Binding affinities (Kd) — source-verified (view)
Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target
- target_name_canonical
- Target as named in the source paper.
- target_type
- protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
- target_uniprot
- UniProt accession when a human protein (sparse for now; links to apt-scout target).
- aptamer_name
- Aptamer identifier as reported.
- kd_reported
- Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
- kd_log10_molar
- log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
- measurement_class
- intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
- binding_constant_type
- Kd / apparent-Kd etc. as reported.
- assay_method
- SPR / filter binding / flow cytometry / ITC / BLI …
- assay_temperature_k
- Assay temperature (K) — a reason the same pair can have several rows.
- source_pmid
- PubMed ID of the source paper (links out).
- verbatim_quote
- The exact sentence the value was taken from.
- verification_level
- QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
- sequence_status
- Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
- pi_provenance_flag
- PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
- seq_source
- original (already in source DB) / backfill_text_verified (recovered from paper or SI text).
155 rows where measurement_class = "non_intrinsic" sorted by kd_log10_molar
This data as json, CSV (advanced)
Suggested facets: target_uniprot, seq_source, assay_temperature_k, assay_ph, assay_buffer, assay_cations, aptamer_chemistry, source_db
assay_method 11
- flow_cytometry 91
- SPR 22
- CE-LIF 10
- ELISA 5
- fluorescence 4
- filter_binding 3
- BLI 2
- ELONA 1
- FACS 1
- microscale thermophoresis 1
- qRT-PCR 1
sequence_status 5
verification_level 2
tier 1
- Gold 155
measurement_class 1
- non_intrinsic · 155 ✖
binding_constant_type 1
- Kd 155
| id | target_name_canonical | target_type | target_uniprot | aptamer_name | aptamer_seq | kd_reported | kd_log10_molar ▼ | measurement_class | binding_constant_type | tier | source_origin | verification_level | sequence_status | seq_source | pi_provenance_flag | assay_method | assay_temperature_k | assay_ph | assay_buffer | assay_cations | aptamer_chemistry | aptamer_modifications | source_pmid | doi | verbatim_quote | source_db |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 188 | PDGF-BB | protein | P01127 | 36aApt | 0.036 pM | -13.444 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | ELISA | 298.0 | DNA | 28825469 | 10.1021/acscombsci.6b00163 | 36aApt | 0.036 ± 0.012 | - 18.33 | step2c_literal_v3 | |||||||
| 186 | PDGF-BB | protein | P01127 | 38aApt | 0.094 pM | -13.027 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | ELISA | 298.0 | DNA | 28825469 | 10.1021/acscombsci.6b00163 | 38aApt | 0.094 ± 0.008 | - 17.76 | step2c_literal_v3 | |||||||
| 208 | SW480 cells | cell/EV | Q16520 | Apt-nanovesicle | 3.66 pM | -11.437 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | DNA | cholesterol; multivalent | 32049531 | 10.1021/jacs.9b13782 | The dissociation constant ( K d ) value of Apt-nanovesicle against SW480 cells was found to be 3.66 ± 0.34 pM (Figure 2B) | step2c_literal_v3 | ||||||||
| 184 | PDGF-BB | protein | P01127 | FullApt | 5.33 pM | -11.273 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | ELISA | 298.0 | DNA | 28825469 | 10.1021/acscombsci.6b00163 | FullApt | 5.33 ± 2.36 | - 15.37 | step2c_literal_v3 | |||||||
