home / scout

Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

322 rows where sequence_status = "verified_in_text_or_SI", tier = "Gold" and verification_level = "extraction_verified" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: source_origin, seq_source, assay_temperature_k, assay_ph, assay_cations, aptamer_chemistry, source_db

assay_method 16

  • flow_cytometry 55
  • SPR 46
  • MST 19
  • filter_binding 14
  • fluorescence 10
  • CE-LIF 7
  • QCM 5
  • BSI 4
  • BLI 3
  • ELISA 2
  • FACS 2
  • ITC 2
  • mass_spectrometry 2
  • microscale thermophoresis 2
  • qPCR 1
  • qRT-PCR 1

target_type 2

  • protein 317
  • glycan/conjugate 5

measurement_class 2

  • intrinsic 233
  • non_intrinsic 89

binding_constant_type 2

  • Kd 319
  • KD 3

verification_level 1

  • extraction_verified · 322 ✖

tier 1

  • Gold · 322 ✖

sequence_status 1

  • verified_in_text_or_SI · 322 ✖
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
44 IL-8 protein P10145 8A-35 GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC 1.72e-12 M -11.764 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.0 7.4 HBST running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, and 0.005% Tween 20)   2'F-RNA 2'-fluoro-pyrimidine modified 24129312 10.1016/j.biomaterials.2013.09.107 | 8A-35 | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80 | 3.11 x 10 1 | step2c_literal_v3
621 nucleolin protein P19338 Cy5-AT11-B0 TGGTGGTGGTTGGTGGTGGTGGTGGT 3.3e-12 M -11.481 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       31301466 10.1016/j.ijpharm.2019.118511 yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8 elsevier_step2c
620 nucleolin protein P19338 Cy5-AT11 TGGTGGTGGTTGTTGTGGTGGTGGTGGT 5.2e-12 M -11.284 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       31301466 10.1016/j.ijpharm.2019.118511 yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8 elsevier_step2c
618 nucleolin protein P19338 Cy5-AT11 TGGTGGTGGTTGTTGTGGTGGTGGTGGT 9.1e-12 M -11.041 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       31301466 10.1016/j.ijpharm.2019.118511 K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4 elsevier_step2c
619 nucleolin protein P19338 Cy5-AT11-B0 TGGTGGTGGTTGGTGGTGGTGGTGGT 9.5e-12 M -11.022 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       31301466 10.1016/j.ijpharm.2019.118511 K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4 elsevier_step2c
623 Malate Synthase protein Q8N0X4 MS10-Trunc GGTGGTGGTGG 19.0 pM -10.721 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         abstract       31704587 10.1016/j.omtn.2019.09.026 MS10-Trunc aptamer exhibited high af fi nity for MS (equilibrium dissociation constant [KD] 19 pM) elsevier_step2c
140 PDGF-C protein P01127 α-PC CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC 20.0 pM -10.699 intrinsic KD Gold v4 extraction_verified verified_in_text_or_SI original   SPR   7.4 HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4)   DNA PEG 42138517 10.1167/iovs.67.5.36 SPR analysis demonstrated that the α -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM step2c_literal_v3
669 bevacizumab protein P31995 A14#1 GCGGTTGGTGGTAGTTACGTTCGC 44.0 pM -10.357 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         abstract       35114463 10.1016/j.bios.2022.114027 affinity of A14#1 to bevacizumab markedly increased at pH 4.7 ( K D = 44 pM) elsevier_step2c
9 sLe X -BSA glycan/conjugate Q9NSU2 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 5.7e-11 M -10.244 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR 298.15 7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11 step2c_literal_v3
3 sLe X -BSA glycan/conjugate Q9NSU2 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 8.5e-11 M -10.071 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR 298.15 7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11 step2c_literal_v3
