTGTTGTGGTGGTGGTGGT | 5.2e-12 M | -11.284 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 31301466 | 10.1016/j.ijpharm.2019.118511 | yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8 | elsevier_step2c | |||||||
| 184 | PDGF-BB | protein | P01127 | FullApt | 5.33 pM | -11.273 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | ELISA | 298.0 | DNA | 28825469 | 10.1021/acscombsci.6b00163 | FullApt | 5.33 ± 2.36 | - 15.37 | step2c_literal_v3 | |||||||
| 185 | PDGF-BB | protein | P01127 | 40Apt | 5.92 pM | -11.228 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | ELISA | 298.0 | DNA | 28825469 | 10.1021/acscombsci.6b00163 | 40Apt | 5.92 ± 1.13 | - 15.31 | step2c_literal_v3 | |||||||
| 187 | PDGF-BB | protein | P01127 | 38bApt | 7.03 pM | -11.153 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | ELISA | 298.0 | DNA | 28825469 | 10.1021/acscombsci.6b00163 | 38bApt | 7.03 ± 1.28 | - 15.21 | step2c_literal_v3 | |||||||
| 618 | nucleolin | protein | P19338 | Cy5-AT11 | TGGTGGTGGTTGTTGTGGTGGTGGTGGT | 9.1e-12 M | -11.041 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 31301466 | 10.1016/j.ijpharm.2019.118511 | K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4 | elsevier_step2c | |||||||
| 619 | nucleolin | protein | P19338 | Cy5-AT11-B0 | TGGTGGTGGTTGGTGGTGGTGGTGGT | 9.5e-12 M | -11.022 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 31301466 | 10.1016/j.ijpharm.2019.118511 | K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4 | elsevier_step2c | |||||||
| 269 | thrombin | protein | P00734 | HD1-12A-DAB | 13.1 pM | -10.883 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | filter_binding | selection buffer | DNA | 41053535 | 10.1002/advs.202509867 | HD1-12A-DAB EXACT inhibitor bound to thrombin and prothrombin with K D s of 13.1 pm | step2c_literal_v3 | |||||||
| 143 | P-selectin | protein | Q14242 | PF377 | 14.0 pM | -10.854 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 310.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF377 | 14 | step2c_literal_v3 | ||||
| 147 | P-selectin | protein | Q14242 | PF377sl | 14.0 pM | -10.854 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 296.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF377sl | 14 | step2c_literal_v3 | ||||
| 142 | P-selectin | protein | Q14242 | PF377 | 16.0 pM | -10.796 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 310.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF377 | 16 | step2c_literal_v3 | ||||
| 144 | P-selectin | protein | Q14242 | PF377 | 18.0 pM | -10.745 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 277.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF377 | 18 | step2c_literal_v3 | ||||
| 351 | thrombin | protein | P00734 | Supra-TBA15/29-GO | 1.9e-11 M | -10.721 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | pending_manual_supp | DNA | Graphene Oxide immobilization; poly(adenine) anchor | 31157200 | 10.3389/fchem.2019.00280 | Supra-TBA15 / 29-GO prepared with GO (40 μ g mL -1 ) at 60 ◦ C exhibited much higher binding affinity toward thrombin ( K d = 1.9 × 10 -11 M, Figure S10 , Supporting Information). | step2c_acs_v1 | ||||||||
| 623 | Malate Synthase | protein | Q8N0X4 | MS10-Trunc | GGTGGTGGTGG | 19.0 pM | -10.721 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | abstract | 31704587 | 10.1016/j.omtn.2019.09.026 | MS10-Trunc aptamer exhibited high af fi nity for MS (equilibrium dissociation constant [KD] 19 pM) | elsevier_step2c | |||||||
| 209 | SW480 cells | cell/EV | Q16520 | Fixed Apt-nanovesicle | 28.06 pM | -10.552 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | DNA | cholesterol; crosslinked | 32049531 | 10.1021/jacs.9b13782 | the K d value of fi xed Apt-nanovesicles to SW480 cells was increased to 28.06 ± 3.31 pM (Figure 2D) | step2c_literal_v3 | ||||||||
| 146 | P-selectin | protein | Q14242 | PF377sl | 29.0 pM | -10.538 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 310.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF377sl | 29 | step2c_literal_v3 | ||||
| 319 | VEGF165 | protein | P15692 | 3R02 Bivalent | TGTGGGGGTGGACTGGGTGGGTACCTTTTTTTTTTTGTGGGGGTGGACTGGGTGGGTACC | 3e-11 M | -10.523 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | 23237717 | 10.1021/ac303023d | The K d value of 30 pM for 3R02 Bivalent was calculated by measuring SPR. | step2c_acs_v1 | ||||||||