| 185 | PDGF-BB | protein | P01127 | 40Apt | 5.92 pM | -11.228 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | ELISA | 298.0 | DNA | 28825469 | 10.1021/acscombsci.6b00163 | 40Apt | 5.92 ± 1.13 | - 15.31 | step2c_literal_v3 | |||||||
| 187 | PDGF-BB | protein | P01127 | 38bApt | 7.03 pM | -11.153 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | ELISA | 298.0 | DNA | 28825469 | 10.1021/acscombsci.6b00163 | 38bApt | 7.03 ± 1.28 | - 15.21 | step2c_literal_v3 | |||||||
| 269 | thrombin | protein | P00734 | HD1-12A-DAB | 13.1 pM | -10.883 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | filter_binding | selection buffer | DNA | 41053535 | 10.1002/advs.202509867 | HD1-12A-DAB EXACT inhibitor bound to thrombin and prothrombin with K D s of 13.1 pm | step2c_literal_v3 | |||||||
| 209 | SW480 cells | cell/EV | Q16520 | Fixed Apt-nanovesicle | 28.06 pM | -10.552 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | DNA | cholesterol; crosslinked | 32049531 | 10.1021/jacs.9b13782 | the K d value of fi xed Apt-nanovesicles to SW480 cells was increased to 28.06 ± 3.31 pM (Figure 2D) | step2c_literal_v3 | ||||||||
| 219 | CCRF-CEM cells | cell/EV | Q9NRR3 | CDN-sgc8 | 0.08 nM | -10.097 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | fluorescence | 1 × PBS, 5 mM MgCl2 | 5.0 | DNA | biotinylated | 35670775 | 10.1021/acs.analchem.2c01359 | Kd=0.08±0.01 nM | step2c_literal_v3 | |||||
| 245 | MPO | protein | P05164 | MPO-16 | GTCTGGAAACGACGAGGGCCACTGATTAACGTAGTTAATTGGTCTTGTCG | 166.0 pM | -9.78 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | flow_cytometry | selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) | 2.5 | DNA | 37277648 | 10.1038/s41557-023-01207-z | MPO16 revealed the highest binding affinity ( K d = 166 pM) | step2c_literal_v3 | ||||
| 234 | MPO | protein | P05164 | MPO-02 | TATGCGATTTCAAAAATGTTACGATGGATATTGACATTTAAATATGTCGG | 227.0 pM | -9.644 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | flow_cytometry | selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) | 2.5 | DNA | 37277648 | 10.1038/s41557-023-01207-z | MPO-02 ... 227 | step2c_literal_v3 | ||||
| 307 | P-selectin | protein | Q14242 | PF377sl | 250.0 pM | -9.602 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | flow_cytometry | 296.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF377sl | 250 | step2c_literal_v3 | ||||
| 247 | Human thrombin | protein | P00734 | Lin08-08 | 0.4 nM | -9.398 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | KEEP_seq_in_figure | SPR | 7.4 | PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20 | DNA | 37621412 | 10.1016/j.omtn.2023.07.038 | Lin(08-08) | 1.63 10^6 | 6.94 10^-4 | 0.4 | step2c_literal_v3 | |||||
| 249 | Human thrombin | protein | P00734 | Pse08-08 | 0.4 nM | -9.398 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | KEEP_seq_in_figure | SPR | 7.4 | PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20 | DNA | 37621412 | 10.1016/j.omtn.2023.07.038 | Pse(08-08) | 1.19 10^6 | 5.10 10^-4 | 0.4 | step2c_literal_v3 | |||||
| 218 | CCRF-CEM cells | cell/EV | Q9NRR3 | mono-CDN-sgc8 | 0.48 nM | -9.319 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | fluorescence | 1 × PBS, 5 mM MgCl2 | 5.0 | DNA | biotinylated | 35670775 | 10.1021/acs.analchem.2c01359 | Kd= 0.48 ± 0.04 nM | step2c_literal_v3 | |||||
