home / scout

Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

154 rows where measurement_class = "non_intrinsic", tier = "Gold" and verification_level = "extraction_verified" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: target_uniprot, seq_source, assay_temperature_k, assay_ph, assay_buffer, assay_cations, aptamer_chemistry

assay_method 11

  • flow_cytometry 91
  • SPR 22
  • CE-LIF 10
  • ELISA 5
  • fluorescence 4
  • filter_binding 3
  • BLI 2
  • ELONA 1
  • FACS 1
  • microscale thermophoresis 1
  • qRT-PCR 1

sequence_status 5

  • verified_in_text_or_SI 89
  • pending_manual_supp 31
  • pending_supp_oa 24
  • pending_manual_figure 9
  • no_single_sequence_pool 1

target_type 2

  • protein 139
  • cell/EV 15

verification_level 1

  • extraction_verified · 154 ✖

tier 1

  • Gold · 154 ✖

measurement_class 1

  • non_intrinsic · 154 ✖

binding_constant_type 1

  • Kd 154
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
188 PDGF-BB protein P01127 36aApt   0.036 pM -13.444 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ELISA 298.0       DNA   28825469 10.1021/acscombsci.6b00163 36aApt | 0.036 ± 0.012 | - 18.33 step2c_literal_v3
186 PDGF-BB protein P01127 38aApt   0.094 pM -13.027 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ELISA 298.0       DNA   28825469 10.1021/acscombsci.6b00163 38aApt | 0.094 ± 0.008 | - 17.76 step2c_literal_v3
208 SW480 cells cell/EV Q16520 Apt-nanovesicle   3.66 pM -11.437 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp               DNA cholesterol; multivalent 32049531 10.1021/jacs.9b13782 The dissociation constant ( K d ) value of Apt-nanovesicle against SW480 cells was found to be 3.66 ± 0.34 pM (Figure 2B) step2c_literal_v3
184 PDGF-BB protein P01127 FullApt   5.33 pM -11.273 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ELISA 298.0       DNA   28825469 10.1021/acscombsci.6b00163 FullApt | 5.33 ± 2.36 | - 15.37 step2c_literal_v3
185 PDGF-BB protein P01127 40Apt   5.92 pM -11.228 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ELISA 298.0       DNA   28825469 10.1021/acscombsci.6b00163 40Apt | 5.92 ± 1.13 | - 15.31 step2c_literal_v3
187 PDGF-BB protein P01127 38bApt   7.03 pM -11.153 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ELISA 298.0       DNA   28825469 10.1021/acscombsci.6b00163 38bApt | 7.03 ± 1.28 | - 15.21 step2c_literal_v3
269 thrombin protein P00734 HD1-12A-DAB   13.1 pM -10.883 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     filter_binding     selection buffer   DNA   41053535 10.1002/advs.202509867 HD1-12A-DAB EXACT inhibitor bound to thrombin and prothrombin with K D s of 13.1 pm step2c_literal_v3
209 SW480 cells cell/EV Q16520 Fixed Apt-nanovesicle   28.06 pM -10.552 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp               DNA cholesterol; crosslinked 32049531 10.1021/jacs.9b13782 the K d value of fi xed Apt-nanovesicles to SW480 cells was increased to 28.06 ± 3.31 pM (Figure 2D) step2c_literal_v3
219 CCRF-CEM cells cell/EV Q9NRR3 CDN-sgc8   0.08 nM -10.097 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     fluorescence     1 × PBS, 5 mM MgCl2 5.0 DNA biotinylated 35670775 10.1021/acs.analchem.2c01359 Kd=0.08±0.01 nM step2c_literal_v3
245 MPO protein P05164 MPO-16 GTCTGGAAACGACGAGGGCCACTGATTAACGTAGTTAATTGGTCTTGTCG 166.0 pM -9.78 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO16 revealed the highest binding affinity ( K d = 166 pM) step2c_literal_v3
234 MPO protein P05164 MPO-02 TATGCGATTTCAAAAATGTTACGATGGATATTGACATTTAAATATGTCGG 227.0 pM -9.644 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-02 ... 227 step2c_literal_v3
307 P-selectin protein Q14242 PF377sl   250.0 pM -9.602 non_intrinsic Kd Gold v4 extraction_verified pending_manual_figure     flow_cytometry 296.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377sl | 250 step2c_literal_v3