547 ofloxacin protein Q9H015 Q2 ATACCAGCTTATTCAATTGCAGGGTATCTGAGGCTTGATCTACTAAATGTCGTGGGGCATTGCTATTGGCGTTGATACGTACAATCGTAATCAGTTAG 0.11 nM -9.959 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       26547431 10.1016/j.bios.2015.10.069 Their K D values were calculated at K D 1⁄4 0.11 nM ( 7 0.06) for aptamer Q2 elsevier_step2c
245 MPO protein P05164 MPO-16 GTCTGGAAACGACGAGGGCCACTGATTAACGTAGTTAATTGGTCTTGTCG 166.0 pM -9.78 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO16 revealed the highest binding affinity ( K d = 166 pM) step2c_literal_v3
548 ofloxacin protein Q9H015 Q8 ATACCAGCTTATTCAATTAGTTGTGTATTGAGGTTTGATCTAGGCATAGTCAACAGAGCACGATCGATCTGGCTTGTTCTACAATCGTAATCAGTTAG 0.2 nM -9.699 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       26547431 10.1016/j.bios.2015.10.069 K D 1⁄4 0.20 nM ( 7 0.09) for aptamer Q8 elsevier_step2c
558 OH-BDE47 protein   BDE-A-8 GACAGCCGGGGCATCAGAGCAGCCGATTGTCTGTTGTGCC 0.2 nM -9.699 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       27566357 10.1016/j.aca.2016.06.040 The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition. elsevier_step2c
234 MPO protein P05164 MPO-02 TATGCGATTTCAAAAATGTTACGATGGATATTGACATTTAAATATGTCGG 227.0 pM -9.644 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-02 ... 227 step2c_literal_v3
639 thrombin protein P00734 29-mer thrombin-specific aptamer AGTCCGTGGTAGGGCAGGTTGGGGTGACT 298.0 pM -9.526 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       32570818 10.3390/s20123442 The n-curve analysis provided a Kd of 298 pM ( + 111 / 81 pM) elsevier_step2c
660 20 Methyl Spirolide G protein   SPX 7 GGCGGTGTGGGTACCACGAGGTTTGGACGCGCGTAGCACCCCATTCAGC 3e-10 M -9.523 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       34144421 10.1016/j.foodchem.2021.130332 The present study, among the aptamers selected, the aptamer with highest affinity had a dissociation constant of 0.3 nM for SPX G elsevier_step2c
554 chimeric-tPA protein   Chi-tPA 1 TTCCAACGGTTGGTGGGTGGTT 0.32 nM -9.495 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         abstract       26876003 10.1016/j.pep.2016.02.004 selected aptamer having KD values of 0.320 nM elsevier_step2c
173 human α-thrombin protein P00734 Apt29 AGTCCGTGGTAGGGCAGGTTGGGGTGACT 0.5 nM -9.301 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original             DNA   28763192 10.1021/acs.analchem.7b02313 a 29nucleotide aptamer (5 ′ -AGT CCG TGG TAG GGC AGG TTG GGG TGA CT-3 ′ , denoted as Apt29 here) binds to the heparin-binding site of human α -thrombin with a dissociation constant ( K d) around 0.5 nM. step2c_literal_v3
530 AGEs-HSA protein   #9s TCTGCCACCCTCCGACTAACATATCCGGCCTGAGACCA 0.57 nM -9.244 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI backfill_text_verified         abstract       24012635 10.1016/j.mvr.2013.08.010 Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively. elsevier_step2c
175 human α-thrombin protein P00734 5'-TMR-Apt15-T24 GGTTGGTGTGGTTGG 0.6 nM -9.222 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   CE-LIF 298.15 7.5 sample bu ff er containing 10 mM Tris-HCl (pH 7.5) and 5 mM KCl   DNA TMR label at 5'-end; polyT tail (24 T) at 3'-end 28763192 10.1021/acs.analchem.7b02313 0.6 nM for 5 ′ -TMR-Apt15-T24 step2c_literal_v3
176 human α-thrombin protein P00734 5'-TMR-Apt15-T25 GGTTGGTGTGGTTGG 0.6 nM -9.222 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   CE-LIF 298.15 7.5 sample bu ff er containing 10 mM Tris-HCl (pH 7.5) and 5 mM KCl   DNA TMR label at 5'-end; polyT tail (25 T) at 3'-end 28763192 10.1021/acs.analchem.7b02313 0.6 nM for 5 ′ -TMR-Apt15-T25 step2c_literal_v3
529 AGEs-HSA protein   #4s CAGAATCGGGGACCACGACACTGCACATACCTCGTACGAA 0.63 nM -9.201 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI backfill_text_verified         abstract       24012635 10.1016/j.mvr.2013.08.010 Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively. elsevier_step2c
154 thrombin protein P00734 HD1-22 GGTTGGTGTGGTTGGAAAAAAAAAAAAGTCCGTGGTAGGGCAGGTTGGGGTGACT 6.5e-10 M -9.187 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR         DNA bivalent fusion; poly-dA linker 18826387 10.1111/j.1538-7836.2008.03162.x HD1-22 | Thrombin | K D ( M) | 6.5 · 10 ) 10 step2c_literal_v3
