home / scout

Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

113 rows where sequence_status = "verified_in_text_or_SI" and verification_level = "multi_agent_verified" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: source_origin, seq_source, assay_temperature_k, assay_ph, assay_buffer, aptamer_chemistry, aptamer_modifications

assay_method 13

  • fluorescence 13
  • SPR 8
  • affinity_real_time_qPCR 8
  • flow_cytometry 8
  • MST 6
  • BLI 3
  • PISA 3
  • ITC 2
  • QCM 2
  • ALISA 1
  • ELAA 1
  • NECEEM 1
  • saturation_binding 1

measurement_class 4

  • intrinsic 94
  • apparent_cellular 12
  • avidity_multivalent 6
  • non_intrinsic 1

verification_level 1

  • multi_agent_verified · 113 ✖

tier 1

  • Gold 113

target_type 1

  • protein 113

sequence_status 1

  • verified_in_text_or_SI · 113 ✖

binding_constant_type 1

  • Kd 113
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
319 VEGF165 protein P15692 3R02 Bivalent TGTGGGGGTGGACTGGGTGGGTACCTTTTTTTTTTTGTGGGGGTGGACTGGGTGGGTACC 3e-11 M -10.523 avidity_multivalent Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 23237717 10.1021/ac303023d The K d value of 30 pM for 3R02 Bivalent was calculated by measuring SPR. step2c_acs_v1
312 thrombin protein P00734 MP-TBA15/TBA29-T15 GGTTGGTGTGGTTGG 5.2e-11 M -10.284 avidity_multivalent Kd Gold v4 multi_agent_verified verified_in_text_or_SI backfill_text_verified   saturation_binding   7.4 physiological buffer (25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 5.0 mM KCl, 1.0 mM MgCl2, 1.0 mM CaCl2) containing BSA (100 μM)   DNA thiolated; 15-mer thymidine linker 22300379 10.1021/la204651t MP-TBA15/TBA29-T15 -Au NPs provided high flexibility and an appropriate orientation and distance between TBA and TBA units for bivalent binding, allowing stronger interactions with thrombin ( K d = 5.2 × 10 -11 M; Supporting Information, Figure S3) step2c_acs_v1
331 MutS protein O15457 2-06 ACTTCTGCCCGCCTCCTTCCTGGTAAAGTCATTAATAGGTGTGGGGTGCCGGGCATTTCGGAGACGAGATAGGCGGACACT 1.23e-10 M -9.91 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 25668425 10.1021/acs.analchem.5b00171 The best fi t was obtained at K d = 123 pM and [T]0 = 213 pM step2c_acs_v1
363 HBcAg protein   A-9 AGCAGCACAGAGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCTACCGTGAA 2.0000000000000003e-10 M -9.699 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   affinity_real_time_qPCR         DNA   32250595 10.1021/acs.analchem.9b05740 This aptamer showed strong binding to HBcAg ( K d : 0.2 nM) step2c_acs_v1
318 VEGF165 protein P15692 3R02 TGTGGGGGTGGACTGGGTGGGTACC 3e-10 M -9.523 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 23237717 10.1021/ac303023d The K d value for 3R02 was 300 pM step2c_acs_v1
358 HBeAg protein   EAg3-Py TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGAGATGTTTGGTTTT 4.0000000000000007e-10 M -9.398 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   affinity_real_time_qPCR   7.4 1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)   DNA pyrrolo-dC 32250595 10.1021/acs.analchem.9b05740 The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3 step2c_acs_v1
415 BDNF protein P23560 NV_B12 GGATTTGAGCTTATGTGGCATAGGTTGCCTGGGTGGGTGGGGTCGGGGAA 5e-10 M -9.301 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   ALISA     1 × selection buffer   DNA biotin 38149631 10.1021/acschemneuro.3c00661 The equilibrium dissociation constant ( K d) for the NV_B12/BDNF interaction was obtained by fitting the equation, Y = B max × X /( K d + X )... The K d value determined to be 0.5 nM (95% CI: 0.4 -0.6 nM) step2c_acs_v1
343 PlanarAu protein   1N TATGCATGTGTAGTAAGACCTAGTCCACAATCAACG 5.600000000000001e-10 M -9.252 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   QCM     AIB   DNA   30189130 10.1021/acscombsci.8b00048 aptamer 1N showing the highest affinity (0.56 nM) step2c_acs_v1