247 Human thrombin protein P00734 Lin08-08   0.4 nM -9.398 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa   KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Lin(08-08) | 1.63 10^6 | 6.94 10^-4 | 0.4 step2c_literal_v3
249 Human thrombin protein P00734 Pse08-08   0.4 nM -9.398 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa   KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Pse(08-08) | 1.19 10^6 | 5.10 10^-4 | 0.4 step2c_literal_v3
218 CCRF-CEM cells cell/EV Q9NRR3 mono-CDN-sgc8   0.48 nM -9.319 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     fluorescence     1 × PBS, 5 mM MgCl2 5.0 DNA biotinylated 35670775 10.1021/acs.analchem.2c01359 Kd= 0.48 ± 0.04 nM step2c_literal_v3
173 human α-thrombin protein P00734 Apt29 AGTCCGTGGTAGGGCAGGTTGGGGTGACT 0.5 nM -9.301 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original             DNA   28763192 10.1021/acs.analchem.7b02313 a 29nucleotide aptamer (5 ′ -AGT CCG TGG TAG GGC AGG TTG GGG TGA CT-3 ′ , denoted as Apt29 here) binds to the heparin-binding site of human α -thrombin with a dissociation constant ( K d) around 0.5 nM. step2c_literal_v3
205 thrombin protein P00734 TBA29   0.5 nM -9.301 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp               DNA   31614078 10.1021/acs.analchem.9b03368 The 29-nt TBA29 aptamer has a bimodular duplex-antiparallel G4 structure and binds to thrombin with a binding a ffi nity of 0.5 nM. 30 step2c_literal_v3
175 human α-thrombin protein P00734 5'-TMR-Apt15-T24 GGTTGGTGTGGTTGG 0.6 nM -9.222 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   CE-LIF 298.15 7.5 sample bu ff er containing 10 mM Tris-HCl (pH 7.5) and 5 mM KCl   DNA TMR label at 5'-end; polyT tail (24 T) at 3'-end 28763192 10.1021/acs.analchem.7b02313 0.6 nM for 5 ′ -TMR-Apt15-T24 step2c_literal_v3
176 human α-thrombin protein P00734 5'-TMR-Apt15-T25 GGTTGGTGTGGTTGG 0.6 nM -9.222 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   CE-LIF 298.15 7.5 sample bu ff er containing 10 mM Tris-HCl (pH 7.5) and 5 mM KCl   DNA TMR label at 5'-end; polyT tail (25 T) at 3'-end 28763192 10.1021/acs.analchem.7b02313 0.6 nM for 5 ′ -TMR-Apt15-T25 step2c_literal_v3
303 EGFR protein P00533 Anti-EGF receptor aptamer   0.62 nM -9.208 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp               DNA 3' end sulfhydryl group (-SH) 41877526 10.1021/acs.molpharmaceut.5c01966 Anti-EGF receptor aptamers ( K d : 0.62 nM, DNA aptamers) step2c_literal_v3
154 thrombin protein P00734 HD1-22 GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT 6.5e-10 M -9.187 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR         DNA bivalent fusion; poly-dA linker 18826387 10.1111/j.1538-7836.2008.03162.x HD1-22 | Thrombin | K D ( M) | 6.5 · 10 ) 10 step2c_literal_v3
177 human α-thrombin protein P00734 5'-TMR-Apt15-T30 GGTTGGTGTGGTTGG 0.7 nM -9.155 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   CE-LIF 298.15 7.5 sample bu ff er containing 10 mM Tris-HCl (pH 7.5) and 5 mM KCl   DNA TMR label at 5'-end; polyT tail (30 T) at 3'-end 28763192 10.1021/acs.analchem.7b02313 0.7 nM for 5 ′ -TMR-Apt15-T30 step2c_literal_v3
178 human α-thrombin protein P00734 5'-TMR-Apt15-T35 GGTTGGTGTGGTTGG 0.7 nM -9.155 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   CE-LIF 298.15 7.5 sample bu ff er containing 10 mM Tris-HCl (pH 7.5) and 5 mM KCl   DNA TMR label at 5'-end; polyT tail (35 T) at 3'-end 28763192 10.1021/acs.analchem.7b02313 0.7 nM for 5 ′ -TMR-Apt15-T35 step2c_literal_v3
217 CCRF-CEM cells cell/EV Q9NRR3 individual sgc8   0.82 nM -9.086 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     fluorescence     1 × PBS, 5 mM MgCl2 5.0 DNA biotinylated 35670775 10.1021/acs.analchem.2c01359 Kd=0.82 ± 0.12 nM step2c_literal_v3