| 173 | human α-thrombin | protein | P00734 | Apt29 | AGTCCGTGGTAGGGCAGGTTGGGGTGACT | 0.5 nM | -9.301 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | DNA | 28763192 | 10.1021/acs.analchem.7b02313 | a 29nucleotide aptamer (5 ′ -AGT CCG TGG TAG GGC AGG TTG GGG TGA CT-3 ′ , denoted as Apt29 here) binds to the heparin-binding site of human α -thrombin with a dissociation constant ( K d) around 0.5 nM. | step2c_literal_v3 | |||||||
| 205 | thrombin | protein | P00734 | TBA29 | 0.5 nM | -9.301 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | DNA | 31614078 | 10.1021/acs.analchem.9b03368 | The 29-nt TBA29 aptamer has a bimodular duplex-antiparallel G4 structure and binds to thrombin with a binding a ffi nity of 0.5 nM. 30 | step2c_literal_v3 | |||||||||
| 175 | human α-thrombin | protein | P00734 | 5'-TMR-Apt15-T24 | GGTTGGTGTGGTTGG | 0.6 nM | -9.222 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | CE-LIF | 298.15 | 7.5 | sample bu ff er containing 10 mM Tris-HCl (pH 7.5) and 5 mM KCl | DNA | TMR label at 5'-end; polyT tail (24 T) at 3'-end | 28763192 | 10.1021/acs.analchem.7b02313 | 0.6 nM for 5 ′ -TMR-Apt15-T24 | step2c_literal_v3 | ||
| 176 | human α-thrombin | protein | P00734 | 5'-TMR-Apt15-T25 | GGTTGGTGTGGTTGG | 0.6 nM | -9.222 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | CE-LIF | 298.15 | 7.5 | sample bu ff er containing 10 mM Tris-HCl (pH 7.5) and 5 mM KCl | DNA | TMR label at 5'-end; polyT tail (25 T) at 3'-end | 28763192 | 10.1021/acs.analchem.7b02313 | 0.6 nM for 5 ′ -TMR-Apt15-T25 | step2c_literal_v3 | ||
| 303 | EGFR | protein | P00533 | Anti-EGF receptor aptamer | 0.62 nM | -9.208 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | DNA | 3' end sulfhydryl group (-SH) | 41877526 | 10.1021/acs.molpharmaceut.5c01966 | Anti-EGF receptor aptamers ( K d : 0.62 nM, DNA aptamers) | step2c_literal_v3 | ||||||||
| 154 | thrombin | protein | P00734 | HD1-22 | GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT | 6.5e-10 M | -9.187 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | DNA | bivalent fusion; poly-dA linker | 18826387 | 10.1111/j.1538-7836.2008.03162.x | HD1-22 | Thrombin | K D ( M) | 6.5 · 10 ) 10 | step2c_literal_v3 | |||||
| 177 | human α-thrombin | protein | P00734 | 5'-TMR-Apt15-T30 | GGTTGGTGTGGTTGG | 0.7 nM | -9.155 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | CE-LIF | 298.15 | 7.5 | sample bu ff er containing 10 mM Tris-HCl (pH 7.5) and 5 mM KCl | DNA | TMR label at 5'-end; polyT tail (30 T) at 3'-end | 28763192 | 10.1021/acs.analchem.7b02313 | 0.7 nM for 5 ′ -TMR-Apt15-T30 | step2c_literal_v3 | ||
| 178 | human α-thrombin | protein | P00734 | 5'-TMR-Apt15-T35 | GGTTGGTGTGGTTGG | 0.7 nM | -9.155 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | CE-LIF | 298.15 | 7.5 | sample bu ff er containing 10 mM Tris-HCl (pH 7.5) and 5 mM KCl | DNA | TMR label at 5'-end; polyT tail (35 T) at 3'-end | 28763192 | 10.1021/acs.analchem.7b02313 | 0.7 nM for 5 ′ -TMR-Apt15-T35 | step2c_literal_v3 | ||
| 217 | CCRF-CEM cells | cell/EV | Q9NRR3 | individual sgc8 | 0.82 nM | -9.086 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | fluorescence | 1 × PBS, 5 mM MgCl2 | 5.0 | DNA | biotinylated | 35670775 | 10.1021/acs.analchem.2c01359 | Kd=0.82 ± 0.12 nM | step2c_literal_v3 | |||||
