Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

555 rows where measurement_class = "intrinsic" and tier = "Gold" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: source_origin, seq_source, pi_provenance_flag, assay_temperature_k, assay_ph, assay_cations, aptamer_chemistry, source_db

verification_level 2

target_type 2

binding_constant_type 2

tier 1

  • Gold · 555 ✖

measurement_class 1

  • intrinsic · 555 ✖
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
44 IL-8 protein P10145 8A-35 GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC 1.72e-12 M -11.764 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.0 7.4 HBST running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, and 0.005% Tween 20)   2'F-RNA 2'-fluoro-pyrimidine modified 24129312 10.1016/j.biomaterials.2013.09.107 | 8A-35 | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80 | 3.11 x 10 1 | step2c_literal_v3
598 human α-Thrombin protein P00734 A1   2.0 pM -11.699 intrinsic Kd Gold elsevier extraction_verified pending_manual_supp           text       31129134 10.1016/j.ab.2019.05.012 Also for aptamer A1 we measured with MST KD values in the pico- and nanomolar range (2 pM and 52 nM). The lowest KD value is determined with MST (shown as bar) for aptamer A1, which is 2 pM. elsevier_step2c
621 nucleolin protein P19338 Cy5-AT11-B0 TGGTGGTGGTTGGTGGTGGTGGTGGT 3.3e-12 M -11.481 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       31301466 10.1016/j.ijpharm.2019.118511 yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8 elsevier_step2c
620 nucleolin protein P19338 Cy5-AT11 TGGTGGTGGTTGTTGTGGTGGTGGTGGT 5.2e-12 M -11.284 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       31301466 10.1016/j.ijpharm.2019.118511 yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8 elsevier_step2c
618 nucleolin protein P19338 Cy5-AT11 TGGTGGTGGTTGTTGTGGTGGTGGTGGT 9.1e-12 M -11.041 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       31301466 10.1016/j.ijpharm.2019.118511 K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4 elsevier_step2c
619 nucleolin protein P19338 Cy5-AT11-B0 TGGTGGTGGTTGGTGGTGGTGGTGGT 9.5e-12 M -11.022 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       31301466 10.1016/j.ijpharm.2019.118511 K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4 elsevier_step2c
143 P-selectin protein Q14242 PF377   14.0 pM -10.854 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377 | 14 step2c_literal_v3
147 P-selectin protein Q14242 PF377sl   14.0 pM -10.854 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 296.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377sl | 14 step2c_literal_v3
142 P-selectin protein Q14242 PF377   16.0 pM -10.796 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377 | 16 step2c_literal_v3
144 P-selectin protein Q14242 PF377   18.0 pM -10.745 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 277.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377 | 18 step2c_literal_v3
623 Malate Synthase protein Q8N0X4 MS10-Trunc GGTGGTGGTGG 19.0 pM -10.721 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         abstract       31704587 10.1016/j.omtn.2019.09.026 MS10-Trunc aptamer exhibited high af fi nity for MS (equilibrium dissociation constant [KD] 19 pM) elsevier_step2c
140 PDGF-C protein P01127 α-PC CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC 20.0 pM -10.699 intrinsic KD Gold v4 extraction_verified verified_in_text_or_SI original   SPR   7.4 HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4)   DNA PEG 42138517 10.1167/iovs.67.5.36 SPR analysis demonstrated that the α -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM step2c_literal_v3