177 human α-thrombin protein P00734 5'-TMR-Apt15-T30 GGTTGGTGTGGTTGG 0.7 nM -9.155 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   CE-LIF 298.15 7.5 sample bu ff er containing 10 mM Tris-HCl (pH 7.5) and 5 mM KCl   DNA TMR label at 5'-end; polyT tail (30 T) at 3'-end 28763192 10.1021/acs.analchem.7b02313 0.7 nM for 5 ′ -TMR-Apt15-T30 step2c_literal_v3
178 human α-thrombin protein P00734 5'-TMR-Apt15-T35 GGTTGGTGTGGTTGG 0.7 nM -9.155 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   CE-LIF 298.15 7.5 sample bu ff er containing 10 mM Tris-HCl (pH 7.5) and 5 mM KCl   DNA TMR label at 5'-end; polyT tail (35 T) at 3'-end 28763192 10.1021/acs.analchem.7b02313 0.7 nM for 5 ′ -TMR-Apt15-T35 step2c_literal_v3
634 Immunoglobulin E protein Q96D42 IgE37-T10-FAM GGGGCACGTTTATCCGTCCCTAGTGGCGTGCCCC 0.8 nM -9.097 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         abstract       32498825 10.1016/j.talanta.2020.121018 The FA assay using T10-labeled aptamer with a dissociation constant ( K d) about 0.8 nM elsevier_step2c
33 Tasset - thrombin complex protein   Bock GGTTGGTGTGGTTGG 0.87 nM -9.06 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   BSI 283.15 7.5 50 mM TRIS buffer (pH 7.5) containing 100 mM NaCl and 1 mM MgCl2 1.0 DNA   22032342 10.1021/ac202823m Bock - [Tasset complex] | not available | 0.87 ( 0.18 nM step2c_literal_v3
241 MPO protein P05164 MPO-14 ATATAGTACAGTGAGTAGTTGTACCACATTGTAGGTACTTAGTTGGAATG 897.0 pM -9.047 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-14 ... K d : 897 pM step2c_literal_v3
235 MPO protein P05164 MPO-03 TTCTTTGTACTACGTATGTGTTACACATCTTAAGTCCGTTTTGATGCAGC 912.0 pM -9.04 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-03 ... 912 step2c_literal_v3
38 alpha-thrombin protein P05154 RNAR9D-14T GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC 1.0 nM -9.0 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding 310.15 7.4 Hepes-saline buffer with 0.01% BSA   2'F-RNA 2' Fluorocytosine; 2' Fluorouracil 22385910 10.1111/j.1538-7836.2012.04679.x Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) and α-thrombin (apparent Kd =1 nM) step2c_literal_v3
233 MPO protein P05164 MPO-01 CACTCGTGAAGATCTTTAATAGATAGAATAATCGAGGTTGATTCGATGTA 1148.0 pM -8.94 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-01 ... 1,148 step2c_literal_v3
39 prothrombin protein P00734 RNAR9D-14T GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC 1.4 nM -8.854 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.15 7.4 Hepes-saline buffer   2'F-RNA 2' Fluorocytosine; 2' Fluorouracil 22385910 10.1111/j.1538-7836.2012.04679.x Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM step2c_literal_v3
559 OH-BDE47 protein   BDE-A-12 ATTGCACGTCTCCGCCGCTTGGGTGGAGAGGCTATTCGGC 1.53 nM -8.815 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       27566357 10.1016/j.aca.2016.06.040 The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition. elsevier_step2c
41 hOX40 protein   9C7 GGGAGGACGATGCGGAAAAAAGAACACUUCCGAUUAGGGCCCACCCUAACGGCCGCAGACGACTCGCCCGA 1.7 nM -8.77 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   filter_binding 310.15 7.5 selection buffer F (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2, and 0.01% BSA)   2'F-RNA   23113766 10.1089/nat.2012.0388 9C7 | 11 | 1.7 step2c_literal_v3
35 Bock - thrombin complex protein Q86YV9 Tasset CAGTCCGTGGTAGGGCAGGTTGGGGTGACTTCGTGGAA 1.9 nM -8.721 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   BSI 283.15 7.5 50 mM TRIS buffer (pH 7.5) containing 100 mM NaCl and 1 mM MgCl2 1.0 DNA   22032342 10.1021/ac202823m Tasset - [Bock complex] | not available | 1.9 ( 0.2 nM step2c_literal_v3
204 VWF A1 domain protein P04275 ARC1779 GGCGUGCAGUGCCUUCGGCCGTGCGGTGCCUCCGUCACGCT 2.0 nM -8.699 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original             DNA PEG20K; 2'-O-methyl-substituted nucleotides; inverted deoxythymidine cap 31315441 10.1161/ATVBAHA.119.312439 ARC1779 has a high binding affinity to VWF A1 domain (K D ≈ 2 nM) step2c_literal_v3
