scout: v_kd: 16 rows where measurement_class = "avidity_multivalent", tier = "Gold" and verification_level = "multi_agent_verified" sorted by kd_log10

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical: Target as named in the source paper.
target_type: protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot: UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name: Aptamer identifier as reported.
kd_reported: Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar: log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class: intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type: Kd / apparent-Kd etc. as reported.
assay_method: SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k: Assay temperature (K) — a reason the same pair can have several rows.
source_pmid: PubMed ID of the source paper (links out).
verbatim_quote: The exact sentence the value was taken from.
verification_level: QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status: Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag: PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source: original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

16 rows where measurement_class = "avidity_multivalent", tier = "Gold" and verification_level = "multi_agent_verified" sorted by kd_log10_molar

descending

✎ View and edit SQL

This data as json, CSV (advanced)

id	target_name_canonical	target_type	target_uniprot	aptamer_name	aptamer_seq	kd_reported	kd_log10_molar ▼	measurement_class	binding_constant_type	tier	source_origin	verification_level	sequence_status	seq_source	assay_method	assay_temperature_k	assay_ph	assay_buffer	aptamer_chemistry	aptamer_modifications	source_pmid	doi	verbatim_quote	source_db
406	SARS-CoV-2 spike protein (wild type)	protein		DSA1N5		3e-12 M	-11.523	avidity_multivalent	Kd	Gold	v4	multi_agent_verified	pending_manual_supp		dot_blot			undiluted wastewater	DNA	dimeric	36926840	10.1021/acssensors.2c02655	DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B).	step2c_acs_v1
743	SARS-CoV-2 spike protein (wild type)	protein		DSA1N5		3.9e-12 M	-11.409	avidity_multivalent	Kd	Gold	ACS	multi_agent_verified	pending_manual_supp		dot_blot			undiluted wastewater	DNA	dimeric	36926840	10.1021/acssensors.2c02655	DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B).	step2c_acs_v1
404	SARS-CoV-2 pseudotyped lentivirus (omicron variant)	protein		DSA1N5		4.8e-12 M	-11.319	avidity_multivalent	Kd	Gold	v4	multi_agent_verified	pending_manual_supp		dot_blot			deionized water	DNA	dimeric	36926840	10.1021/acssensors.2c02655	This study demonstrates that DSA1N5 has high affinity for recognizing OMPV with a K d value of 4.8 pM, which is in the same order of magnitude as that measured for the WTPV (2.1 pM) in deionized water (DI water)	step2c_acs_v1
405	SARS-CoV-2 pseudotyped lentivirus (omicron variant)	protein		DSA1N5		5.1e-12 M	-11.292	avidity_multivalent	Kd	Gold	v4	multi_agent_verified	pending_manual_supp		dot_blot			wastewater (diluted 50% with binding buffer)	DNA	dimeric	36926840	10.1021/acssensors.2c02655	DSA1N5 preserves its binding affinity in 50% wastewater ( K d = 2.1 -4.1 pM for WTPV and 5.1 for OMPV in wastewater).	step2c_acs_v1
351	thrombin	protein	P00734	Supra-TBA15/29-GO		1.9e-11 M	-10.721	avidity_multivalent	Kd	Gold	v4	multi_agent_verified	pending_manual_supp						DNA	Graphene Oxide immobilization; poly(adenine) anchor	31157200	10.3389/fchem.2019.00280	Supra-TBA15 / 29-GO prepared with GO (40 μ g mL -1 ) at 60 ◦ C exhibited much higher binding affinity toward thrombin ( K d = 1.9 × 10 -11 M, Figure S10 , Supporting Information).	step2c_acs_v1
319	VEGF165	protein	P15692	3R02 Bivalent	TGTGGGGGTGGACTGGGTGGGTACCTTTTTTTTTTTGTGGGGGTGGACTGGGTGGGTACC	3e-11 M	-10.523	avidity_multivalent	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original							23237717	10.1021/ac303023d	The K d value of 30 pM for 3R02 Bivalent was calculated by measuring SPR.	step2c_acs_v1