| 241 | MPO | protein | P05164 | MPO-14 | ATATAGTACAGTGAGTAGTTGTACCACATTGTAGGTACTTAGTTGGAATG | 897.0 pM | -9.047 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | flow_cytometry | selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) | 2.5 | DNA | 37277648 | 10.1038/s41557-023-01207-z | MPO-14 ... K d : 897 pM | step2c_literal_v3 | ||||
| 235 | MPO | protein | P05164 | MPO-03 | TTCTTTGTACTACGTATGTGTTACACATCTTAAGTCCGTTTTGATGCAGC | 912.0 pM | -9.04 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | flow_cytometry | selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) | 2.5 | DNA | 37277648 | 10.1038/s41557-023-01207-z | MPO-03 ... 912 | step2c_literal_v3 | ||||
| 233 | MPO | protein | P05164 | MPO-01 | CACTCGTGAAGATCTTTAATAGATAGAATAATCGAGGTTGATTCGATGTA | 1148.0 pM | -8.94 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | flow_cytometry | selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) | 2.5 | DNA | 37277648 | 10.1038/s41557-023-01207-z | MPO-01 ... 1,148 | step2c_literal_v3 | ||||
| 202 | CD8a | protein | P01732 | A3 | 1.9 nM | -8.721 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | flow_cytometry | DNA | 31209354 | 10.1038/s41551-019-0411-6 | the A1, A3 and A8 aptamers have apparent K D values of 18.3 ± 4.6, 1.9 ± 0.8 and 2.4 ± 0.9 nM, respectively | step2c_literal_v3 | ||||||||
| 215 | CD8 | protein | P01732 | CD8 aptamer | 1.9 nM | -8.721 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | flow_cytometry | DNA | 3'-toehold extension | 32786336 | 10.1021/acs.accounts.0c00335 | The aptamer with the highest apparent affinity (1.9 nM) and association rate, measured by flow cytometry and biolayer interferometry, respectively, was chosen for further use in cell isolation. | step2c_literal_v3 | |||||||
| 157 | von Willebrand factor A1 domain | protein | P04275 | ARC1779 | 2.0 nM | -8.699 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | DNA | 20-kDa polyethylene glycol conjugation; nuclease-resistant | 21108551 | 10.1586/erc.10.154 | ARC1779 binds with high affinity (Kd ~ 2 nM) to the vWF A1 domain | step2c_literal_v3 | ||||||||
| 204 | VWF A1 domain | protein | P04275 | ARC1779 | GGCGUGCAGUGCCUUCGGCCGTGCGGTGCCUCCGUCACGCT | 2.0 nM | -8.699 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | DNA | PEG20K; 2'-O-methyl-substituted nucleotides; inverted deoxythymidine cap | 31315441 | 10.1161/ATVBAHA.119.312439 | ARC1779 has a high binding affinity to VWF A1 domain (K D ≈ 2 nM) | step2c_literal_v3 | ||||||
| 228 | CD8 | protein | P01732 | A3t | 2.0 nM | -8.699 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | DNA | 36149728 | 10.1021/acsami.2c11783 | A3t, a CD8 receptor-binding aptamer, which binds CD8-expressing cells with an equilibrium dissociation constant K D of 2 nM. | step2c_literal_v3 | |||||||||
| 232 | CD8 | protein | P01732 | rvCD8apt | 2.0 nM | -8.699 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | DNA | 8 nt toehold | 36149728 | 10.1021/acsami.2c11783 | apparent K D = 2 nM for CD8 + cells | step2c_literal_v3 | ||||||||
| 203 | CD8a | protein | P01732 | A8 | 2.4 nM | -8.62 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | flow_cytometry | DNA | 31209354 | 10.1038/s41551-019-0411-6 | the A1, A3 and A8 aptamers have apparent K D values of 18.3 ± 4.6, 1.9 ± 0.8 and 2.4 ± 0.9 nM, respectively | step2c_literal_v3 | ||||||||
