Binding affinities (Kd) — source-verified (view)
Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target
- target_name_canonical
- Target as named in the source paper.
- target_type
- protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
- target_uniprot
- UniProt accession when a human protein (sparse for now; links to apt-scout target).
- aptamer_name
- Aptamer identifier as reported.
- kd_reported
- Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
- kd_log10_molar
- log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
- measurement_class
- intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
- binding_constant_type
- Kd / apparent-Kd etc. as reported.
- assay_method
- SPR / filter binding / flow cytometry / ITC / BLI …
- assay_temperature_k
- Assay temperature (K) — a reason the same pair can have several rows.
- source_pmid
- PubMed ID of the source paper (links out).
- verbatim_quote
- The exact sentence the value was taken from.
- verification_level
- QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
- sequence_status
- Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
- pi_provenance_flag
- PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
- seq_source
- original (already in source DB) / backfill_text_verified (recovered from paper or SI text).
233 rows where measurement_class = "intrinsic", sequence_status = "verified_in_text_or_SI" and verification_level = "extraction_verified" sorted by kd_log10_molar
This data as json, CSV (advanced)
Suggested facets: source_origin, seq_source, assay_temperature_k, assay_ph, assay_buffer, aptamer_chemistry, source_db
assay_method 13
- SPR 29
- MST 19
- filter_binding 13
- fluorescence 9
- QCM 5
- BSI 4
- ELISA 2
- ITC 2
- mass_spectrometry 2
- BLI 1
- FACS 1
- microscale thermophoresis 1
- qPCR 1
target_type 2
- protein 228
- glycan/conjugate 5
verification_level 1
- extraction_verified · 233 ✖
tier 1
- Gold 233
sequence_status 1
- verified_in_text_or_SI · 233 ✖
measurement_class 1
- intrinsic · 233 ✖
| id | target_name_canonical | target_type | target_uniprot | aptamer_name | aptamer_seq | kd_reported | kd_log10_molar ▼ | measurement_class | binding_constant_type | tier | source_origin | verification_level | sequence_status | seq_source | pi_provenance_flag | assay_method | assay_temperature_k | assay_ph | assay_buffer | assay_cations | aptamer_chemistry | aptamer_modifications | source_pmid | doi | verbatim_quote | source_db |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 44 | IL-8 | protein | P10145 | 8A-35 | GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC | 1.72e-12 M | -11.764 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.0 | 7.4 | HBST running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, and 0.005% Tween 20) | 2'F-RNA | 2'-fluoro-pyrimidine modified | 24129312 | 10.1016/j.biomaterials.2013.09.107 | | 8A-35 | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80 | 3.11 x 10 1 | | step2c_literal_v3 | ||
| 621 | nucleolin | protein | P19338 | Cy5-AT11-B0 | TGGTGGTGGTTGGTGGTGGTGGTGGT | 3.3e-12 M | -11.481 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 31301466 | 10.1016/j.ijpharm.2019.118511 | yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8 | elsevier_step2c | |||||||
| 620 | nucleolin | protein | P19338 | Cy5-AT11 | TGGTGGTGGTTGTTGTGGTGGTGGTGGT | 5.2e-12 M | -11.284 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 31301466 | 10.1016/j.ijpharm.2019.118511 | yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8 | elsevier_step2c | |||||||
| 618 | nucleolin | protein | P19338 | Cy5-AT11 | TGGTGGTGGTTGTTGTGGTGGTGGTGGT | 9.1e-12 M | -11.041 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 31301466 | 10.1016/j.ijpharm.2019.118511 | K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4 | elsevier_step2c | |||||||