241 MPO protein P05164 MPO-14 ATATAGTACAGTGAGTAGTTGTACCACATTGTAGGTACTTAGTTGGAATG 897.0 pM -9.047 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-14 ... K d : 897 pM step2c_literal_v3
235 MPO protein P05164 MPO-03 TTCTTTGTACTACGTATGTGTTACACATCTTAAGTCCGTTTTGATGCAGC 912.0 pM -9.04 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-03 ... 912 step2c_literal_v3
233 MPO protein P05164 MPO-01 CACTCGTGAAGATCTTTAATAGATAGAATAATCGAGGTTGATTCGATGTA 1148.0 pM -8.94 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-01 ... 1,148 step2c_literal_v3
202 CD8a protein P01732 A3   1.9 nM -8.721 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa     flow_cytometry         DNA   31209354 10.1038/s41551-019-0411-6 the A1, A3 and A8 aptamers have apparent K D values of 18.3 ± 4.6, 1.9 ± 0.8 and 2.4 ± 0.9 nM, respectively step2c_literal_v3
215 CD8 protein P01732 CD8 aptamer   1.9 nM -8.721 non_intrinsic Kd Gold v4 extraction_verified pending_manual_figure     flow_cytometry         DNA 3'-toehold extension 32786336 10.1021/acs.accounts.0c00335 The aptamer with the highest apparent affinity (1.9 nM) and association rate, measured by flow cytometry and biolayer interferometry, respectively, was chosen for further use in cell isolation. step2c_literal_v3
157 von Willebrand factor A1 domain protein P04275 ARC1779   2.0 nM -8.699 non_intrinsic Kd Gold v4 extraction_verified pending_manual_figure               DNA 20-kDa polyethylene glycol conjugation; nuclease-resistant 21108551 10.1586/erc.10.154 ARC1779 binds with high affinity (Kd ~ 2 nM) to the vWF A1 domain step2c_literal_v3
204 VWF A1 domain protein P04275 ARC1779 GGCGUGCAGUGCCUUCGGCCGTGCGGTGCCUCCGUCACGCT 2.0 nM -8.699 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original             DNA PEG20K; 2'-O-methyl-substituted nucleotides; inverted deoxythymidine cap 31315441 10.1161/ATVBAHA.119.312439 ARC1779 has a high binding affinity to VWF A1 domain (K D ≈ 2 nM) step2c_literal_v3
228 CD8 protein P01732 A3t   2.0 nM -8.699 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp               DNA   36149728 10.1021/acsami.2c11783 A3t, a CD8 receptor-binding aptamer, which binds CD8-expressing cells with an equilibrium dissociation constant K D of 2 nM. step2c_literal_v3
232 CD8 protein P01732 rvCD8apt   2.0 nM -8.699 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp               DNA 8 nt toehold 36149728 10.1021/acsami.2c11783 apparent K D = 2 nM for CD8 + cells step2c_literal_v3
203 CD8a protein P01732 A8   2.4 nM -8.62 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa     flow_cytometry         DNA   31209354 10.1038/s41551-019-0411-6 the A1, A3 and A8 aptamers have apparent K D values of 18.3 ± 4.6, 1.9 ± 0.8 and 2.4 ± 0.9 nM, respectively step2c_literal_v3
237 MPO protein P05164 MPO-05 GCATATCAAGCAGAATGTTTTGTCTCTATTTTCTCATATGTTTATGCGTA 2584.0 pM -8.588 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-05 ... 2,584 step2c_literal_v3
251 Human thrombin protein P00734 Pse08-29 TGACCTCTAGTGACTGATTTACGAGTC 2.6 nM -8.585 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Pse(08 - 29) | 1.33 10^6 | 3.47 10^-3 | 2.6 step2c_literal_v3
242 MPO protein P05164 MPO-18 TAAGTAATGTGACTGTGTAATTTTTGCTGTCTATAATGCGGATACTGGGT 3192.0 pM -8.496 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-18 ... K d : 3,192 pM step2c_literal_v3
181 human α-thrombin protein P00734 Apt15-T25-3'-TMR GGTTGGTGTGGTTGG 3.2 nM -8.495 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   CE-LIF 298.15 7.5 sample bu ff er containing 10 mM Tris-HCl (pH 7.5) and 5 mM KCl   DNA TMR label at 3'-end; polyT tail (25 T) at 3'-end 28763192 10.1021/acs.analchem.7b02313 The apparent K d of Apt15-T25 -3 ′ -TMR was estimated to be about 3.2 nM. step2c_literal_v3
