Binding affinities (Kd) — source-verified (view)
Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target
- target_name_canonical
- Target as named in the source paper.
- target_type
- protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
- target_uniprot
- UniProt accession when a human protein (sparse for now; links to apt-scout target).
- aptamer_name
- Aptamer identifier as reported.
- kd_reported
- Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
- kd_log10_molar
- log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
- measurement_class
- intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
- binding_constant_type
- Kd / apparent-Kd etc. as reported.
- assay_method
- SPR / filter binding / flow cytometry / ITC / BLI …
- assay_temperature_k
- Assay temperature (K) — a reason the same pair can have several rows.
- source_pmid
- PubMed ID of the source paper (links out).
- verbatim_quote
- The exact sentence the value was taken from.
- verification_level
- QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
- sequence_status
- Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
- pi_provenance_flag
- PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
- seq_source
- original (already in source DB) / backfill_text_verified (recovered from paper or SI text).
327 rows where measurement_class = "intrinsic" and sequence_status = "verified_in_text_or_SI" sorted by kd_log10_molar
This data as json, CSV (advanced)
Suggested facets: source_origin, seq_source, assay_temperature_k, assay_ph, aptamer_chemistry, source_db
assay_method 19
- SPR 37
- MST 23
- fluorescence 19
- filter_binding 13
- affinity_real_time_qPCR 8
- QCM 7
- BLI 4
- BSI 4
- ITC 4
- ELISA 2
- flow_cytometry 2
- mass_spectrometry 2
- ALISA 1
- ELAA 1
- FACS 1
- NECEEM 1
- PISA 1
- microscale thermophoresis 1
- qPCR 1
verification_level 2
target_type 2
- protein 322
- glycan/conjugate 5
tier 1
- Gold 327
sequence_status 1
- verified_in_text_or_SI · 327 ✖
measurement_class 1
- intrinsic · 327 ✖
| id | target_name_canonical | target_type | target_uniprot | aptamer_name | aptamer_seq | kd_reported | kd_log10_molar ▼ | measurement_class | binding_constant_type | tier | source_origin | verification_level | sequence_status | seq_source | pi_provenance_flag | assay_method | assay_temperature_k | assay_ph | assay_buffer | assay_cations | aptamer_chemistry | aptamer_modifications | source_pmid | doi | verbatim_quote | source_db |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 44 | IL-8 | protein | P10145 | 8A-35 | GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC | 1.72e-12 M | -11.764 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.0 | 7.4 | HBST running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, and 0.005% Tween 20) | 2'F-RNA | 2'-fluoro-pyrimidine modified | 24129312 | 10.1016/j.biomaterials.2013.09.107 | | 8A-35 | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80 | 3.11 x 10 1 | | step2c_literal_v3 | ||
| 621 | nucleolin | protein | P19338 | Cy5-AT11-B0 | TGGTGGTGGTTGGTGGTGGTGGTGGT | 3.3e-12 M | -11.481 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 31301466 | 10.1016/j.ijpharm.2019.118511 | yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8 | elsevier_step2c | |||||||
| 620 | nucleolin | protein | P19338 | Cy5-AT11 | TGGTGGTGGTTGTTGTGGTGGTGGTGGT | 5.2e-12 M | -11.284 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 31301466 | 10.1016/j.ijpharm.2019.118511 | yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8 | elsevier_step2c | |||||||
| 618 | nucleolin | protein | P19338 | Cy5-AT11 | TGGTGGTGGTTGTTGTGGTGGTGGTGGT | 9.1e-12 M | -11.041 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 31301466 | 10.1016/j.ijpharm.2019.118511 | K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4 | elsevier_step2c | |||||||
| 619 | nucleolin | protein | P19338 | Cy5-AT11-B0 | TGGTGGTGGTTGGTGGTGGTGGTGGT | 9.5e-12 M | -11.022 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 31301466 | 10.1016/j.ijpharm.2019.118511 | K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4 | elsevier_step2c | |||||||
