home / scout

Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

715 rows where target_type = "protein" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: source_origin, seq_source, pi_provenance_flag, assay_temperature_k, assay_ph, assay_cations, aptamer_chemistry, source_db

assay_method 27

  • flow_cytometry 94
  • SPR 67
  • fluorescence 44
  • MST 29
  • filter_binding 28
  • BLI 27
  • ITC 12
  • ELISA 11
  • CE-LIF 10
  • affinity_real_time_qPCR 8
  • QCM 7
  • BSI 4
  • dot_blot 4
  • PISA 3
  • ELONA 2
  • EMSA 2
  • FACS 2
  • mass_spectrometry 2
  • microcantilever 2
  • microscale thermophoresis 2
  • ALISA 1
  • DPV 1
  • ELAA 1
  • NECEEM 1
  • qPCR 1
  • qRT-PCR 1
  • saturation_binding 1

sequence_status 5

  • verified_in_text_or_SI 430
  • pending_manual_supp 201
  • pending_manual_figure 40
  • pending_supp_oa 40
  • no_single_sequence_pool 4

measurement_class 4

  • intrinsic 543
  • non_intrinsic 140
  • apparent_cellular 16
  • avidity_multivalent 16

verification_level 2

  • extraction_verified 534
  • multi_agent_verified 181

binding_constant_type 2

  • Kd 712
  • KD 3

tier 1

  • Gold 715

target_type 1

  • protein · 715 ✖
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
188 PDGF-BB protein P01127 36aApt   0.036 pM -13.444 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ELISA 298.0       DNA   28825469 10.1021/acscombsci.6b00163 36aApt | 0.036 ± 0.012 | - 18.33 step2c_literal_v3
186 PDGF-BB protein P01127 38aApt   0.094 pM -13.027 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ELISA 298.0       DNA   28825469 10.1021/acscombsci.6b00163 38aApt | 0.094 ± 0.008 | - 17.76 step2c_literal_v3
44 IL-8 protein P10145 8A-35 GGGGGCUUAUCAUUCCAUUUAGUGUUAUGAUAACC 1.72e-12 M -11.764 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   SPR 298.0 7.4 HBST running buffer (10 mM HEPES, pH 7.4, 150 mM NaCl, and 0.005% Tween 20)   2'F-RNA 2'-fluoro-pyrimidine modified 24129312 10.1016/j.biomaterials.2013.09.107 | 8A-35 | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80 | 3.11 x 10 1 | step2c_literal_v3
598 human α-Thrombin protein P00734 A1   2.0 pM -11.699 intrinsic Kd Gold elsevier extraction_verified pending_manual_supp           text       31129134 10.1016/j.ab.2019.05.012 Also for aptamer A1 we measured with MST KD values in the pico- and nanomolar range (2 pM and 52 nM). The lowest KD value is determined with MST (shown as bar) for aptamer A1, which is 2 pM. elsevier_step2c
406 SARS-CoV-2 spike protein (wild type) protein   DSA1N5   3e-12 M -11.523 avidity_multivalent Kd Gold v4 multi_agent_verified pending_manual_supp     dot_blot     undiluted wastewater   DNA dimeric 36926840 10.1021/acssensors.2c02655 DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B). step2c_acs_v1
621 nucleolin protein P19338 Cy5-AT11-B0 TGGTGGTGGTTGGTGGTGGTGGTGGT 3.3e-12 M -11.481 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       31301466 10.1016/j.ijpharm.2019.118511 yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8 elsevier_step2c
743 SARS-CoV-2 spike protein (wild type) protein   DSA1N5   3.9e-12 M -11.409 avidity_multivalent Kd Gold ACS multi_agent_verified pending_manual_supp     dot_blot     undiluted wastewater   DNA dimeric 36926840 10.1021/acssensors.2c02655 DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B). step2c_acs_v1
404 SARS-CoV-2 pseudotyped lentivirus (omicron variant) protein   DSA1N5   4.8e-12 M -11.319 avidity_multivalent Kd Gold v4 multi_agent_verified pending_manual_supp     dot_blot     deionized water   DNA dimeric 36926840 10.1021/acssensors.2c02655 This study demonstrates that DSA1N5 has high affinity for recognizing OMPV with a K d value of 4.8 pM, which is in the same order of magnitude as that measured for the WTPV (2.1 pM) in deionized water (DI water) step2c_acs_v1
405 SARS-CoV-2 pseudotyped lentivirus (omicron variant) protein   DSA1N5   5.1e-12 M -11.292 avidity_multivalent Kd Gold v4 multi_agent_verified pending_manual_supp     dot_blot     wastewater (diluted 50% with binding buffer)   DNA dimeric 36926840 10.1021/acssensors.2c02655 DSA1N5 preserves its binding affinity in 50% wastewater ( K d = 2.1 -4.1 pM for WTPV and 5.1 for OMPV in wastewater). step2c_acs_v1
