home / scout

Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

16 rows where measurement_class = "avidity_multivalent", tier = "Gold" and verification_level = "multi_agent_verified" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: target_name_canonical, target_uniprot, aptamer_name, aptamer_seq, source_origin, seq_source, assay_temperature_k, assay_ph, assay_buffer, aptamer_modifications, source_pmid, doi, verbatim_quote

assay_method 6

  • dot_blot 4
  • ELISA 2
  • MST 2
  • PISA 2
  • flow_cytometry 2
  • saturation_binding 1

sequence_status 3

  • pending_manual_supp 9
  • verified_in_text_or_SI 6
  • pending_manual_figure 1

verification_level 1

  • multi_agent_verified · 16 ✖

tier 1

  • Gold · 16 ✖

target_type 1

  • protein 16

measurement_class 1

  • avidity_multivalent · 16 ✖

binding_constant_type 1

  • Kd 16
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
406 SARS-CoV-2 spike protein (wild type) protein   DSA1N5   3e-12 M -11.523 avidity_multivalent Kd Gold v4 multi_agent_verified pending_manual_supp     dot_blot     undiluted wastewater   DNA dimeric 36926840 10.1021/acssensors.2c02655 DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B). step2c_acs_v1
743 SARS-CoV-2 spike protein (wild type) protein   DSA1N5   3.9e-12 M -11.409 avidity_multivalent Kd Gold ACS multi_agent_verified pending_manual_supp     dot_blot     undiluted wastewater   DNA dimeric 36926840 10.1021/acssensors.2c02655 DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B). step2c_acs_v1
404 SARS-CoV-2 pseudotyped lentivirus (omicron variant) protein   DSA1N5   4.8e-12 M -11.319 avidity_multivalent Kd Gold v4 multi_agent_verified pending_manual_supp     dot_blot     deionized water   DNA dimeric 36926840 10.1021/acssensors.2c02655 This study demonstrates that DSA1N5 has high affinity for recognizing OMPV with a K d value of 4.8 pM, which is in the same order of magnitude as that measured for the WTPV (2.1 pM) in deionized water (DI water) step2c_acs_v1
405 SARS-CoV-2 pseudotyped lentivirus (omicron variant) protein   DSA1N5   5.1e-12 M -11.292 avidity_multivalent Kd Gold v4 multi_agent_verified pending_manual_supp     dot_blot     wastewater (diluted 50% with binding buffer)   DNA dimeric 36926840 10.1021/acssensors.2c02655 DSA1N5 preserves its binding affinity in 50% wastewater ( K d = 2.1 -4.1 pM for WTPV and 5.1 for OMPV in wastewater). step2c_acs_v1
351 thrombin protein P00734 Supra-TBA15/29-GO   1.9e-11 M -10.721 avidity_multivalent Kd Gold v4 multi_agent_verified pending_manual_supp               DNA Graphene Oxide immobilization; poly(adenine) anchor 31157200 10.3389/fchem.2019.00280 Supra-TBA15 / 29-GO prepared with GO (40 μ g mL -1 ) at 60 ◦ C exhibited much higher binding affinity toward thrombin ( K d = 1.9 × 10 -11 M, Figure S10 , Supporting Information). step2c_acs_v1
319 VEGF165 protein P15692 3R02 Bivalent TGTGGGGGTGGACTGGGTGGGTACCTTTTTTTTTTTGTGGGGGTGGACTGGGTGGGTACC 3e-11 M -10.523 avidity_multivalent Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 23237717 10.1021/ac303023d The K d value of 30 pM for 3R02 Bivalent was calculated by measuring SPR. step2c_acs_v1
312 thrombin protein P00734 MP-TBA15/TBA29-T15 GGTTGGTGTGGTTGG 5.2e-11 M -10.284 avidity_multivalent Kd Gold v4 multi_agent_verified verified_in_text_or_SI backfill_text_verified   saturation_binding   7.4 physiological buffer (25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 5.0 mM KCl, 1.0 mM MgCl2, 1.0 mM CaCl2) containing BSA (100 μM)   DNA thiolated; 15-mer thymidine linker 22300379 10.1021/la204651t MP-TBA15/TBA29-T15 -Au NPs provided high flexibility and an appropriate orientation and distance between TBA and TBA units for bivalent binding, allowing stronger interactions with thrombin ( K d = 5.2 × 10 -11 M; Supporting Information, Figure S3) step2c_acs_v1