146 P-selectin protein Q14242 PF377sl   29.0 pM -10.538 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377sl | 29 step2c_literal_v3
669 bevacizumab protein P31995 A14#1 GCGGTTGGTGGTAGTTACGTTCGC 44.0 pM -10.357 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         abstract       35114463 10.1016/j.bios.2022.114027 affinity of A14#1 to bevacizumab markedly increased at pH 4.7 ( K D = 44 pM) elsevier_step2c
145 P-selectin protein Q14242 PF377sl   46.0 pM -10.337 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377sl | 46 step2c_literal_v3
148 P-selectin protein Q14242 PF373sl   56.0 pM -10.252 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF373sl | 56 step2c_literal_v3
9 sLe X -BSA glycan/conjugate Q9NSU2 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 5.7e-11 M -10.244 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR 298.15 7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11 step2c_literal_v3
56 von Willebrand factor A1-domain protein P04275 Rn-DsDsDs-53mh   61.3 pM -10.213 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR 310.15   1 × PBS supplemented with 0.05% (w/v) Nonidet P-40   DNA Ds (7-(2-thienyl)imidazo[4,5b]pyridine); mini-hairpin DNA 27966933 10.1021/jacs.6b10767 RnDsDsDs-53mh ( K D = 61.3 pM) step2c_literal_v3
542 Myoglobin protein P02144 anti-Mb aptamer   65.0 pM -10.187 intrinsic Kd Gold elsevier extraction_verified pending_manual_supp           text       25957831 10.1016/j.bios.2015.04.089 The corresponding af fi nity, K D, values calculated from the ratio between dissociation ( k d) and association ( k a ) was found to be 65 pM. elsevier_step2c
53 von Willebrand factor A1-domain protein P04275 Rn-DsDsDs-44   74.9 pM -10.126 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR 310.15   1 × PBS supplemented with 0.05% (w/v) Nonidet P-40   DNA Ds (7-(2-thienyl)imidazo[4,5b]pyridine) 27966933 10.1021/jacs.6b10767 Rn-DsDsDs-44 ( K D = 74.9 pM) exhibited the highest a ffi nity step2c_literal_v3
3 sLe X -BSA glycan/conjugate Q9NSU2 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 8.5e-11 M -10.071 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR 298.15 7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11 step2c_literal_v3
152 PDGF-BB protein P01127 PDGF-B aptamer   0.1 nM -10.0 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding         DNA 2'-fluoro; 2'-O-methyl; hexaethylene glycol spacer; inverted 3'-3' thymidine cap; 40-kd PEG conjugated 9916931 10.1016/S0002-9440(10)65263-7 the binding affinity of the aptamer used in the experiments described below ( K d ≈ 0.1 nM) step2c_literal_v3
547 ofloxacin protein Q9H015 Q2 ATACCAGCTTATTCAATTGCAGGGTATCTGAGGCTTGATCTACTAAATGTCGTGGGGCATTGCTATTGGCGTTGATACGTACAATCGTAATCAGTTAG 0.11 nM -9.959 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       26547431 10.1016/j.bios.2015.10.069 Their K D values were calculated at K D 1⁄4 0.11 nM ( 7 0.06) for aptamer Q2 elsevier_step2c
331 MutS protein O15457 2-06 ACTTCTGCCCGCCTCCTTCCTGGTAAAGTCATTAATAGGTGTGGGGTGCCGGGCATTTCGGAGACGAGATAGGCGGACACT 1.23e-10 M -9.91 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 25668425 10.1021/acs.analchem.5b00171 The best fi t was obtained at K d = 123 pM and [T]0 = 213 pM step2c_acs_v1
149 P-selectin protein Q14242 PF398sl   178.0 pM -9.75 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF398sl | 178 step2c_literal_v3
57 von Willebrand factor A1-domain protein P04275 Rn-DsDs-51mh2   182.0 pM -9.74 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR 310.15   1 × PBS supplemented with 0.05% (w/v) Nonidet P-40   DNA Ds (7-(2-thienyl)imidazo[4,5b]pyridine); mini-hairpin DNA 27966933 10.1021/jacs.6b10767 Rn-DsDs-51mh2 ( K D = 182 pM) step2c_literal_v3