312	thrombin	protein	P00734	MP-TBA15/TBA29-T15	GGTTGGTGTGGTTGG	5.2e-11 M	-10.284	avidity_multivalent	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	backfill_text_verified	saturation_binding		7.4	physiological buffer (25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 5.0 mM KCl, 1.0 mM MgCl2, 1.0 mM CaCl2) containing BSA (100 μM)	DNA	thiolated; 15-mer thymidine linker	22300379	10.1021/la204651t	MP-TBA15/TBA29-T15 -Au NPs provided high flexibility and an appropriate orientation and distance between TBA and TBA units for bivalent binding, allowing stronger interactions with thrombin ( K d = 5.2 × 10 -11 M; Supporting Information, Figure S3)	step2c_acs_v1
350	alkaline phosphatase	protein	P09923	ALP binding aptamer	CTTCTGCCCGCCTCCTTCCTGGAGGACTGTGGAGGACTTAGCGCCCATCCTTGCCCATGGAGACGAGATAGGCGGACACTC	1.49e-09 M	-8.827	avidity_multivalent	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original	PISA		9.5	50 mM glycine-NaOH buffer (pH 9.5)	DNA	3'-thiol	30827094	10.1021/acs.analchem.9b00465	Similarly, from the response -dose curve (Figure 3B), the K d value for the aptamer -MIP hybrid-coated array was estimated to be 1.49 × 10 -9 M	step2c_acs_v1
742	alkaline phosphatase	protein	P09923	ALP binding aptamer	CTTCTGCCCGCCTCCTTCCTGGAGGACTGTGGAGGACTTAGCGCCCATCCTTGCCCATGGAGACGAGATAGGCGGACACTC	1.5000000000000002e-09 M	-8.824	avidity_multivalent	Kd	Gold	ACS	multi_agent_verified	verified_in_text_or_SI	original	PISA				DNA	3'-thiol	30827094	10.1021/acs.analchem.9b00465	giving cross-reactivity of 3.2 -5.6% and a dissociation constant of 1.5 nM	step2c_acs_v1
465	SARS-CoV-2 spike RBD	protein		Aptx2-L		4.900000000000001e-09 M	-8.31	avidity_multivalent	Kd	Gold	v4	multi_agent_verified	pending_manual_supp		flow_cytometry	298.15	7.4	PBS, pH 7.4, 0.55 mM MgCl2	DNA		41498844	10.1021/acsami.5c16490	The Aptx2-L variant showed superior affinity with a dissociation constant ( K d) of 4.9 nM	step2c_acs_v1
412	Salmonella typhimurium	protein	Q8IWE5	NTri-triApt		1.1890000000000001e-08 M	-7.925	avidity_multivalent	Kd	Gold	v4	multi_agent_verified	pending_manual_supp		ELISA	310.15	7.5	PBS	DNA	biotin	37893744	10.3390/foods12203853	the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively	step2c_acs_v1
336	VEGF-165	protein	P15692	bivalent construct for VEGF-165 (no linker)		1.7e-08 M	-7.77	avidity_multivalent	Kd	Gold	v4	multi_agent_verified	pending_manual_figure								27043498	10.3390/molecules21040421	this bivalent construct had about 28-fold higher binding affinity ( K D = 17 nM)	step2c_acs_v1
466	SARS-CoV-2 spike RBD	protein		Aptx2-S		2.17e-08 M	-7.664	avidity_multivalent	Kd	Gold	v4	multi_agent_verified	pending_manual_supp		flow_cytometry	298.15	7.4	PBS, pH 7.4, 0.55 mM MgCl2	DNA		41498844	10.1021/acsami.5c16490	compared to 21.7 nM for Aptx2-S	step2c_acs_v1
434	Ara h1	protein	P35354	CB-APT1	GTGCTCGGACTCCACTTGCGCTTCATTAACCGGGTTGCTCATTTATTCA	3.63e-08 M	-7.44	avidity_multivalent	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original	MST	298.15	7.2	1 × binding buffer	DNA		40083221	10.1021/acs.analchem.5c00270	Among them, CBAPT1 exhibited the strongest binding to Ara h1 with a K d value of 36.3 nM in aqueous solutions.	step2c_acs_v1
413	Salmonella typhimurium	protein	Q8IWE5	NTri-biApt		4.3090000000000004e-08 M	-7.366	avidity_multivalent	Kd	Gold	v4	multi_agent_verified	pending_manual_supp		ELISA	310.15	7.5	PBS	DNA	biotin	37893744	10.3390/foods12203853	the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively	step2c_acs_v1
435	Ara h1	protein	P35354	CB-APT1	GTGCTCGGACTCCACTTGCGCTTCATTAACCGGGTTGCTCATTTATTCA	4.5000000000000006e-08 M	-7.347	avidity_multivalent	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original	MST	298.15	7.2	1 × binding buffer with 80% w/w total peanut proteins	DNA		40083221	10.1021/acs.analchem.5c00270	Notably, a similar binding affinity was observed even in a complex matrix that contained 80% w/w total peanut proteins ( K d = 45.0 nM, Figures 3 and S5).	step2c_acs_v1

Advanced export

JSON shape: default, array, newline-delimited

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';

Binding affinities (Kd) — source-verified (view)

16 rows where measurement_class = "avidity_multivalent", tier = "Gold" and verification_level = "multi_agent_verified" sorted by kd_log10_molar

Advanced export