| 619 | nucleolin | protein | P19338 | Cy5-AT11-B0 | TGGTGGTGGTTGGTGGTGGTGGTGGT | 9.5e-12 M | -11.022 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 31301466 | 10.1016/j.ijpharm.2019.118511 | K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4 | elsevier_step2c | |||||||
| 623 | Malate Synthase | protein | Q8N0X4 | MS10-Trunc | GGTGGTGGTGG | 19.0 pM | -10.721 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | abstract | 31704587 | 10.1016/j.omtn.2019.09.026 | MS10-Trunc aptamer exhibited high af fi nity for MS (equilibrium dissociation constant [KD] 19 pM) | elsevier_step2c | |||||||
| 140 | PDGF-C | protein | P01127 | α-PC | CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC | 20.0 pM | -10.699 | intrinsic | KD | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 7.4 | HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4) | DNA | PEG | 42138517 | 10.1167/iovs.67.5.36 | SPR analysis demonstrated that the α -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM | step2c_literal_v3 | |||
| 669 | bevacizumab | protein | P31995 | A14#1 | GCGGTTGGTGGTAGTTACGTTCGC | 44.0 pM | -10.357 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | abstract | 35114463 | 10.1016/j.bios.2022.114027 | affinity of A14#1 to bevacizumab markedly increased at pH 4.7 ( K D = 44 pM) | elsevier_step2c | |||||||
| 9 | sLe X -BSA | glycan/conjugate | Q9NSU2 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 5.7e-11 M | -10.244 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 298.15 | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11 | step2c_literal_v3 | |
| 3 | sLe X -BSA | glycan/conjugate | Q9NSU2 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 8.5e-11 M | -10.071 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 298.15 | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11 | step2c_literal_v3 | |
| 547 | ofloxacin | protein | Q9H015 | Q2 | ATACCAGCTTATTCAATTGCAGGGTATCTGAGGCTTGATCTACTAAATGTCGTGGGGCATTGCTATTGGCGTTGATACGTACAATCGTAATCAGTTAG | 0.11 nM | -9.959 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 26547431 | 10.1016/j.bios.2015.10.069 | Their K D values were calculated at K D 1⁄4 0.11 nM ( 7 0.06) for aptamer Q2 | elsevier_step2c | |||||||
| 548 | ofloxacin | protein | Q9H015 | Q8 | ATACCAGCTTATTCAATTAGTTGTGTATTGAGGTTTGATCTAGGCATAGTCAACAGAGCACGATCGATCTGGCTTGTTCTACAATCGTAATCAGTTAG | 0.2 nM | -9.699 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 26547431 | 10.1016/j.bios.2015.10.069 | K D 1⁄4 0.20 nM ( 7 0.09) for aptamer Q8 | elsevier_step2c | |||||||
| 558 | OH-BDE47 | protein | BDE-A-8 | GACAGCCGGGGCATCAGAGCAGCCGATTGTCTGTTGTGCC | 0.2 nM | -9.699 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 27566357 | 10.1016/j.aca.2016.06.040 | The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition. | elsevier_step2c | ||||||||
| 639 | thrombin | protein | P00734 | 29-mer thrombin-specific aptamer | AGTCCGTGGTAGGGCAGGTTGGGGTGACT | 298.0 pM | -9.526 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 32570818 | 10.3390/s20123442 | The n-curve analysis provided a Kd of 298 pM ( + 111 / 81 pM) | elsevier_step2c | |||||||
| 660 | 20 Methyl Spirolide G | protein | SPX 7 | GGCGGTGTGGGTACCACGAGGTTTGGACGCGCGTAGCACCCCATTCAGC | 3e-10 M | -9.523 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 34144421 | 10.1016/j.foodchem.2021.130332 | The present study, among the aptamers selected, the aptamer with highest affinity had a dissociation constant of 0.3 nM for SPX G | elsevier_step2c | ||||||||
| 554 | chimeric-tPA | protein | Chi-tPA 1 | TTCCAACGGTTGGTGGGTGGTT | 0.32 nM | -9.495 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | abstract | 26876003 | 10.1016/j.pep.2016.02.004 | selected aptamer having KD values of 0.320 nM | elsevier_step2c | ||||||||
| 530 | AGEs-HSA | protein | #9s | TCTGCCACCCTCCGACTAACATATCCGGCCTGAGACCA | 0.57 nM | -9.244 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | backfill_text_verified | abstract | 24012635 | 10.1016/j.mvr.2013.08.010 | Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively. | elsevier_step2c | ||||||||
