Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

16 rows where measurement_class = "apparent_cellular", tier = "Gold" and verification_level = "multi_agent_verified" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: target_name_canonical, target_uniprot, aptamer_name, aptamer_seq, kd_log10_molar, assay_temperature_k, assay_ph, assay_buffer, aptamer_modifications, source_pmid, doi, verbatim_quote

assay_method 3

verification_level 1

  • multi_agent_verified · 16 ✖

tier 1

  • Gold · 16 ✖

target_type 1

measurement_class 1

  • apparent_cellular · 16 ✖

binding_constant_type 1

id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
313 Salmonella enteritidis protein P29460 SENT-9 CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT 7.000000000000001e-09 M -8.155 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 22971146 10.1021/ac302217u It was observed that the aptamer pool collected at the seventh round of selection had the highest binding a ffi nity to the bacteria ( K D = 7 nM). step2c_acs_v1
309 Streptococcus pyogenes M-type mixture protein   20A24P AAGCAGCACAGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTATGCGTGCTACCGTGAA 9.000000000000001e-09 M -8.046 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   flow_cytometry   7.4 binding buffer (1-BB; 50 mM Tris-HCl(pH7.4), 5 mM KCl, 100 mM NaCl, 1 mM MgCl2)   DNA 5'-FAM 21504182 10.1021/ac200575e Two aptamers, 20A24P and 15A3P (with estimated binding dissociation constants of 9 and 10 nM, respectively) step2c_acs_v1
310 Streptococcus pyogenes M-type mixture protein   15A3P ATTCACGGTAGCACGCATAGGGACAGCAAGCCCAAGCTGGGTGTGCAAGGTGAGGAGTGGG 1e-08 M -8.0 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   flow_cytometry   7.4 binding buffer (1-BB; 50 mM Tris-HCl(pH7.4), 5 mM KCl, 100 mM NaCl, 1 mM MgCl2)   DNA 5'-FAM 21504182 10.1021/ac200575e Two aptamers, 20A24P and 15A3P (with estimated binding dissociation constants of 9 and 10 nM, respectively) step2c_acs_v1
427 U87MG GBM with IDH1 htz mutation protein   Gli-55 GTCCGGTTCAACCTCTAGCATTCCTGGCGTTATTAACGGAGCAGTCCTGTGGAGTGGGTGA 1.22e-08 M -7.914 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   flow_cytometry 298.15   DPBS   DNA Cy5 39682297 10.3390/cancers16234111 The apparent dissociation constant measured for U87MG GBM with the IDH1 htz mutation ( Kd ) of Gli-55 is 12.2 nM step2c_acs_v1
428 U87MG GBM with IDH1 htz mutation protein   Gli-35 GCGTTATTAACGGAGCAGTCCTGTGGAGTGGGTGA 1.3600000000000001e-08 M -7.866 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   flow_cytometry 298.15   DPBS   DNA Cy5 39682297 10.3390/cancers16234111 while for Gli-35, it is 13.6 nM. step2c_acs_v1
476 Escherichia coli O157:H7 protein   E. coli O157:H7-specific aptamer CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG 1.4400000000000002e-08 M -7.842 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence 298.15   15% (v/v) PEG200   DNA FAM 41850902 10.1021/acs.analchem.5c07364 the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM). step2c_acs_v1
475 Escherichia coli O157:H7 protein   E. coli O157:H7-specific aptamer CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG 1.92e-08 M -7.717 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence 298.15   liquid milk-based matrices (0% lactalbumin/lactose/casein)   DNA FAM 41850902 10.1021/acs.analchem.5c07364 the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM). step2c_acs_v1
317 Salmonella typhimurium protein Q8IWE5 STYP-3 GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC 2.5000000000000002e-08 M -7.602 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 23075417 10.1021/ac302902s It was observed that the aptamer pool collected at the seventh round of selection had the highest binding a ffi nity to the bacteria ( K D = 25 nM). step2c_acs_v1
408 ASPH protein Q12797 AP-Cell 1 CGGGACAAGACAACGAACGAACAGGAAGAGAACCGGAATGCAGACGTCAGGG 4.751e-08 M -7.323 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   flow_cytometry     binding buffer (5 mM MgCl2, 4.5 g of glucose, 1 g BSA, and 100 mg yeast tRNA in 1 L Dulbecco's PBS)   DNA 5'-FAM 36959438 10.1007/s12033-023-00688-0 three proper oligomers, AP-Cell 1, AP-Cell 2, and AP-Cell 3 with reasonable dissociation constants ( K d ) of 47.51, 39.38, and 65.23 nM, respectively, were achieved. step2c_acs_v1
414 Salmonella typhimurium protein Q8IWE5 NTri-monoApt   5.7320000000000006e-08 M -7.242 apparent_cellular Kd Gold v4 multi_agent_verified pending_manual_supp     ELISA 310.15 7.5 PBS   DNA biotin 37893744 10.3390/foods12203853 the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively step2c_acs_v1
442 PTK7 protein Q13308 Sgc8c-Si6   5.7230000000000004e-08 M -7.242 apparent_cellular Kd Gold v4 multi_agent_verified pending_manual_supp     flow_cytometry 277.15   washing buffer supplemented with 1 mg/mL BSA and 1 mM yeast tRNA   DNA poly-Si 40415219 10.1021/acs.analchem.5c01062 Sgc8c-Si6 maintained strong binding affinity ( K d = 57.23 nM) step2c_acs_v1
409 ASPH protein Q12797 AP-Cell 3 CCGTATCGCCCAGGCAACTGGGCTAAACTTCCCAGAGGGAACGAAACCTGGG 6.523000000000001e-08 M -7.186 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   flow_cytometry     binding buffer (5 mM MgCl2, 4.5 g of glucose, 1 g BSA, and 100 mg yeast tRNA in 1 L Dulbecco's PBS)   DNA 5'-FAM 36959438 10.1007/s12033-023-00688-0 three proper oligomers, AP-Cell 1, AP-Cell 2, and AP-Cell 3 with reasonable dissociation constants ( K d ) of 47.51, 39.38, and 65.23 nM, respectively, were achieved. step2c_acs_v1
402 EpCAM protein P16422 SYL3C   9.700000000000001e-08 M -7.013 apparent_cellular Kd Gold v4 multi_agent_verified pending_manual_supp                   36856721 10.1021/acsami.2c22820 SYL3C can bind to SW480 cells (EpCAM+) with a K d of 97 nM step2c_acs_v1
474 Moraxella osloensis protein   MO9 GCATTCAGAGCCATCCACCCTGAAGGTGGCGTATATCGATGTTCGGGACGCCGTGCCTGTTGCGTACGAATGG 1.1890000000000001e-07 M -6.925 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence         DNA thiolated 41784024 10.1021/acssensors.5c03424 high-a ffi nity aptamer (K d = 118.9 nM) step2c_acs_v1
335 SW620 protein P41236 XL-33-1 CCCATCAATGTTACGACCCGCTAGGGCTGCTGTGCCATCGGGTAA 3.22e-07 M -6.492 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 25867099 10.1021/acs.analchem.5b00637 Binding affinity of XL-33-1 against SW620 at 37 ° C was found to be 322 nM. step2c_acs_v1
403 EpCAM protein P16422 TD05   7.92e-07 M -6.101 apparent_cellular Kd Gold v4 multi_agent_verified pending_manual_supp                   36856721 10.1021/acsami.2c22820 TD05's K d value is 792 nM step2c_acs_v1

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';