| 237 | MPO | protein | P05164 | MPO-05 | GCATATCAAGCAGAATGTTTTGTCTCTATTTTCTCATATGTTTATGCGTA | 2584.0 pM | -8.588 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | flow_cytometry | selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) | 2.5 | DNA | 37277648 | 10.1038/s41557-023-01207-z | MPO-05 ... 2,584 | step2c_literal_v3 | ||||
| 251 | Human thrombin | protein | P00734 | Pse08-29 | TGACCTCTAGTGACTGATTTACGAGTC | 2.6 nM | -8.585 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | KEEP_seq_in_figure | SPR | 7.4 | PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20 | DNA | 37621412 | 10.1016/j.omtn.2023.07.038 | Pse(08 - 29) | 1.33 10^6 | 3.47 10^-3 | 2.6 | step2c_literal_v3 | |||
| 242 | MPO | protein | P05164 | MPO-18 | TAAGTAATGTGACTGTGTAATTTTTGCTGTCTATAATGCGGATACTGGGT | 3192.0 pM | -8.496 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | flow_cytometry | selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) | 2.5 | DNA | 37277648 | 10.1038/s41557-023-01207-z | MPO-18 ... K d : 3,192 pM | step2c_literal_v3 | ||||
| 181 | human α-thrombin | protein | P00734 | Apt15-T25-3'-TMR | GGTTGGTGTGGTTGG | 3.2 nM | -8.495 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | CE-LIF | 298.15 | 7.5 | sample bu ff er containing 10 mM Tris-HCl (pH 7.5) and 5 mM KCl | DNA | TMR label at 3'-end; polyT tail (25 T) at 3'-end | 28763192 | 10.1021/acs.analchem.7b02313 | The apparent K d of Apt15-T25 -3 ′ -TMR was estimated to be about 3.2 nM. | step2c_literal_v3 | ||
| 211 | K562 | protein | Q8WUY8 | PAM | 3.2 nM | -8.495 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | DNA | FAM | 32307868 | 10.1002/anie.202004206 | the K d value (3.2 nM) of PAM in binding the K562 cell is one order of magnitude lower than that of the aptamer alone (41 nM). | step2c_literal_v3 | ||||||||
| 226 | transferrin receptor 1 | protein | P02786 | JBA8.26 | 3.3 nM | -8.481 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | flow_cytometry | DNA | 35875870 | 10.1021/jacs.2c05349 | JBA8.26 bound TfR1 hi H9 T-lymphoma cells with an apparent K D of 3.3 ± 0.6 nM | step2c_literal_v3 | ||||||||
| 156 | prothrombin | protein | P00734 | HD1 | GGTTGGTGTGGTTGG | 3.5e-09 M | -8.456 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | SPR | DNA | 18826387 | 10.1111/j.1538-7836.2008.03162.x | HD1 | Prothrombin+ phospholipids | K D ( M) | 3.5 · 10 ) 9 | step2c_literal_v3 | ||||||
| 250 | Mouse thrombin | protein | Pse08-08 | 4.2 nM | -8.377 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | KEEP_seq_in_figure | SPR | 7.4 | PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20 | DNA | 37621412 | 10.1016/j.omtn.2023.07.038 | Pse(08-08) | 7.35 10^5 | 3.06 10^-3 | 4.2 | step2c_literal_v3 | ||||||
| 288 | CD19 | protein | P15391 | WB15/15.CD19.1_3S | ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGTACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT | 4.3 nM | -8.367 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | flow_cytometry | 310.15 | RPMI-1640 medium (+25 mM HEPES, +L-glutamine) | DNA | Spacer 9 | 41079126 | 10.1016/j.omtn.2025.102712 | WB15/15.CD19.1_3S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 3.96 | N.P. | 4.3 ± 2.4 | step2c_literal_v3 | |||