| 623 | Malate Synthase | protein | Q8N0X4 | MS10-Trunc | GGTGGTGGTGG | 19.0 pM | -10.721 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | abstract | 31704587 | 10.1016/j.omtn.2019.09.026 | MS10-Trunc aptamer exhibited high af fi nity for MS (equilibrium dissociation constant [KD] 19 pM) | elsevier_step2c | |||||||
| 140 | PDGF-C | protein | P01127 | α-PC | CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC | 20.0 pM | -10.699 | intrinsic | KD | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 7.4 | HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4) | DNA | PEG | 42138517 | 10.1167/iovs.67.5.36 | SPR analysis demonstrated that the α -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM | step2c_literal_v3 | |||
| 669 | bevacizumab | protein | P31995 | A14#1 | GCGGTTGGTGGTAGTTACGTTCGC | 44.0 pM | -10.357 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | abstract | 35114463 | 10.1016/j.bios.2022.114027 | affinity of A14#1 to bevacizumab markedly increased at pH 4.7 ( K D = 44 pM) | elsevier_step2c | |||||||
| 9 | sLe X -BSA | glycan/conjugate | Q9NSU2 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 5.7e-11 M | -10.244 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 298.15 | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11 | step2c_literal_v3 | |
| 3 | sLe X -BSA | glycan/conjugate | Q9NSU2 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 8.5e-11 M | -10.071 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 298.15 | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11 | step2c_literal_v3 | |
| 547 | ofloxacin | protein | Q9H015 | Q2 | ATACCAGCTTATTCAATTGCAGGGTATCTGAGGCTTGATCTACTAAATGTCGTGGGGCATTGCTATTGGCGTTGATACGTACAATCGTAATCAGTTAG | 0.11 nM | -9.959 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 26547431 | 10.1016/j.bios.2015.10.069 | Their K D values were calculated at K D 1⁄4 0.11 nM ( 7 0.06) for aptamer Q2 | elsevier_step2c | |||||||
| 331 | MutS | protein | O15457 | 2-06 | ACTTCTGCCCGCCTCCTTCCTGGTAAAGTCATTAATAGGTGTGGGGTGCCGGGCATTTCGGAGACGAGATAGGCGGACACT | 1.23e-10 M | -9.91 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | 25668425 | 10.1021/acs.analchem.5b00171 | The best fi t was obtained at K d = 123 pM and [T]0 = 213 pM | step2c_acs_v1 | ||||||||
| 363 | HBcAg | protein | A-9 | AGCAGCACAGAGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCTACCGTGAA | 2.0000000000000003e-10 M | -9.699 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | affinity_real_time_qPCR | DNA | 32250595 | 10.1021/acs.analchem.9b05740 | This aptamer showed strong binding to HBcAg ( K d : 0.2 nM) | step2c_acs_v1 | |||||||
| 548 | ofloxacin | protein | Q9H015 | Q8 | ATACCAGCTTATTCAATTAGTTGTGTATTGAGGTTTGATCTAGGCATAGTCAACAGAGCACGATCGATCTGGCTTGTTCTACAATCGTAATCAGTTAG | 0.2 nM | -9.699 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 26547431 | 10.1016/j.bios.2015.10.069 | K D 1⁄4 0.20 nM ( 7 0.09) for aptamer Q8 | elsevier_step2c | |||||||
| 558 | OH-BDE47 | protein | BDE-A-8 | GACAGCCGGGGCATCAGAGCAGCCGATTGTCTGTTGTGCC | 0.2 nM | -9.699 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 27566357 | 10.1016/j.aca.2016.06.040 | The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition. | elsevier_step2c | ||||||||
| 639 | thrombin | protein | P00734 | 29-mer thrombin-specific aptamer | AGTCCGTGGTAGGGCAGGTTGGGGTGACT | 298.0 pM | -9.526 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 32570818 | 10.3390/s20123442 | The n-curve analysis provided a Kd of 298 pM ( + 111 / 81 pM) | elsevier_step2c | |||||||
| 318 | VEGF165 | protein | P15692 | 3R02 | TGTGGGGGTGGACTGGGTGGGTACC | 3e-10 M | -9.523 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | 23237717 | 10.1021/ac303023d | The K d value for 3R02 was 300 pM | step2c_acs_v1 | ||||||||
| 660 | 20 Methyl Spirolide G | protein | SPX 7 | GGCGGTGTGGGTACCACGAGGTTTGGACGCGCGTAGCACCCCATTCAGC | 3e-10 M | -9.523 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 34144421 | 10.1016/j.foodchem.2021.130332 | The present study, among the aptamers selected, the aptamer with highest affinity had a dissociation constant of 0.3 nM for SPX G | elsevier_step2c | ||||||||