| 669 | bevacizumab | protein | P31995 | A14#1 | GCGGTTGGTGGTAGTTACGTTCGC | 44.0 pM | -10.357 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | abstract | 35114463 | 10.1016/j.bios.2022.114027 | affinity of A14#1 to bevacizumab markedly increased at pH 4.7 ( K D = 44 pM) | elsevier_step2c | |||||||
| 145 | P-selectin | protein | Q14242 | PF377sl | 46.0 pM | -10.337 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 310.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF377sl | 46 | step2c_literal_v3 | ||||
| 312 | thrombin | protein | P00734 | MP-TBA15/TBA29-T15 | GGTTGGTGTGGTTGG | 5.2e-11 M | -10.284 | avidity_multivalent | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | backfill_text_verified | saturation_binding | 7.4 | physiological buffer (25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 5.0 mM KCl, 1.0 mM MgCl2, 1.0 mM CaCl2) containing BSA (100 μM) | DNA | thiolated; 15-mer thymidine linker | 22300379 | 10.1021/la204651t | MP-TBA15/TBA29-T15 -Au NPs provided high flexibility and an appropriate orientation and distance between TBA and TBA units for bivalent binding, allowing stronger interactions with thrombin ( K d = 5.2 × 10 -11 M; Supporting Information, Figure S3) | step2c_acs_v1 | |||
| 148 | P-selectin | protein | Q14242 | PF373sl | 56.0 pM | -10.252 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 310.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF373sl | 56 | step2c_literal_v3 | ||||
| 9 | sLe X -BSA | glycan/conjugate | Q9NSU2 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 5.7e-11 M | -10.244 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 298.15 | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11 | step2c_literal_v3 | |
| 56 | von Willebrand factor A1-domain | protein | P04275 | Rn-DsDsDs-53mh | 61.3 pM | -10.213 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | SPR | 310.15 | 1 × PBS supplemented with 0.05% (w/v) Nonidet P-40 | DNA | Ds (7-(2-thienyl)imidazo[4,5b]pyridine); mini-hairpin DNA | 27966933 | 10.1021/jacs.6b10767 | RnDsDsDs-53mh ( K D = 61.3 pM) | step2c_literal_v3 | |||||
| 542 | Myoglobin | protein | P02144 | anti-Mb aptamer | 65.0 pM | -10.187 | intrinsic | Kd | Gold | elsevier | extraction_verified | pending_manual_supp | text | 25957831 | 10.1016/j.bios.2015.04.089 | The corresponding af fi nity, K D, values calculated from the ratio between dissociation ( k d) and association ( k a ) was found to be 65 pM. | elsevier_step2c | |||||||||
| 53 | von Willebrand factor A1-domain | protein | P04275 | Rn-DsDsDs-44 | 74.9 pM | -10.126 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | SPR | 310.15 | 1 × PBS supplemented with 0.05% (w/v) Nonidet P-40 | DNA | Ds (7-(2-thienyl)imidazo[4,5b]pyridine) | 27966933 | 10.1021/jacs.6b10767 | Rn-DsDsDs-44 ( K D = 74.9 pM) exhibited the highest a ffi nity | step2c_literal_v3 | |||||
| 219 | CCRF-CEM cells | cell/EV | Q9NRR3 | CDN-sgc8 | 0.08 nM | -10.097 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | fluorescence | 1 × PBS, 5 mM MgCl2 | 5.0 | DNA | biotinylated | 35670775 | 10.1021/acs.analchem.2c01359 | Kd=0.08±0.01 nM | step2c_literal_v3 | |||||
| 3 | sLe X -BSA | glycan/conjugate | Q9NSU2 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 8.5e-11 M | -10.071 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 298.15 | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11 | step2c_literal_v3 | |
| 152 | PDGF-BB | protein | P01127 | PDGF-B aptamer | 0.1 nM | -10.0 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | DNA | 2'-fluoro; 2'-O-methyl; hexaethylene glycol spacer; inverted 3'-3' thymidine cap; 40-kd PEG conjugated | 9916931 | 10.1016/S0002-9440(10)65263-7 | the binding affinity of the aptamer used in the experiments described below ( K d ≈ 0.1 nM) | step2c_literal_v3 | |||||||
| 547 | ofloxacin | protein | Q9H015 | Q2 | ATACCAGCTTATTCAATTGCAGGGTATCTGAGGCTTGATCTACTAAATGTCGTGGGGCATTGCTATTGGCGTTGATACGTACAATCGTAATCAGTTAG | 0.11 nM | -9.959 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 26547431 | 10.1016/j.bios.2015.10.069 | Their K D values were calculated at K D 1⁄4 0.11 nM ( 7 0.06) for aptamer Q2 | elsevier_step2c | |||||||