| 236 | MPO | protein | P05164 | MPO-04 | GTGTTAGTCAACGTATGATAAAGACGGGCTGGTATCACCCATTTAGCGAT | 4376.0 pM | -8.359 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | flow_cytometry | selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) | 2.5 | DNA | 37277648 | 10.1038/s41557-023-01207-z | MPO-04 ... 4,376 | step2c_literal_v3 | ||||
| 165 | porcine thrombin | protein | RNAR9D-14T | GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC | 5.0 nM | -8.301 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 2'F-RNA | 2' Fluorocytosine; 2' Fluorouracil | 22385910 | 10.1111/j.1538-7836.2012.04679.x | RNAR9D-14T binds to porcine thrombin (apparent K d=5 nM) | step2c_literal_v3 | ||||||
| 224 | transferrin receptor 1 | protein | P02786 | JBA8.1 | 5.5 nM | -8.26 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | flow_cytometry | DNA | fluorescein-labeled | 35875870 | 10.1021/jacs.2c05349 | JBA8.1 has an apparent binding affinity (K D ) of 5.5 ± 1.2 nM | step2c_literal_v3 | |||||||
| 252 | Mouse thrombin | protein | Pse08-29 | TGACCTCTAGTGACTGATTTACGAGTC | 6.3 nM | -8.201 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | KEEP_seq_in_figure | SPR | 7.4 | PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20 | DNA | 37621412 | 10.1016/j.omtn.2023.07.038 | Pse(08 - 29) | 6.72 10^5 | 4.26 10^-3 | 6.3 | step2c_literal_v3 | ||||
| 306 | CD64 | protein | P12314 | lw-27 | ATACCAGCTTATTCAATTCGCGGTGCACCGGGAACAATCCGGTCGATGACTTCTACTAACCGGGTCGGATGTGCGCGTAGATAGTAAGTGCAATCT | 6.676 nM | -8.175 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | flow_cytometry | 310.15 | cells binding buffer (4.5 g glucose, 5 ml 1 mol/L MgCl2, 100 mg yeast tRNA and 1 g BSA into 1L Dulbecco's Phosphate buffered saline (DPBS)) | 1000.0 | DNA | TAMRA | 42152987 | 10.1007/s12088-025-01475-y | Kd values of aptamers lw-1, lw-9, lw-27 are 12.76 nM, 14.03 nM, and 6.676 nM respectively | step2c_literal_v3 | ||
| 248 | Mouse thrombin | protein | Lin08-08 | 6.7 nM | -8.174 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_supp_oa | KEEP_seq_in_figure | SPR | 7.4 | PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20 | DNA | 37621412 | 10.1016/j.omtn.2023.07.038 | Lin(08-08) | 6.41 10^5 | 4.30 10^-3 | 6.7 | step2c_literal_v3 | ||||||
| 243 | MPO | protein | P05164 | MPO-25 | GATCGCAGCATCAAATAAGAACATTGTGAATTATGTAATCTGGCTATGTG | 8778.0 pM | -8.057 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | flow_cytometry | selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) | 2.5 | DNA | 37277648 | 10.1038/s41557-023-01207-z | MPO-25 ... K d : 8,778 pM | step2c_literal_v3 |
Advanced export
JSON shape: default, array, newline-delimited
CREATE VIEW v_kd AS
SELECT k.id,
target_name_canonical,
CASE
WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
ELSE 'protein'
END AS target_type,
target_uniprot, aptamer_name, aptamer_seq,
(COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
CASE
WHEN vh.verdict='confirmed' THEN 'human_verified'
WHEN vh.verdict='corrected' THEN 'human_corrected'
WHEN vh.verdict='rejected' THEN 'human_rejected'
WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
ELSE 'automated'
END AS verification_level,
sequence_status, seq_source, pi_provenance_flag,
assay_method,
CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';