350 alkaline phosphatase protein P09923 ALP binding aptamer CTTCTGCCCGCCTCCTTCCTGGAGGACTGTGGAGGACTTAGCGCCCATCCTTGCCCATGGAGACGAGATAGGCGGACACTC 1.49e-09 M -8.827 avidity_multivalent Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   PISA   9.5 50 mM glycine-NaOH buffer (pH 9.5)   DNA 3'-thiol 30827094 10.1021/acs.analchem.9b00465 Similarly, from the response -dose curve (Figure 3B), the K d value for the aptamer -MIP hybrid-coated array was estimated to be 1.49 × 10 -9 M step2c_acs_v1
742 alkaline phosphatase protein P09923 ALP binding aptamer CTTCTGCCCGCCTCCTTCCTGGAGGACTGTGGAGGACTTAGCGCCCATCCTTGCCCATGGAGACGAGATAGGCGGACACTC 1.5000000000000002e-09 M -8.824 avidity_multivalent Kd Gold ACS multi_agent_verified verified_in_text_or_SI original   PISA         DNA 3'-thiol 30827094 10.1021/acs.analchem.9b00465 giving cross-reactivity of 3.2 -5.6% and a dissociation constant of 1.5 nM step2c_acs_v1
465 SARS-CoV-2 spike RBD protein   Aptx2-L   4.900000000000001e-09 M -8.31 avidity_multivalent Kd Gold v4 multi_agent_verified pending_manual_supp     flow_cytometry 298.15 7.4 PBS, pH 7.4, 0.55 mM MgCl2   DNA   41498844 10.1021/acsami.5c16490 The Aptx2-L variant showed superior affinity with a dissociation constant ( K d) of 4.9 nM step2c_acs_v1
412 Salmonella typhimurium protein Q8IWE5 NTri-triApt   1.1890000000000001e-08 M -7.925 avidity_multivalent Kd Gold v4 multi_agent_verified pending_manual_supp     ELISA 310.15 7.5 PBS   DNA biotin 37893744 10.3390/foods12203853 the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively step2c_acs_v1
336 VEGF-165 protein P15692 bivalent construct for VEGF-165 (no linker)   1.7e-08 M -7.77 avidity_multivalent Kd Gold v4 multi_agent_verified pending_manual_figure                   27043498 10.3390/molecules21040421 this bivalent construct had about 28-fold higher binding affinity ( K D = 17 nM) step2c_acs_v1
466 SARS-CoV-2 spike RBD protein   Aptx2-S   2.17e-08 M -7.664 avidity_multivalent Kd Gold v4 multi_agent_verified pending_manual_supp     flow_cytometry 298.15 7.4 PBS, pH 7.4, 0.55 mM MgCl2   DNA   41498844 10.1021/acsami.5c16490 compared to 21.7 nM for Aptx2-S step2c_acs_v1
434 Ara h1 protein P35354 CB-APT1 GTGCTCGGACTCCACTTGCGCTTCATTAACCGGGTTGCTCATTTATTCA 3.63e-08 M -7.44 avidity_multivalent Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   MST 298.15 7.2 1 × binding buffer   DNA   40083221 10.1021/acs.analchem.5c00270 Among them, CBAPT1 exhibited the strongest binding to Ara h1 with a K d value of 36.3 nM in aqueous solutions. step2c_acs_v1
413 Salmonella typhimurium protein Q8IWE5 NTri-biApt   4.3090000000000004e-08 M -7.366 avidity_multivalent Kd Gold v4 multi_agent_verified pending_manual_supp     ELISA 310.15 7.5 PBS   DNA biotin 37893744 10.3390/foods12203853 the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively step2c_acs_v1
435 Ara h1 protein P35354 CB-APT1 GTGCTCGGACTCCACTTGCGCTTCATTAACCGGGTTGCTCATTTATTCA 4.5000000000000006e-08 M -7.347 avidity_multivalent Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   MST 298.15 7.2 1 × binding buffer with 80% w/w total peanut proteins   DNA   40083221 10.1021/acs.analchem.5c00270 Notably, a similar binding affinity was observed even in a complex matrix that contained 80% w/w total peanut proteins ( K d = 45.0 nM, Figures 3 and S5). step2c_acs_v1

Advanced export

JSON shape: default, array, newline-delimited

CSV options:

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';
Powered by Datasette · Queries took 32.794ms · Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target