620 nucleolin protein P19338 Cy5-AT11 TGGTGGTGGTTGTTGTGGTGGTGGTGGT 5.2e-12 M -11.284 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       31301466 10.1016/j.ijpharm.2019.118511 yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8 elsevier_step2c
184 PDGF-BB protein P01127 FullApt   5.33 pM -11.273 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ELISA 298.0       DNA   28825469 10.1021/acscombsci.6b00163 FullApt | 5.33 ± 2.36 | - 15.37 step2c_literal_v3
185 PDGF-BB protein P01127 40Apt   5.92 pM -11.228 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ELISA 298.0       DNA   28825469 10.1021/acscombsci.6b00163 40Apt | 5.92 ± 1.13 | - 15.31 step2c_literal_v3
187 PDGF-BB protein P01127 38bApt   7.03 pM -11.153 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ELISA 298.0       DNA   28825469 10.1021/acscombsci.6b00163 38bApt | 7.03 ± 1.28 | - 15.21 step2c_literal_v3
618 nucleolin protein P19338 Cy5-AT11 TGGTGGTGGTTGTTGTGGTGGTGGTGGT 9.1e-12 M -11.041 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       31301466 10.1016/j.ijpharm.2019.118511 K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4 elsevier_step2c
619 nucleolin protein P19338 Cy5-AT11-B0 TGGTGGTGGTTGGTGGTGGTGGTGGT 9.5e-12 M -11.022 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       31301466 10.1016/j.ijpharm.2019.118511 K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4 elsevier_step2c
269 thrombin protein P00734 HD1-12A-DAB   13.1 pM -10.883 non_intrinsic Kd Gold v4 extraction_verified pending_manual_supp     filter_binding     selection buffer   DNA   41053535 10.1002/advs.202509867 HD1-12A-DAB EXACT inhibitor bound to thrombin and prothrombin with K D s of 13.1 pm step2c_literal_v3
143 P-selectin protein Q14242 PF377   14.0 pM -10.854 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377 | 14 step2c_literal_v3
147 P-selectin protein Q14242 PF377sl   14.0 pM -10.854 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 296.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377sl | 14 step2c_literal_v3
142 P-selectin protein Q14242 PF377   16.0 pM -10.796 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377 | 16 step2c_literal_v3
144 P-selectin protein Q14242 PF377   18.0 pM -10.745 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 277.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377 | 18 step2c_literal_v3
351 thrombin protein P00734 Supra-TBA15/29-GO   1.9e-11 M -10.721 avidity_multivalent Kd Gold v4 multi_agent_verified pending_manual_supp               DNA Graphene Oxide immobilization; poly(adenine) anchor 31157200 10.3389/fchem.2019.00280 Supra-TBA15 / 29-GO prepared with GO (40 μ g mL -1 ) at 60 ◦ C exhibited much higher binding affinity toward thrombin ( K d = 1.9 × 10 -11 M, Figure S10 , Supporting Information). step2c_acs_v1
623 Malate Synthase protein Q8N0X4 MS10-Trunc GGTGGTGGTGG 19.0 pM -10.721 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         abstract       31704587 10.1016/j.omtn.2019.09.026 MS10-Trunc aptamer exhibited high af fi nity for MS (equilibrium dissociation constant [KD] 19 pM) elsevier_step2c
140 PDGF-C protein P01127 α-PC CTACTGTGTGATGTCTGAGAGCAGCGTCTAAACGAACAAGCGAACCTATGCACAGAGGACAGTACATCAGACAC 20.0 pM -10.699 intrinsic KD Gold v4 extraction_verified verified_in_text_or_SI original   SPR   7.4 HBS-EP + (10-mM HEPES, 150-mM NaCl, 3-mM EDTA, and 0.05% Tween 20, pH 7.4)   DNA PEG 42138517 10.1167/iovs.67.5.36 SPR analysis demonstrated that the α -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM step2c_literal_v3
146 P-selectin protein Q14242 PF377sl   29.0 pM -10.538 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377sl | 29 step2c_literal_v3
319 VEGF165 protein P15692 3R02 Bivalent TGTGGGGGTGGACTGGGTGGGTACCTTTTTTTTTTTGTGGGGGTGGACTGGGTGGGTACC 3e-11 M -10.523 avidity_multivalent Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 23237717 10.1021/ac303023d The K d value of 30 pM for 3R02 Bivalent was calculated by measuring SPR. step2c_acs_v1