332 MutS protein O15457 2-06 ACTTCTGCCCGCCTCCTTCCTGGTAAAGTCATTAATAGGTGTGGGGTGCCGGGCATTTCGGAGACGAGATAGGCGGACACT 6.5e-10 M -9.187 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 25668425 10.1021/acs.analchem.5b00171 The experimental points from the second step resulted in the best fi t with the theoretical dependence of R versus [L] 0 at K d = 650 pM step2c_acs_v1
398 neomycin protein Q96LI5 Aptamer A GGACUGGGCGAGAAGUUUAGUCC 1e-09 M -9.0 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 36453647 10.1021/acschembio.2c00653 The binding affinity of neomycin to Aptamer A shows a strong K d of 1 nM with an enthalpy and entropy value of -100 kJ/mol & -163.1 J/mol. K step2c_acs_v1
432 Sc3+ protein Q96PL5 Sc-1 CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC 1e-09 M -9.0 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence     SELEX buffer   DNA   39743479 10.1021/jacs.4c13768 true K d for the binding of Sc-1 to Sc 3+ to be 1.0 nM step2c_acs_v1
372 beta-conglutin protein   11-mer GGTGGGGGTGG 1.05e-09 M -8.979 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   MST 298.15   binding buffer with 0.05% v/v Tween-20   DNA   33498970 10.3390/ijms22031150 KD values determined (Figure 6b) are very similar (11-mer: 1.05 nM step2c_acs_v1
340 AP65 protein Q13882 AP65_A1 AGCTCCAGAAGATAAATTACAGGTGAGGGCGGGCGGGTGGTTGTAATATGATCGAATGGTATATGTGTGTTTGCAACTAGGATACTATGACCCCG 1.057e-09 M -8.976 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   ELAA 298.15 6.4 binding buffer (10 mM phosphate, 138 mM NaCl, 2.7 mM KCl, 1.5 mM MgCl2 at pH 6.4)   DNA 5'-biotinylated 29972299 10.1021/acsinfecdis.8b00065 A K D value of 1.057 nM was obtained using the sigmoidal dose-response curve model step2c_acs_v1
356 HBeAg protein   A-9S ACTTTTTTGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCT 1.2e-09 M -8.921 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   affinity_real_time_qPCR   7.4 1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)   DNA /5AmMC6/ 32250595 10.1021/acs.analchem.9b05740 The measured dissociation constant ( K d) is improved by 19 times  from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer. step2c_acs_v1
433 PvTRAg protein   Apt_16 TTAATAACATGAGTTATTGAATTATTGTTTATTTTTTTTTTTTTG 1.2e-09 M -8.921 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original             DNA   40042916 10.1021/acsinfecdis.4c01047 The K D of Apt_14 and Apt_16 was found to be comparable, 1.9 and 1.2 nM, respectively step2c_acs_v1
350 alkaline phosphatase protein P09923 ALP binding aptamer CTTCTGCCCGCCTCCTTCCTGGAGGACTGTGGAGGACTTAGCGCCCATCCTTGCCCATGGAGACGAGATAGGCGGACACTC 1.49e-09 M -8.827 avidity_multivalent Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   PISA   9.5 50 mM glycine-NaOH buffer (pH 9.5)   DNA 3'-thiol 30827094 10.1021/acs.analchem.9b00465 Similarly, from the response -dose curve (Figure 3B), the K d value for the aptamer -MIP hybrid-coated array was estimated to be 1.49 × 10 -9 M step2c_acs_v1
742 alkaline phosphatase protein P09923 ALP binding aptamer CTTCTGCCCGCCTCCTTCCTGGAGGACTGTGGAGGACTTAGCGCCCATCCTTGCCCATGGAGACGAGATAGGCGGACACTC 1.5000000000000002e-09 M -8.824 avidity_multivalent Kd Gold ACS multi_agent_verified verified_in_text_or_SI original   PISA         DNA 3'-thiol 30827094 10.1021/acs.analchem.9b00465 giving cross-reactivity of 3.2 -5.6% and a dissociation constant of 1.5 nM step2c_acs_v1
394 IgE protein P0DOX4 S2 GACTACCCGGGTATCTAATCCGACCATTTTTCGTCTCCTTTGTACGAGCAGTGTGCTCGACCTGCCGCCCGTAGG 1.5500000000000002e-09 M -8.81 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   NECEEM   9.0 10 mM Tris-HCl buffer (pH 9.0)   DNA FITC 36144553 10.3390/molecules27185818 Based on the results of these experiments, the K D values of S1 and S2 were estimated to be 0.83 and 1.55 nM, respectively step2c_acs_v1