| 554 | chimeric-tPA | protein | Chi-tPA 1 | TTCCAACGGTTGGTGGGTGGTT | 0.32 nM | -9.495 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | abstract | 26876003 | 10.1016/j.pep.2016.02.004 | selected aptamer having KD values of 0.320 nM | elsevier_step2c | ||||||||
| 358 | HBeAg | protein | EAg3-Py | TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGAGATGTTTGGTTTT | 4.0000000000000007e-10 M | -9.398 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | affinity_real_time_qPCR | 7.4 | 1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20) | DNA | pyrrolo-dC | 32250595 | 10.1021/acs.analchem.9b05740 | The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3 | step2c_acs_v1 | ||||
| 415 | BDNF | protein | P23560 | NV_B12 | GGATTTGAGCTTATGTGGCATAGGTTGCCTGGGTGGGTGGGGTCGGGGAA | 5e-10 M | -9.301 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | ALISA | 1 × selection buffer | DNA | biotin | 38149631 | 10.1021/acschemneuro.3c00661 | The equilibrium dissociation constant ( K d) for the NV_B12/BDNF interaction was obtained by fitting the equation, Y = B max × X /( K d + X )... The K d value determined to be 0.5 nM (95% CI: 0.4 -0.6 nM) | step2c_acs_v1 | ||||
| 343 | PlanarAu | protein | 1N | TATGCATGTGTAGTAAGACCTAGTCCACAATCAACG | 5.600000000000001e-10 M | -9.252 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | QCM | AIB | DNA | 30189130 | 10.1021/acscombsci.8b00048 | aptamer 1N showing the highest affinity (0.56 nM) | step2c_acs_v1 | ||||||
| 530 | AGEs-HSA | protein | #9s | TCTGCCACCCTCCGACTAACATATCCGGCCTGAGACCA | 0.57 nM | -9.244 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | backfill_text_verified | abstract | 24012635 | 10.1016/j.mvr.2013.08.010 | Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively. | elsevier_step2c | ||||||||
| 529 | AGEs-HSA | protein | #4s | CAGAATCGGGGACCACGACACTGCACATACCTCGTACGAA | 0.63 nM | -9.201 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | backfill_text_verified | abstract | 24012635 | 10.1016/j.mvr.2013.08.010 | Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively. | elsevier_step2c | ||||||||
| 332 | MutS | protein | O15457 | 2-06 | ACTTCTGCCCGCCTCCTTCCTGGTAAAGTCATTAATAGGTGTGGGGTGCCGGGCATTTCGGAGACGAGATAGGCGGACACT | 6.5e-10 M | -9.187 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | 25668425 | 10.1021/acs.analchem.5b00171 | The experimental points from the second step resulted in the best fi t with the theoretical dependence of R versus [L] 0 at K d = 650 pM | step2c_acs_v1 | ||||||||
| 634 | Immunoglobulin E | protein | Q96D42 | IgE37-T10-FAM | GGGGCACGTTTATCCGTCCCTAGTGGCGTGCCCC | 0.8 nM | -9.097 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | abstract | 32498825 | 10.1016/j.talanta.2020.121018 | The FA assay using T10-labeled aptamer with a dissociation constant ( K d) about 0.8 nM | elsevier_step2c | |||||||
| 33 | Tasset - thrombin complex | protein | Bock | GGTTGGTGTGGTTGG | 0.87 nM | -9.06 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | BSI | 283.15 | 7.5 | 50 mM TRIS buffer (pH 7.5) containing 100 mM NaCl and 1 mM MgCl2 | 1.0 | DNA | 22032342 | 10.1021/ac202823m | Bock - [Tasset complex] | not available | 0.87 ( 0.18 nM | step2c_literal_v3 | |||
| 38 | alpha-thrombin | protein | P05154 | RNAR9D-14T | GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC | 1.0 nM | -9.0 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 310.15 | 7.4 | Hepes-saline buffer with 0.01% BSA | 2'F-RNA | 2' Fluorocytosine; 2' Fluorouracil | 22385910 | 10.1111/j.1538-7836.2012.04679.x | Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) and α-thrombin (apparent Kd =1 nM) | step2c_literal_v3 | ||
| 398 | neomycin | protein | Q96LI5 | Aptamer A | GGACUGGGCGAGAAGUUUAGUCC | 1e-09 M | -9.0 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | 36453647 | 10.1021/acschembio.2c00653 | The binding affinity of neomycin to Aptamer A shows a strong K d of 1 nM with an enthalpy and entropy value of -100 kJ/mol & -163.1 J/mol. K | step2c_acs_v1 | ||||||||