649 THY1 protein P04216 XA-B217 CAGGGGACGCACCAAGGTTGCCCACCGACGTGCAGGCGAACTACAGGCACGCGGCCATGACCCGCGTGCTG 2.0 nM -8.699 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       33242496 10.1016/j.biochi.2020.11.018 The equilibrium dissociation constants, Kd, were derived from these curves and are determined as ... XA-B217=2 nM elsevier_step2c
565 Progesterone protein P06401 PG13T2 GATTAACATTAGCCCACCGCCCACC 2.1 nM -8.678 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       28237255 10.1016/j.ab.2017.02.014 The dissociation constant of the PG13T2-P4 complex calculated using non-linear regression fi tting of the obtained curve was found to be 2.1 nM. elsevier_step2c
727 IL-23 protein P26951 A23P15 GGTCACTTCCAACGCTTA 2.139 nM -8.67 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI backfill_text_verified         text       38810331 10.1016/j.jpba.2024.116245 the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively elsevier_step2c
508 alpha-fetoprotein protein P02771 AFP-specific ssDNA aptamer GGCAGGAAGACAAACAAGCTTGGCGGCGGGAAGGTGTTTAAATTCCCGGGTCTGCGTGGTCTGTGGTGCTGT 2.37 nM -8.625 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       22410487 10.1016/j.bios.2012.02.024 The K d of the AFP-specific ssDNA was calculated to be 2.37 nM elsevier_step2c
30 thrombin protein P00734 HD22 AGTCCGTGGTAGGGCAGGTTGGGGTGACT 2.4e-09 M -8.62 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR         DNA   18826387 10.1111/j.1538-7836.2008.03162.x HD22 | Thrombin | K D ( M) | 2.4 · 10 ) 9 step2c_literal_v3
237 MPO protein P05164 MPO-05 GCATATCAAGCAGAATGTTTTGTCTCTATTTTCTCATATGTTTATGCGTA 2584.0 pM -8.588 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-05 ... 2,584 step2c_literal_v3
251 Human thrombin protein P00734 Pse08-29 TGACCTCTAGTGACTGATTTACGAGTC 2.6 nM -8.585 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Pse(08 - 29) | 1.33 10^6 | 3.47 10^-3 | 2.6 step2c_literal_v3
537 Prostate Specific Antigen protein P07288 Apta TTTAAATAGCATTAAAGCTCGCCATCAAATAGC 2.6 nM -8.585 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         abstract       25569871 10.1016/j.bios.2014.12.033 The change in current is used to determine the PSA -aptamer dissociation constant KD , of ca. 2.6 nM. elsevier_step2c
712 Neuron specific enolase protein P09104 P-5C8G TCACACAGGGAGCTCTCCTACATTAATAACGCATTGCGTT 2.76 nM -8.559 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         abstract       38091739 10.1016/j.talanta.2023.125535 The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively. elsevier_step2c
16 thrombin protein P00734 TBA GGTTGGTGTGGTTGG 2.86e-09 M -8.544 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR         DNA biotin at 3' end; six-carbon spacer 16053288 10.1021/ac0502450 thrombin | 2.2 10 5 | 6.3 10 - 4 | 3.4 10 8 | 2.86 10 - 9 step2c_literal_v3
726 IL-23 protein P26951 A23P6 GGTCTACGTCGAATCGTATA 2.88 nM -8.541 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI backfill_text_verified         text       38810331 10.1016/j.jpba.2024.116245 the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively elsevier_step2c
65 hCD4 protein P01730 U26 CGATGTCGACGTGCAGCTTCCTTGAGCCTTACTGAAAATACTACCCAGTCC 2.93 nM -8.533 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   qPCR 298.15 7.4 1× PBS pH 7.4   DNA biotin 32567629 10.1039/d0an00634c U26 exhibited the highest binding affinity ( K d = 2.93 ± 1.03 nM) to hCD4-conjugated beads. step2c_literal_v3
242 MPO protein P05164 MPO-18 TAAGTAATGTGACTGTGTAATTTTTGCTGTCTATAATGCGGATACTGGGT 3192.0 pM -8.496 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-18 ... K d : 3,192 pM step2c_literal_v3

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options:

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';
Powered by Datasette · Queries took 43.987ms · Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target