359 HBeAg protein   EAg3 TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGAGATGTTTGGTTTT 1.7000000000000001e-09 M -8.77 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   affinity_real_time_qPCR   7.4 1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)   DNA   32250595 10.1021/acs.analchem.9b05740 The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3, as compared to the K d value of 1.7 nM with the unmodi fi ed EAg3 aptamer. step2c_acs_v1
374 beta-conglutin protein   TT-11-mer TTGGTGGGGGTGG 1.88e-09 M -8.726 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   MST 298.15   binding buffer with 0.05% v/v Tween-20   DNA   33498970 10.3390/ijms22031150 KD values determined (Figure 6b) are very similar (... TT-11 mer: 1.88 nM step2c_acs_v1
376 beta-conglutin protein   11-mer-TT GGTGGGGGTGGTT 2.59e-09 M -8.587 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   MST 298.15   binding buffer with 0.05% v/v Tween-20   DNA   33498970 10.3390/ijms22031150 KD values determined (Figure 6b) are very similar (... and 11-mer-TT: 2.59 nM) step2c_acs_v1
375 beta-conglutin protein   TT-11-mer-TT TTGGTGGGGGTGGTT 2.71e-09 M -8.567 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   MST 298.15   binding buffer with 0.05% v/v Tween-20   DNA   33498970 10.3390/ijms22031150 KD values determined (Figure 6b) are very similar (... TT-11-mer-TT: 2.71 nM step2c_acs_v1
367 SARS-CoV-2 RBD protein   CoV2-RBD-1 CAGCACCGACCTTGTGCTTTGGGAGTGCTGGTCCAAGGGCGTTAATGGACA 3.1000000000000005e-09 M -8.509 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     PBS with 0.55 mM MgCl2   DNA   32551560 10.1021/acs.analchem.0c01394 the dissociation constant values ( K d) of the CoV2-RBD-1 aptamer ... were 3.1 nM step2c_acs_v1
410 melamine protein   Apt M TTCCTTTTCTCTCC 4.4000000000000005e-09 M -8.357 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI backfill_text_verified             DNA abasic site 37343019 10.1021/acs.analchem.2c05777 dissociation constant K d = 4.4 nM step2c_acs_v1
320 VEGF165 protein P15692 VEap121 TGTGGGGGTGGACGGGCCGGGTAGA 4.700000000000001e-09 M -8.328 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   SPR 293.15 7.4 Tris-buffered saline (TBS: 10 mM Tris-HCl, 100 mM NaCl, 5 mM KCl, pH 7.4)   DNA   23237717 10.1021/ac303023d As the calculated K d value of VEap121 was 4.7 nM step2c_acs_v1
327 Myoglobin protein P02144 Myo40-7-27 CCCTCCTTTCCTTCGACTAGATCTGCTGCGTTGTTCCGA 4.93e-09 M -8.307 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original             DNA   24914856 10.1021/ac501088q The aptamer with the highest a ffi nity ( K d = 4.93 nM) was then used for the fabrication of a label-free supersandwich electrochemical biosensor for Myo detection step2c_acs_v1
455 biliverdin protein P53004 Bvd4 GACGACGGGTGTGGAACAGTGCGAATACTTTCGAGTCGTC 6.000000000000001e-09 M -8.222 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 40669049 10.1021/acschembio.5c00438 For the biliverdin selection, the tightest affinity aptamer has a dissociation costant ( K d ) value of 6 nM determined using isothermal titration calorimetry (ITC) step2c_acs_v1
313 Salmonella enteritidis protein P29460 SENT-9 CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTTACAGAGGT 7.000000000000001e-09 M -8.155 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 22971146 10.1021/ac302217u It was observed that the aptamer pool collected at the seventh round of selection had the highest binding a ffi nity to the bacteria ( K D = 7 nM). step2c_acs_v1
445 Cu2+ protein Q6UVY6 Co-1 GACGACGGAACGGAGGTTCTTAGGTCGGTAGACCGAGTCGTC 8e-09 M -8.097 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 40656531 10.1039/d5sc02436f The corresponding true K d values were ... 8 nM for Cu 2+ step2c_acs_v1