211 K562 protein Q8WUY8 PAM   3.2 nM -8.495 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp               DNA FAM 32307868 10.1002/anie.202004206 the K d value (3.2 nM) of PAM in binding the K562 cell is one order of magnitude lower than that of the aptamer alone (41 nM). step2c_literal_v3
226 transferrin receptor 1 protein P02786 JBA8.26   3.3 nM -8.481 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa     flow_cytometry         DNA   35875870 10.1021/jacs.2c05349 JBA8.26 bound TfR1 hi H9 T-lymphoma cells with an apparent K D of 3.3 ± 0.6 nM step2c_literal_v3
156 prothrombin protein P00734 HD1 GGTTGGTGTGGTTGG 3.5e-09 M -8.456 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR         DNA   18826387 10.1111/j.1538-7836.2008.03162.x HD1 | Prothrombin+ phospholipids | K D ( M) | 3.5 · 10 ) 9 step2c_literal_v3
250 Mouse thrombin protein   Pse08-08   4.2 nM -8.377 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa   KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Pse(08-08) | 7.35 10^5 | 3.06 10^-3 | 4.2 step2c_literal_v3
288 CD19 protein P15391 WB15/15.CD19.1_3S ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGTACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT 4.3 nM -8.367 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   flow_cytometry 310.15   RPMI-1640 medium (+25 mM HEPES, +L-glutamine)   DNA Spacer 9 41079126 10.1016/j.omtn.2025.102712 WB15/15.CD19.1_3S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 3.96 | N.P. | 4.3 ± 2.4 step2c_literal_v3
236 MPO protein P05164 MPO-04 GTGTTAGTCAACGTATGATAAAGACGGGCTGGTATCACCCATTTAGCGAT 4376.0 pM -8.359 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-04 ... 4,376 step2c_literal_v3
165 porcine thrombin protein   RNAR9D-14T GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC 5.0 nM -8.301 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding         2'F-RNA 2' Fluorocytosine; 2' Fluorouracil 22385910 10.1111/j.1538-7836.2012.04679.x RNAR9D-14T binds to porcine thrombin (apparent K d=5 nM) step2c_literal_v3
224 transferrin receptor 1 protein P02786 JBA8.1   5.5 nM -8.26 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa     flow_cytometry         DNA fluorescein-labeled 35875870 10.1021/jacs.2c05349 JBA8.1 has an apparent binding affinity (K D ) of 5.5 ± 1.2 nM step2c_literal_v3
252 Mouse thrombin protein   Pse08-29 TGACCTCTAGTGACTGATTTACGAGTC 6.3 nM -8.201 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Pse(08 - 29) | 6.72 10^5 | 4.26 10^-3 | 6.3 step2c_literal_v3
306 CD64 protein P12314 lw-27 ATACCAGCTTATTCAATTCGCGGTGCACCGGGAACAATCCGGTCGATGACTTCTACTAACCGGGTCGGATGTGCGCGTAGATAGTAAGTGCAATCT 6.676 nM -8.175 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   flow_cytometry 310.15   cells binding buffer (4.5 g glucose, 5 ml 1 mol/L MgCl2, 100 mg yeast tRNA and 1 g BSA into 1L Dulbecco's Phosphate buffered saline (DPBS)) 1000.0 DNA TAMRA 42152987 10.1007/s12088-025-01475-y Kd values of aptamers lw-1, lw-9, lw-27 are 12.76 nM, 14.03 nM, and 6.676 nM respectively step2c_literal_v3
248 Mouse thrombin protein   Lin08-08   6.7 nM -8.174 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa   KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Lin(08-08) | 6.41 10^5 | 4.30 10^-3 | 6.7 step2c_literal_v3
243 MPO protein P05164 MPO-25 GATCGCAGCATCAAATAAGAACATTGTGAATTATGTAATCTGGCTATGTG 8778.0 pM -8.057 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-25 ... K d : 8,778 pM step2c_literal_v3

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options:

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';
Powered by Datasette · Queries took 52.83ms · Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target