| 529 | AGEs-HSA | protein | #4s | CAGAATCGGGGACCACGACACTGCACATACCTCGTACGAA | 0.63 nM | -9.201 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | backfill_text_verified | abstract | 24012635 | 10.1016/j.mvr.2013.08.010 | Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively. | elsevier_step2c | ||||||||
| 634 | Immunoglobulin E | protein | Q96D42 | IgE37-T10-FAM | GGGGCACGTTTATCCGTCCCTAGTGGCGTGCCCC | 0.8 nM | -9.097 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | abstract | 32498825 | 10.1016/j.talanta.2020.121018 | The FA assay using T10-labeled aptamer with a dissociation constant ( K d) about 0.8 nM | elsevier_step2c | |||||||
| 33 | Tasset - thrombin complex | protein | Bock | GGTTGGTGTGGTTGG | 0.87 nM | -9.06 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | BSI | 283.15 | 7.5 | 50 mM TRIS buffer (pH 7.5) containing 100 mM NaCl and 1 mM MgCl2 | 1.0 | DNA | 22032342 | 10.1021/ac202823m | Bock - [Tasset complex] | not available | 0.87 ( 0.18 nM | step2c_literal_v3 | |||
| 38 | alpha-thrombin | protein | P05154 | RNAR9D-14T | GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC | 1.0 nM | -9.0 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 310.15 | 7.4 | Hepes-saline buffer with 0.01% BSA | 2'F-RNA | 2' Fluorocytosine; 2' Fluorouracil | 22385910 | 10.1111/j.1538-7836.2012.04679.x | Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) and α-thrombin (apparent Kd =1 nM) | step2c_literal_v3 | ||
| 39 | prothrombin | protein | P00734 | RNAR9D-14T | GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC | 1.4 nM | -8.854 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | 298.15 | 7.4 | Hepes-saline buffer | 2'F-RNA | 2' Fluorocytosine; 2' Fluorouracil | 22385910 | 10.1111/j.1538-7836.2012.04679.x | Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM | step2c_literal_v3 | ||
| 559 | OH-BDE47 | protein | BDE-A-12 | ATTGCACGTCTCCGCCGCTTGGGTGGAGAGGCTATTCGGC | 1.53 nM | -8.815 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 27566357 | 10.1016/j.aca.2016.06.040 | The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition. | elsevier_step2c | ||||||||
| 41 | hOX40 | protein | 9C7 | GGGAGGACGATGCGGAAAAAAGAACACUUCCGAUUAGGGCCCACCCUAACGGCCGCAGACGACTCGCCCGA | 1.7 nM | -8.77 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 310.15 | 7.5 | selection buffer F (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2, and 0.01% BSA) | 2'F-RNA | 23113766 | 10.1089/nat.2012.0388 | 9C7 | 11 | 1.7 | step2c_literal_v3 | ||||
| 35 | Bock - thrombin complex | protein | Q86YV9 | Tasset | CAGTCCGTGGTAGGGCAGGTTGGGGTGACTTCGTGGAA | 1.9 nM | -8.721 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | BSI | 283.15 | 7.5 | 50 mM TRIS buffer (pH 7.5) containing 100 mM NaCl and 1 mM MgCl2 | 1.0 | DNA | 22032342 | 10.1021/ac202823m | Tasset - [Bock complex] | not available | 1.9 ( 0.2 nM | step2c_literal_v3 | ||
| 649 | THY1 | protein | P04216 | XA-B217 | CAGGGGACGCACCAAGGTTGCCCACCGACGTGCAGGCGAACTACAGGCACGCGGCCATGACCCGCGTGCTG | 2.0 nM | -8.699 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 33242496 | 10.1016/j.biochi.2020.11.018 | The equilibrium dissociation constants, Kd, were derived from these curves and are determined as ... XA-B217=2 nM | elsevier_step2c | |||||||
| 565 | Progesterone | protein | P06401 | PG13T2 | GATTAACATTAGCCCACCGCCCACC | 2.1 nM | -8.678 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 28237255 | 10.1016/j.ab.2017.02.014 | The dissociation constant of the PG13T2-P4 complex calculated using non-linear regression fi tting of the obtained curve was found to be 2.1 nM. | elsevier_step2c | |||||||
| 727 | IL-23 | protein | P26951 | A23P15 | GGTCACTTCCAACGCTTA | 2.139 nM | -8.67 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | backfill_text_verified | text | 38810331 | 10.1016/j.jpba.2024.116245 | the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively | elsevier_step2c | |||||||