| 331 | MutS | protein | O15457 | 2-06 | ACTTCTGCCCGCCTCCTTCCTGGTAAAGTCATTAATAGGTGTGGGGTGCCGGGCATTTCGGAGACGAGATAGGCGGACACT | 1.23e-10 M | -9.91 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | 25668425 | 10.1021/acs.analchem.5b00171 | The best fi t was obtained at K d = 123 pM and [T]0 = 213 pM | step2c_acs_v1 | ||||||||
| 245 | MPO | protein | P05164 | MPO-16 | GTCTGGAAACGACGAGGGCCACTGATTAACGTAGTTAATTGGTCTTGTCG | 166.0 pM | -9.78 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | flow_cytometry | selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) | 2.5 | DNA | 37277648 | 10.1038/s41557-023-01207-z | MPO16 revealed the highest binding affinity ( K d = 166 pM) | step2c_literal_v3 | ||||
| 149 | P-selectin | protein | Q14242 | PF398sl | 178.0 pM | -9.75 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 310.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF398sl | 178 | step2c_literal_v3 | ||||
| 57 | von Willebrand factor A1-domain | protein | P04275 | Rn-DsDs-51mh2 | 182.0 pM | -9.74 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | SPR | 310.15 | 1 × PBS supplemented with 0.05% (w/v) Nonidet P-40 | DNA | Ds (7-(2-thienyl)imidazo[4,5b]pyridine); mini-hairpin DNA | 27966933 | 10.1021/jacs.6b10767 | Rn-DsDs-51mh2 ( K D = 182 pM) | step2c_literal_v3 | |||||
| 363 | HBcAg | protein | A-9 | AGCAGCACAGAGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCTACCGTGAA | 2.0000000000000003e-10 M | -9.699 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | affinity_real_time_qPCR | DNA | 32250595 | 10.1021/acs.analchem.9b05740 | This aptamer showed strong binding to HBcAg ( K d : 0.2 nM) | step2c_acs_v1 | |||||||
| 548 | ofloxacin | protein | Q9H015 | Q8 | ATACCAGCTTATTCAATTAGTTGTGTATTGAGGTTTGATCTAGGCATAGTCAACAGAGCACGATCGATCTGGCTTGTTCTACAATCGTAATCAGTTAG | 0.2 nM | -9.699 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 26547431 | 10.1016/j.bios.2015.10.069 | K D 1⁄4 0.20 nM ( 7 0.09) for aptamer Q8 | elsevier_step2c | |||||||
| 558 | OH-BDE47 | protein | BDE-A-8 | GACAGCCGGGGCATCAGAGCAGCCGATTGTCTGTTGTGCC | 0.2 nM | -9.699 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 27566357 | 10.1016/j.aca.2016.06.040 | The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition. | elsevier_step2c | ||||||||
| 234 | MPO | protein | P05164 | MPO-02 | TATGCGATTTCAAAAATGTTACGATGGATATTGACATTTAAATATGTCGG | 227.0 pM | -9.644 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | flow_cytometry | selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) | 2.5 | DNA | 37277648 | 10.1038/s41557-023-01207-z | MPO-02 ... 227 | step2c_literal_v3 | ||||
| 307 | P-selectin | protein | Q14242 | PF377sl | 250.0 pM | -9.602 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | flow_cytometry | 296.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF377sl | 250 | step2c_literal_v3 | ||||
| 639 | thrombin | protein | P00734 | 29-mer thrombin-specific aptamer | AGTCCGTGGTAGGGCAGGTTGGGGTGACT | 298.0 pM | -9.526 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 32570818 | 10.3390/s20123442 | The n-curve analysis provided a Kd of 298 pM ( + 111 / 81 pM) | elsevier_step2c | |||||||
| 318 | VEGF165 | protein | P15692 | 3R02 | TGTGGGGGTGGACTGGGTGGGTACC | 3e-10 M | -9.523 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | 23237717 | 10.1021/ac303023d | The K d value for 3R02 was 300 pM | step2c_acs_v1 | ||||||||
| 660 | 20 Methyl Spirolide G | protein | SPX 7 | GGCGGTGTGGGTACCACGAGGTTTGGACGCGCGTAGCACCCCATTCAGC | 3e-10 M | -9.523 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 34144421 | 10.1016/j.foodchem.2021.130332 | The present study, among the aptamers selected, the aptamer with highest affinity had a dissociation constant of 0.3 nM for SPX G | elsevier_step2c |
Advanced export
JSON shape: default, array, newline-delimited
CREATE VIEW v_kd AS
SELECT k.id,
target_name_canonical,
CASE
WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
ELSE 'protein'
END AS target_type,
target_uniprot, aptamer_name, aptamer_seq,
(COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
CASE
WHEN vh.verdict='confirmed' THEN 'human_verified'
WHEN vh.verdict='corrected' THEN 'human_corrected'
WHEN vh.verdict='rejected' THEN 'human_rejected'
WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
ELSE 'automated'
END AS verification_level,
sequence_status, seq_source, pi_provenance_flag,
assay_method,
CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';