363 HBcAg protein   A-9 AGCAGCACAGAGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCTACCGTGAA 2.0000000000000003e-10 M -9.699 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   affinity_real_time_qPCR         DNA   32250595 10.1021/acs.analchem.9b05740 This aptamer showed strong binding to HBcAg ( K d : 0.2 nM) step2c_acs_v1
548 ofloxacin protein Q9H015 Q8 ATACCAGCTTATTCAATTAGTTGTGTATTGAGGTTTGATCTAGGCATAGTCAACAGAGCACGATCGATCTGGCTTGTTCTACAATCGTAATCAGTTAG 0.2 nM -9.699 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       26547431 10.1016/j.bios.2015.10.069 K D 1⁄4 0.20 nM ( 7 0.09) for aptamer Q8 elsevier_step2c
558 OH-BDE47 protein   BDE-A-8 GACAGCCGGGGCATCAGAGCAGCCGATTGTCTGTTGTGCC 0.2 nM -9.699 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       27566357 10.1016/j.aca.2016.06.040 The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition. elsevier_step2c
639 thrombin protein P00734 29-mer thrombin-specific aptamer AGTCCGTGGTAGGGCAGGTTGGGGTGACT 298.0 pM -9.526 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       32570818 10.3390/s20123442 The n-curve analysis provided a Kd of 298 pM ( + 111 / 81 pM) elsevier_step2c
318 VEGF165 protein P15692 3R02 TGTGGGGGTGGACTGGGTGGGTACC 3e-10 M -9.523 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 23237717 10.1021/ac303023d The K d value for 3R02 was 300 pM step2c_acs_v1
660 20 Methyl Spirolide G protein   SPX 7 GGCGGTGTGGGTACCACGAGGTTTGGACGCGCGTAGCACCCCATTCAGC 3e-10 M -9.523 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       34144421 10.1016/j.foodchem.2021.130332 The present study, among the aptamers selected, the aptamer with highest affinity had a dissociation constant of 0.3 nM for SPX G elsevier_step2c
554 chimeric-tPA protein   Chi-tPA 1 TTCCAACGGTTGGTGGGTGGTT 0.32 nM -9.495 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         abstract       26876003 10.1016/j.pep.2016.02.004 selected aptamer having KD values of 0.320 nM elsevier_step2c
55 von Willebrand factor A1-domain protein P04275 ARC1172-41   326.0 pM -9.487 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR 310.15   1 × PBS supplemented with 0.05% (w/v) Nonidet P-40   DNA   27966933 10.1021/jacs.6b10767 ARC1172-41 ( K D = 326 pM) step2c_literal_v3
478 FLRPp (O serotype) protein   FMD_1   3.46e-10 M -9.461 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     SPR         DNA   42010751 10.1021/acs.analchem.5c04748 dissociation constants ( KD ) of 3.46 × 10 -10 M step2c_acs_v1
358 HBeAg protein   EAg3-Py TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGAGATGTTTGGTTTT 4.0000000000000007e-10 M -9.398 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   affinity_real_time_qPCR   7.4 1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)   DNA pyrrolo-dC 32250595 10.1021/acs.analchem.9b05740 The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3 step2c_acs_v1
50 PDGF-BB protein P01127 PDGF-specific aptamer   5e-10 M -9.301 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     microcantilever 310.15 7.4 PBSM buffer (10.1 mM Na2HPO4, 1.8 mM KH2PO4, 137 mM NaCl, 2.7 mM KCl, and 1 mM MgCl2, pH 7.4) 1.0 DNA 3'-3'-linked thymidine nucleotide ([3'T]); thiolated 5'-end 24723743 10.1016/j.snb.2012.02.045 K d , as shown in Fig. 10, decreased from approximately 12 × 10 -10 M to 5 × 10 -10 M as the temperature changed from 19 to 37 ◦ C. step2c_literal_v3
415 BDNF protein P23560 NV_B12 GGATTTGAGCTTATGTGGCATAGGTTGCCTGGGTGGGTGGGGTCGGGGAA 5e-10 M -9.301 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   ALISA     1 × selection buffer   DNA biotin 38149631 10.1021/acschemneuro.3c00661 The equilibrium dissociation constant ( K d) for the NV_B12/BDNF interaction was obtained by fitting the equation, Y = B max × X /( K d + X )... The K d value determined to be 0.5 nM (95% CI: 0.4 -0.6 nM) step2c_acs_v1