| 432 | Sc3+ | protein | Q96PL5 | Sc-1 | CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC | 1e-09 M | -9.0 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | fluorescence | SELEX buffer | DNA | 39743479 | 10.1021/jacs.4c13768 | true K d for the binding of Sc-1 to Sc 3+ to be 1.0 nM | step2c_acs_v1 | |||||
| 372 | beta-conglutin | protein | 11-mer | GGTGGGGGTGG | 1.05e-09 M | -8.979 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | MST | 298.15 | binding buffer with 0.05% v/v Tween-20 | DNA | 33498970 | 10.3390/ijms22031150 | KD values determined (Figure 6b) are very similar (11-mer: 1.05 nM | step2c_acs_v1 | |||||
| 340 | AP65 | protein | Q13882 | AP65_A1 | AGCTCCAGAAGATAAATTACAGGTGAGGGCGGGCGGGTGGTTGTAATATGATCGAATGGTATATGTGTGTTTGCAACTAGGATACTATGACCCCG | 1.057e-09 M | -8.976 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | ELAA | 298.15 | 6.4 | binding buffer (10 mM phosphate, 138 mM NaCl, 2.7 mM KCl, 1.5 mM MgCl2 at pH 6.4) | DNA | 5'-biotinylated | 29972299 | 10.1021/acsinfecdis.8b00065 | A K D value of 1.057 nM was obtained using the sigmoidal dose-response curve model | step2c_acs_v1 | ||
| 356 | HBeAg | protein | A-9S | ACTTTTTTGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCT | 1.2e-09 M | -8.921 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | affinity_real_time_qPCR | 7.4 | 1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20) | DNA | /5AmMC6/ | 32250595 | 10.1021/acs.analchem.9b05740 | The measured dissociation constant ( K d) is improved by 19 times from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer. | step2c_acs_v1 | ||||
| 433 | PvTRAg | protein | Apt_16 | TTAATAACATGAGTTATTGAATTATTGTTTATTTTTTTTTTTTTG | 1.2e-09 M | -8.921 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | DNA | 40042916 | 10.1021/acsinfecdis.4c01047 | The K D of Apt_14 and Apt_16 was found to be comparable, 1.9 and 1.2 nM, respectively | step2c_acs_v1 | ||||||||
| 39 | prothrombin | protein | P00734 | RNAR9D-14T | GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC | 1.4 nM | -8.854 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | Hepes-saline buffer | 2'F-RNA | 2' Fluorocytosine; 2' Fluorouracil | 22385910 | 10.1111/j.1538-7836.2012.04679.x | Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM | step2c_literal_v3 | ||
| 559 | OH-BDE47 | protein | BDE-A-12 | ATTGCACGTCTCCGCCGCTTGGGTGGAGAGGCTATTCGGC | 1.53 nM | -8.815 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 27566357 | 10.1016/j.aca.2016.06.040 | The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition. | elsevier_step2c | ||||||||
| 394 | IgE | protein | P0DOX4 | S2 | GACTACCCGGGTATCTAATCCGACCATTTTTCGTCTCCTTTGTACGAGCAGTGTGCTCGACCTGCCGCCCGTAGG | 1.5500000000000002e-09 M | -8.81 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | NECEEM | 9.0 | 10 mM Tris-HCl buffer (pH 9.0) | DNA | FITC | 36144553 | 10.3390/molecules27185818 | Based on the results of these experiments, the K D values of S1 and S2 were estimated to be 0.83 and 1.55 nM, respectively | step2c_acs_v1 | |||
| 41 | hOX40 | protein | 9C7 | GGGAGGACGATGCGGAAAAAAGAACACUUCCGAUUAGGGCCCACCCUAACGGCCGCAGACGACTCGCCCGA | 1.7 nM | -8.77 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 310.15 | 7.5 | selection buffer F (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2, and 0.01% BSA) | 2'F-RNA | 23113766 | 10.1089/nat.2012.0388 | 9C7 | 11 | 1.7 | step2c_literal_v3 | ||||
| 359 | HBeAg | protein | EAg3 | TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGAGATGTTTGGTTTT | 1.7000000000000001e-09 M | -8.77 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | affinity_real_time_qPCR | 7.4 | 1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20) | DNA | 32250595 | 10.1021/acs.analchem.9b05740 | The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3, as compared to the K d value of 1.7 nM with the unmodi fi ed EAg3 aptamer. | step2c_acs_v1 | |||||
| 374 | beta-conglutin | protein | TT-11-mer | TTGGTGGGGGTGG | 1.88e-09 M | -8.726 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | MST | 298.15 | binding buffer with 0.05% v/v Tween-20 | DNA | 33498970 | 10.3390/ijms22031150 | KD values determined (Figure 6b) are very similar (... TT-11 mer: 1.88 nM | step2c_acs_v1 | |||||