309 Streptococcus pyogenes M-type mixture protein   20A24P AAGCAGCACAGAGGTCAGATGGGGGGAAGACACAGAGAAAGGCCGGGGTGAAGTGTAGAGGCCTATGCGTGCTACCGTGAA 9.000000000000001e-09 M -8.046 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   flow_cytometry   7.4 binding buffer (1-BB; 50 mM Tris-HCl(pH7.4), 5 mM KCl, 100 mM NaCl, 1 mM MgCl2)   DNA 5'-FAM 21504182 10.1021/ac200575e Two aptamers, 20A24P and 15A3P (with estimated binding dissociation constants of 9 and 10 nM, respectively) step2c_acs_v1
362 HBeAg protein   EAg2 TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGTGTAGATTGGAAAA 9.2e-09 M -8.036 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   affinity_real_time_qPCR   7.4 1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)   DNA   32250595 10.1021/acs.analchem.9b05740 A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1, 9.2 nM for EAg2 step2c_acs_v1
361 HBeAg protein   EAg1 TTTTTTTTGGGCGAAGACCGGGACGGGAGGAAAGTGTAGATTGGTTTT 9.5e-09 M -8.022 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   affinity_real_time_qPCR   7.4 1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)   DNA   32250595 10.1021/acs.analchem.9b05740 A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1 step2c_acs_v1
310 Streptococcus pyogenes M-type mixture protein   15A3P ATTCACGGTAGCACGCATAGGGACAGCAAGCCCAAGCTGGGTGTGCAAGGTGAGGAGTGGG 1e-08 M -8.0 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   flow_cytometry   7.4 binding buffer (1-BB; 50 mM Tris-HCl(pH7.4), 5 mM KCl, 100 mM NaCl, 1 mM MgCl2)   DNA 5'-FAM 21504182 10.1021/ac200575e Two aptamers, 20A24P and 15A3P (with estimated binding dissociation constants of 9 and 10 nM, respectively) step2c_acs_v1
431 Sc3+ protein Q96PL5 Sc-1 CTCTCGACGACGGACCATTCCCGTGGAATGACTACGTATATGTCGTC 1.0300000000000001e-08 M -7.987 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence     SELEX buffer   DNA   39743479 10.1021/jacs.4c13768 an apparent K d value of 10.3 nM was obtained step2c_acs_v1
427 U87MG GBM with IDH1 htz mutation protein   Gli-55 GTCCGGTTCAACCTCTAGCATTCCTGGCGTTATTAACGGAGCAGTCCTGTGGAGTGGGTGA 1.22e-08 M -7.914 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   flow_cytometry 298.15   DPBS   DNA Cy5 39682297 10.3390/cancers16234111 The apparent dissociation constant measured for U87MG GBM with the IDH1 htz mutation ( Kd ) of Gli-55 is 12.2 nM step2c_acs_v1
344 PlanarAu protein   1N truncated TATGCATGTGTATATCAACACTCCGGGTCTAATCGTTCA 1.304e-08 M -7.885 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   QCM     AIB   DNA   30189130 10.1021/acscombsci.8b00048 1N truncated (Kd = 13.04 nM) step2c_acs_v1
368 SARS-CoV-2 RBD protein   CoV2-RBD-4 ATCCAGAGTGACGCAGCATTTCATCGGGTCCAAAAGGGGCTGCTCGGGATTGCGGATATGGACACGT 1.3600000000000001e-08 M -7.866 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     PBS with 0.55 mM MgCl2   DNA   32551560 10.1021/acs.analchem.0c01394 the dissociation constant values ( K d) of the ... CoV2-RBD-4 aptamer ... were ... 13.6 nM step2c_acs_v1
428 U87MG GBM with IDH1 htz mutation protein   Gli-35 GCGTTATTAACGGAGCAGTCCTGTGGAGTGGGTGA 1.3600000000000001e-08 M -7.866 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   flow_cytometry 298.15   DPBS   DNA Cy5 39682297 10.3390/cancers16234111 while for Gli-35, it is 13.6 nM. step2c_acs_v1
476 Escherichia coli O157:H7 protein   E. coli O157:H7-specific aptamer CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG 1.4400000000000002e-08 M -7.842 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence 298.15   15% (v/v) PEG200   DNA FAM 41850902 10.1021/acs.analchem.5c07364 the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM). step2c_acs_v1
411 thrombin protein P00734 TBA15-AnBtz GGTTGGTGTGGTTGGTATATT 1.5000000000000002e-08 M -7.824 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 37857354 10.1021/acs.bioconjchem.3c00373 apparent dissociation constant ( K d ) of 15 nM step2c_acs_v1