550 Thrombin protein P00734 TBA29   5e-10 M -9.301 intrinsic Kd Gold elsevier extraction_verified pending_manual_supp           text       26643617 10.1016/j.jconrel.2015.11.028 and TBA29 (~5 × 10 -10 M) elsevier_step2c
343 PlanarAu protein   1N TATGCATGTGTAGTAAGACCTAGTCCACAATCAACG 5.600000000000001e-10 M -9.252 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   QCM     AIB   DNA   30189130 10.1021/acscombsci.8b00048 aptamer 1N showing the highest affinity (0.56 nM) step2c_acs_v1
530 AGEs-HSA protein   #9s TCTGCCACCCTCCGACTAACATATCCGGCCTGAGACCA 0.57 nM -9.244 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI backfill_text_verified         abstract       24012635 10.1016/j.mvr.2013.08.010 Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively. elsevier_step2c
2 sLe X -BSA glycan/conjugate Q9NSU2 Selected pool   5.8e-10 M -9.237 intrinsic Kd Gold v4 extraction_verified no_single_sequence_pool   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Selected pool | 2.4 3 10 5 | 1.4 3 10 2 3 | 1.7 3 10 9 | 5.8 3 10 2 10 step2c_literal_v3
529 AGEs-HSA protein   #4s CAGAATCGGGGACCACGACACTGCACATACCTCGTACGAA 0.63 nM -9.201 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI backfill_text_verified         abstract       24012635 10.1016/j.mvr.2013.08.010 Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively. elsevier_step2c
332 MutS protein O15457 2-06 ACTTCTGCCCGCCTCCTTCCTGGTAAAGTCATTAATAGGTGTGGGGTGCCGGGCATTTCGGAGACGAGATAGGCGGACACT 6.5e-10 M -9.187 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 25668425 10.1021/acs.analchem.5b00171 The experimental points from the second step resulted in the best fi t with the theoretical dependence of R versus [L] 0 at K d = 650 pM step2c_acs_v1
536 tetracycline protein Q14728 TC aptamer   770.0 pM -9.114 intrinsic Kd Gold elsevier extraction_verified pending_manual_supp           text       25517161 10.1016/j.bpj.2014.11.001 dissociation constant Kd of 770 pM ([Mg 2 þ ] 1⁄4 10 mM) elsevier_step2c
4 sLe X -BSA glycan/conjugate Q9NSU2 Clone 2   8e-10 M -9.097 intrinsic Kd Gold v4 extraction_verified pending_manual_figure   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 2 | 9.8 3 10 5 | 7.3 3 10 2 5 | 1.2 3 10 9 | 8.0 3 10 2 10 step2c_literal_v3
459 PSMA protein Q04609 C3   8.000000000000001e-10 M -9.097 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     EMSA     5 mM Mg2+   DNA phenol-dT; naphthyl-dC; PSMA-617 bait 41126016 10.1021/jacs.5c13307 an exemplar shows very high affinity for PSMA ( K d ∼ 0.8 nM). step2c_acs_v1
634 Immunoglobulin E protein Q96D42 IgE37-T10-FAM GGGGCACGTTTATCCGTCCCTAGTGGCGTGCCCC 0.8 nM -9.097 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         abstract       32498825 10.1016/j.talanta.2020.121018 The FA assay using T10-labeled aptamer with a dissociation constant ( K d) about 0.8 nM elsevier_step2c
33 Tasset - thrombin complex protein   Bock GGTTGGTGTGGTTGG 0.87 nM -9.06 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   BSI 283.15 7.5 50 mM TRIS buffer (pH 7.5) containing 100 mM NaCl and 1 mM MgCl2 1.0 DNA   22032342 10.1021/ac202823m Bock - [Tasset complex] | not available | 0.87 ( 0.18 nM step2c_literal_v3
38 alpha-thrombin protein P05154 RNAR9D-14T GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC 1.0 nM -9.0 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding 310.15 7.4 Hepes-saline buffer with 0.01% BSA   2'F-RNA 2' Fluorocytosine; 2' Fluorouracil 22385910 10.1111/j.1538-7836.2012.04679.x Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) and α-thrombin (apparent Kd =1 nM) step2c_literal_v3

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';