| 508 | alpha-fetoprotein | protein | P02771 | AFP-specific ssDNA aptamer | GGCAGGAAGACAAACAAGCTTGGCGGCGGGAAGGTGTTTAAATTCCCGGGTCTGCGTGGTCTGTGGTGCTGT | 2.37 nM | -8.625 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 22410487 | 10.1016/j.bios.2012.02.024 | The K d of the AFP-specific ssDNA was calculated to be 2.37 nM | elsevier_step2c | |||||||
| 30 | thrombin | protein | P00734 | HD22 | AGTCCGTGGTAGGGCAGGTTGGGGTGACT | 2.4e-09 M | -8.62 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | DNA | 18826387 | 10.1111/j.1538-7836.2008.03162.x | HD22 | Thrombin | K D ( M) | 2.4 · 10 ) 9 | step2c_literal_v3 | ||||||
| 537 | Prostate Specific Antigen | protein | P07288 | Apta | TTTAAATAGCATTAAAGCTCGCCATCAAATAGC | 2.6 nM | -8.585 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | abstract | 25569871 | 10.1016/j.bios.2014.12.033 | The change in current is used to determine the PSA -aptamer dissociation constant KD , of ca. 2.6 nM. | elsevier_step2c | |||||||
| 712 | Neuron specific enolase | protein | P09104 | P-5C8G | TCACACAGGGAGCTCTCCTACATTAATAACGCATTGCGTT | 2.76 nM | -8.559 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | abstract | 38091739 | 10.1016/j.talanta.2023.125535 | The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively. | elsevier_step2c | |||||||
| 16 | thrombin | protein | P00734 | TBA | GGTTGGTGTGGTTGG | 2.86e-09 M | -8.544 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | DNA | biotin at 3' end; six-carbon spacer | 16053288 | 10.1021/ac0502450 | thrombin | 2.2 10 5 | 6.3 10 - 4 | 3.4 10 8 | 2.86 10 - 9 | step2c_literal_v3 | |||||
| 726 | IL-23 | protein | P26951 | A23P6 | GGTCTACGTCGAATCGTATA | 2.88 nM | -8.541 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | backfill_text_verified | text | 38810331 | 10.1016/j.jpba.2024.116245 | the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively | elsevier_step2c | |||||||
| 65 | hCD4 | protein | P01730 | U26 | CGATGTCGACGTGCAGCTTCCTTGAGCCTTACTGAAAATACTACCCAGTCC | 2.93 nM | -8.533 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | qPCR | 298.15 | 7.4 | 1× PBS pH 7.4 | DNA | biotin | 32567629 | 10.1039/d0an00634c | U26 exhibited the highest binding affinity ( K d = 2.93 ± 1.03 nM) to hCD4-conjugated beads. | step2c_literal_v3 | ||
| 11 | sLe X | glycan/conjugate | Q9NSU2 | Clone 5 | GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU | 3.3e-09 M | -8.481 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | KEEP_seq_in_figure | SPR | 7.4 | RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] | 1.0 | RNA | 11178986 | 10.1006/bbrc.2001.4327 | sLe X | 1.7 3 10 5 | 5.5 3 10 2 4 | 3.0 3 10 8 | 3.3 3 10 2 9 | step2c_literal_v3 | ||
| 635 | Immunoglobulin E | protein | Q96D42 | Unlabeled anti-IgE aptamer | GGGGCACGTTTATCCGTCCCTAGTGGCGTGCCCC | 3.5 nM | -8.456 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 32498825 | 10.1016/j.talanta.2020.121018 | close to the K d of the unlabeled aptamer (3.5 nM) | elsevier_step2c | |||||||
| 651 | gonyautoxin 1/4 | protein | tGO18-T-d | TTGGTCGGGCAAGGTAGGTT | 3.6 nM | -8.444 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 33294137 | 10.1016/j.csbj.2020.10.041 | Corresponding Kd values of GO18-T-d and tGO18-T-d, determined by the average of 8 independent measurements, were 75.63 nM and 3.60 nM, respectively. | elsevier_step2c | ||||||||
| 737 | Surface Antigen 1 | protein | P01730 | SOK14 | CGGACATTGTACCGTTGGGTGGGAGATAGTAAGTGAATAAGGGCGAATTCCACACACTGG | 3.736 nM | -8.428 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 40288708 | 10.1016/j.ijbiomac.2025.143530 | SOK14 (3.736 nM, R 2 = 0.7367) | elsevier_step2c | |||||||
| 34 | human α-thrombin | protein | P00734 | Tasset | CAGTCCGTGGTAGGGCAGGTTGGGGTGACTTCGTGGAA | 3.84 nM | -8.416 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | BSI | 283.15 | 7.5 | 50 mM TRIS buffer (pH 7.5) containing 100 mM NaCl and 1 mM MgCl2 | 1.0 | DNA | 22032342 | 10.1021/ac202823m | Tasset - thrombin | 0.5 - 1.0 nM 14 | 3.84 ( 0.68 nM | step2c_literal_v3 | ||