330 Progesterone protein P06401 P4G13 GCATCACACACCGATACTCACCCGCCTGATTAACATTAGCCCACCGCCCACCCCCGCTGC 1.7e-08 M -7.77 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 25486123 10.1021/ac503639s The dissociation constant of the best aptamer, designated as P4G13, was estimated to be 17 nM by electrochemical impedance spectroscopy (EIS) as well as fl uorometric assay. step2c_acs_v1
421 hnRNP A1 protein P09651 AS1411 GGTGGTGGTGGTTGTGGTGGTGGTGG 1.75e-08 M -7.757 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   BLI   7.4 BLI buffer (20 mM phosphate buffer, 8 mM KCl, 137 mM NaCl, 0.05% surfactant P20)   DNA   38784467 10.1039/d3md00752a for AS1411, the K d value was 17.5 nM (Fig. 6B) step2c_acs_v1
475 Escherichia coli O157:H7 protein   E. coli O157:H7-specific aptamer CCGGACGCTTATGCCTTGCCATCTACAGAGCAGGTGTGACGG 1.92e-08 M -7.717 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   fluorescence 298.15   liquid milk-based matrices (0% lactalbumin/lactose/casein)   DNA FAM 41850902 10.1021/acs.analchem.5c07364 the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM). step2c_acs_v1
441 xanthylacrylamide protein   XAA-1 GACGACGTAGGTGTGGATGGCTTTGAAAAAGGGCTAGTCGTC 2e-08 M -7.699 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 40261307 10.1021/acs.analchem.5c00783 The true K d of aptamer XAA-1 was calculated to be 20 nM after accounting for the competitive effect of the quencher-labeled strand step2c_acs_v1
422 hnRNP A1 protein P09651 TBA GGTTGGTGTGGTTGG 2.1100000000000004e-08 M -7.676 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   BLI   7.4 BLI buffer (20 mM phosphate buffer, 8 mM KCl, 137 mM NaCl, 0.05% surfactant P20)   DNA   38784467 10.1039/d3md00752a for TBA, the K d value was 21.1 nM (Fig. 6A) step2c_acs_v1
357 HBeAg protein   A-9 AGCAGCACAGAGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCTACCGTGAA 2.29e-08 M -7.64 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   affinity_real_time_qPCR   7.4 1 × BB (50 mM Tris-HCl (pH 7.4), 5 mM KCl, 50 mM NaCl, 7 mM MgCl2, and 0.05% Tween 20)   DNA   32250595 10.1021/acs.analchem.9b05740 The measured dissociation constant ( K d) is improved by 19 times  from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer. step2c_acs_v1
373 beta-conglutin protein   11-mer GGTGGGGGTGG 2.3300000000000003e-08 M -7.633 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   BLI 303.15 7.4 PBS, 1.5 mM MgCl2, pH 7.4, 0.1% Tween-20   DNA   33498970 10.3390/ijms22031150 A 2:1 heterogenous model was used to fit the data and calculate the binding affinities resulting in two different KD values of 6.95 and 23.30 nM. step2c_acs_v1
485 melamine protein   Mel36-1 GGAGTTCGTAGAGGTGTCCTAAGTCTTTAGGTTGGA 2.4000000000000003e-08 M -7.62 non_intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI backfill_text_verified     298.15           42261635 10.1021/acs.analchem.6c01553 Mel36-1 has the most sensitive response with an apparent K d of 24 nM step2c_acs_v1
317 Salmonella typhimurium protein Q8IWE5 STYP-3 GAGTTAATCAATACAAGGCGGGAACATCCTTGGCGGTGC 2.5000000000000002e-08 M -7.602 apparent_cellular Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 23075417 10.1021/ac302902s It was observed that the aptamer pool collected at the seventh round of selection had the highest binding a ffi nity to the bacteria ( K D = 25 nM). step2c_acs_v1
416 Sterigmatocystin protein   H Seq02 GAATACGGATTACTGTTCGTACTGACCTATGCTGTGGAGT 2.53e-08 M -7.597 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   ITC         DNA amino-modified 38175632 10.1021/acs.analchem.3c03675 The final fitting curve showed a reduced chi-squared (kcal/mol) 2 of 0.871, and the K D value was 25.3 nM. step2c_acs_v1

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options:

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';
Powered by Datasette · Queries took 514.459ms · Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target