| 35 | Bock - thrombin complex | protein | Q86YV9 | Tasset | CAGTCCGTGGTAGGGCAGGTTGGGGTGACTTCGTGGAA | 1.9 nM | -8.721 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | BSI | 283.15 | 7.5 | 50 mM TRIS buffer (pH 7.5) containing 100 mM NaCl and 1 mM MgCl2 | 1.0 | DNA | 22032342 | 10.1021/ac202823m | Tasset - [Bock complex] | not available | 1.9 ( 0.2 nM | step2c_literal_v3 | ||
| 649 | THY1 | protein | P04216 | XA-B217 | CAGGGGACGCACCAAGGTTGCCCACCGACGTGCAGGCGAACTACAGGCACGCGGCCATGACCCGCGTGCTG | 2.0 nM | -8.699 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 33242496 | 10.1016/j.biochi.2020.11.018 | The equilibrium dissociation constants, Kd, were derived from these curves and are determined as ... XA-B217=2 nM | elsevier_step2c | |||||||
| 565 | Progesterone | protein | P06401 | PG13T2 | GATTAACATTAGCCCACCGCCCACC | 2.1 nM | -8.678 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 28237255 | 10.1016/j.ab.2017.02.014 | The dissociation constant of the PG13T2-P4 complex calculated using non-linear regression fi tting of the obtained curve was found to be 2.1 nM. | elsevier_step2c | |||||||
| 727 | IL-23 | protein | P26951 | A23P15 | GGTCACTTCCAACGCTTA | 2.139 nM | -8.67 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | backfill_text_verified | text | 38810331 | 10.1016/j.jpba.2024.116245 | the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively | elsevier_step2c | |||||||
| 508 | alpha-fetoprotein | protein | P02771 | AFP-specific ssDNA aptamer | GGCAGGAAGACAAACAAGCTTGGCGGCGGGAAGGTGTTTAAATTCCCGGGTCTGCGTGGTCTGTGGTGCTGT | 2.37 nM | -8.625 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 22410487 | 10.1016/j.bios.2012.02.024 | The K d of the AFP-specific ssDNA was calculated to be 2.37 nM | elsevier_step2c | |||||||
| 30 | thrombin | protein | P00734 | HD22 | AGTCCGTGGTAGGGCAGGTTGGGGTGACT | 2.4e-09 M | -8.62 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | DNA | 18826387 | 10.1111/j.1538-7836.2008.03162.x | HD22 | Thrombin | K D ( M) | 2.4 · 10 ) 9 | step2c_literal_v3 | ||||||
| 376 | beta-conglutin | protein | 11-mer-TT | GGTGGGGGTGGTT | 2.59e-09 M | -8.587 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | MST | 298.15 | binding buffer with 0.05% v/v Tween-20 | DNA | 33498970 | 10.3390/ijms22031150 | KD values determined (Figure 6b) are very similar (... and 11-mer-TT: 2.59 nM) | step2c_acs_v1 | |||||
| 537 | Prostate Specific Antigen | protein | P07288 | Apta | TTTAAATAGCATTAAAGCTCGCCATCAAATAGC | 2.6 nM | -8.585 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | abstract | 25569871 | 10.1016/j.bios.2014.12.033 | The change in current is used to determine the PSA -aptamer dissociation constant KD , of ca. 2.6 nM. | elsevier_step2c | |||||||
| 375 | beta-conglutin | protein | TT-11-mer-TT | TTGGTGGGGGTGGTT | 2.71e-09 M | -8.567 | intrinsic | Kd | Gold | v4 | multi_agent_verified | verified_in_text_or_SI | original | MST | 298.15 | binding buffer with 0.05% v/v Tween-20 | DNA | 33498970 | 10.3390/ijms22031150 | KD values determined (Figure 6b) are very similar (... TT-11-mer-TT: 2.71 nM | step2c_acs_v1 | |||||
| 712 | Neuron specific enolase | protein | P09104 | P-5C8G | TCACACAGGGAGCTCTCCTACATTAATAACGCATTGCGTT | 2.76 nM | -8.559 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | abstract | 38091739 | 10.1016/j.talanta.2023.125535 | The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively. | elsevier_step2c |
Advanced export
JSON shape: default, array, newline-delimited
CREATE VIEW v_kd AS
SELECT k.id,
target_name_canonical,
CASE
WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
ELSE 'protein'
END AS target_type,
target_uniprot, aptamer_name, aptamer_seq,
(COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
CASE
WHEN vh.verdict='confirmed' THEN 'human_verified'
WHEN vh.verdict='corrected' THEN 'human_corrected'
WHEN vh.verdict='rejected' THEN 'human_rejected'
WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
ELSE 'automated'
END AS verification_level,
sequence_status, seq_source, pi_provenance_flag,
assay_method,
CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';