| 682 | Carcinoembryonic antigen | protein | P06731 | GAC-P | GACATACCAGCTTATTCAATT | 3.93 nM | -8.406 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 35517255 | 10.1039/c8ra10163a | The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively. | elsevier_step2c | |||||||
| 735 | Surface Antigen 1 | protein | P01730 | SOK18 | CGGGAGAGATAGTAAGTGCAAGGGCGAATTCTGCAGATATCCATCACACTGGCGGCAGC | 4.034 nM | -8.394 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 40288708 | 10.1016/j.ijbiomac.2025.143530 | SOK18 (4.034 nM, R 2 = 0.8422) | elsevier_step2c | |||||||
| 732 | Surface Antigen 1 | protein | P01730 | SOK3 | GGACACCAAGTGCAATCTATACCAGCTTATTCAATAAGGGCGAATTCCAGCACACTGGCG | 4.185 nM | -8.378 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 40288708 | 10.1016/j.ijbiomac.2025.143530 | SOK3 (4.185 nM, R 2 = 0.8153) | elsevier_step2c | |||||||
| 59 | RAGE | protein | P80511 | RAGE-aptamer (clone #2) | TCTGTTCAGGTTGGTACGGTGGAAGGTGTGATTCACGAGG | 4.44 nM | -8.353 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | QCM | DNA | phosphorothioate | 28385802 | 10.2337/db16-1281 | #2RAGE-aptamer | tcTgTTcAggTTggTAcggTggAAggTgTgATTcAcgAgg | 4.44±0.56 | step2c_literal_v3 | |||||
| 652 | Thyroglobulin | protein | P01266 | Seq.T-2 | CGCGTGAGCGGGGAGGCGATGCCCAGGCTAACTTGACTCA | 4.51 nM | -8.346 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 33303143 | 10.1016/j.talanta.2020.121690 | kon = 3.2 × 10 5 M 1 s 1 , koff = 1.44 × 10 3 s 1 , Kd = 4.51 nM | elsevier_step2c | |||||||
| 681 | Carcinoembryonic antigen | protein | P06731 | P-ATG | ATACCAGCTTATTCAATTATG | 4.62 nM | -8.335 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 35517255 | 10.1039/c8ra10163a | The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively. | elsevier_step2c | |||||||
| 517 | Hemagglutinin (HA) protein of AIV H5N1 (A/Vietnam/1203/04) | protein | Aptamer sequence (2) | GTGTGCATGGATAGCACGTAACGGTGTAGTAGATACGTGCGGGTAGGAAGAAAGGGAAATAGTTGTCCTGTTG | 4.65 nM | -8.333 | intrinsic | KD | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 23523887 | 10.1016/j.jviromet.2013.03.006 | the KD (dissociation constants) was 4.65 nM, indicating strong binding between the HA protein and the selected aptamer. | elsevier_step2c | ||||||||
| 527 | Oxytetracycline | protein | Q9Y694 | OTC3 | CGACGCACAGTCGCTGGTGCGTACCTGGTTGCCGTTGTGT | 4.7 nM | -8.328 | intrinsic | Kd | Gold | elsevier | extraction_verified | verified_in_text_or_SI | original | text | 24011458 | 10.1016/j.bios.2013.08.003 | The lowest K d value (4.7 nM) was obtained with the aptamer OTC3. | elsevier_step2c | |||||||
| 115 | HFIXa | protein | Seq 11 | ATTGGCACTCCACGCATAGGCCGCCCACTTAAGCGCACGCGTCGACGATTTCGCACAGTCCCTATGCGTGCTACCGTGAA | 4.93 nM | -8.307 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | ITC | 298.15 | 7.4 | 1 × HEPES (pH 7.4) | DNA | FAM | 38776649 | 10.1016/j.bioorg.2024.107463 | Seq 11- | 7.4 | 0.983 | 203 ± | 4.93 | 130.6 | 279 | 47.42 | step2c_literal_v3 | |||
| 58 | RAGE | protein | P80511 | RAGE-aptamer (clone #1) | CCTGATATGGTGTCACCGCCGCCTTAGTATTGGTGTCTAC | 5.68 nM | -8.246 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | QCM | DNA | phosphorothioate | 28385802 | 10.2337/db16-1281 | #1RAGE-aptamer | ccTgATATggTgTcAccgccgccTTAgTATTggTgTcTAc | 5.68±1.10 | step2c_literal_v3 |
Advanced export
JSON shape: default, array, newline-delimited
CREATE VIEW v_kd AS
SELECT k.id,
target_name_canonical,
CASE
WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
ELSE 'protein'
END AS target_type,
target_uniprot, aptamer_name, aptamer_seq,
(COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
CASE
WHEN vh.verdict='confirmed' THEN 'human_verified'
WHEN vh.verdict='corrected' THEN 'human_corrected'
WHEN vh.verdict='rejected' THEN 'human_rejected'
WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
ELSE 'automated'
END AS verification_level,
sequence_status, seq_source, pi_provenance_flag,
assay_method,
CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';