669 bevacizumab protein P31995 A14#1 GCGGTTGGTGGTAGTTACGTTCGC 44.0 pM -10.357 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         abstract       35114463 10.1016/j.bios.2022.114027 affinity of A14#1 to bevacizumab markedly increased at pH 4.7 ( K D = 44 pM) elsevier_step2c
145 P-selectin protein Q14242 PF377sl   46.0 pM -10.337 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377sl | 46 step2c_literal_v3
312 thrombin protein P00734 MP-TBA15/TBA29-T15 GGTTGGTGTGGTTGG 5.2e-11 M -10.284 avidity_multivalent Kd Gold v4 multi_agent_verified verified_in_text_or_SI backfill_text_verified   saturation_binding   7.4 physiological buffer (25 mM Tris-HCl (pH 7.4), 150 mM NaCl, 5.0 mM KCl, 1.0 mM MgCl2, 1.0 mM CaCl2) containing BSA (100 μM)   DNA thiolated; 15-mer thymidine linker 22300379 10.1021/la204651t MP-TBA15/TBA29-T15 -Au NPs provided high flexibility and an appropriate orientation and distance between TBA and TBA units for bivalent binding, allowing stronger interactions with thrombin ( K d = 5.2 × 10 -11 M; Supporting Information, Figure S3) step2c_acs_v1
148 P-selectin protein Q14242 PF373sl   56.0 pM -10.252 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF373sl | 56 step2c_literal_v3
56 von Willebrand factor A1-domain protein P04275 Rn-DsDsDs-53mh   61.3 pM -10.213 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR 310.15   1 × PBS supplemented with 0.05% (w/v) Nonidet P-40   DNA Ds (7-(2-thienyl)imidazo[4,5b]pyridine); mini-hairpin DNA 27966933 10.1021/jacs.6b10767 RnDsDsDs-53mh ( K D = 61.3 pM) step2c_literal_v3
542 Myoglobin protein P02144 anti-Mb aptamer   65.0 pM -10.187 intrinsic Kd Gold elsevier extraction_verified pending_manual_supp           text       25957831 10.1016/j.bios.2015.04.089 The corresponding af fi nity, K D, values calculated from the ratio between dissociation ( k d) and association ( k a ) was found to be 65 pM. elsevier_step2c
53 von Willebrand factor A1-domain protein P04275 Rn-DsDsDs-44   74.9 pM -10.126 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR 310.15   1 × PBS supplemented with 0.05% (w/v) Nonidet P-40   DNA Ds (7-(2-thienyl)imidazo[4,5b]pyridine) 27966933 10.1021/jacs.6b10767 Rn-DsDsDs-44 ( K D = 74.9 pM) exhibited the highest a ffi nity step2c_literal_v3
152 PDGF-BB protein P01127 PDGF-B aptamer   0.1 nM -10.0 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding         DNA 2'-fluoro; 2'-O-methyl; hexaethylene glycol spacer; inverted 3'-3' thymidine cap; 40-kd PEG conjugated 9916931 10.1016/S0002-9440(10)65263-7 the binding affinity of the aptamer used in the experiments described below ( K d ≈ 0.1 nM) step2c_literal_v3
547 ofloxacin protein Q9H015 Q2 ATACCAGCTTATTCAATTGCAGGGTATCTGAGGCTTGATCTACTAAATGTCGTGGGGCATTGCTATTGGCGTTGATACGTACAATCGTAATCAGTTAG 0.11 nM -9.959 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       26547431 10.1016/j.bios.2015.10.069 Their K D values were calculated at K D 1⁄4 0.11 nM ( 7 0.06) for aptamer Q2 elsevier_step2c
331 MutS protein O15457 2-06 ACTTCTGCCCGCCTCCTTCCTGGTAAAGTCATTAATAGGTGTGGGGTGCCGGGCATTTCGGAGACGAGATAGGCGGACACT 1.23e-10 M -9.91 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 25668425 10.1021/acs.analchem.5b00171 The best fi t was obtained at K d = 123 pM and [T]0 = 213 pM step2c_acs_v1
245 MPO protein P05164 MPO-16 GTCTGGAAACGACGAGGGCCACTGATTAACGTAGTTAATTGGTCTTGTCG 166.0 pM -9.78 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO16 revealed the highest binding affinity ( K d = 166 pM) step2c_literal_v3
149 P-selectin protein Q14242 PF398sl   178.0 pM -9.75 intrinsic Kd Gold v4 extraction_verified pending_manual_figure     filter_binding 310.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF398sl | 178 step2c_literal_v3
57 von Willebrand factor A1-domain protein P04275 Rn-DsDs-51mh2   182.0 pM -9.74 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR 310.15   1 × PBS supplemented with 0.05% (w/v) Nonidet P-40   DNA Ds (7-(2-thienyl)imidazo[4,5b]pyridine); mini-hairpin DNA 27966933 10.1021/jacs.6b10767 Rn-DsDs-51mh2 ( K D = 182 pM) step2c_literal_v3
363 HBcAg protein   A-9 AGCAGCACAGAGGTCAGATGAGGCCTGGTGATCGTGCCCAGGCCATATGAGCAAGGAACCCCTATGCGTGCTACCGTGAA 2.0000000000000003e-10 M -9.699 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   affinity_real_time_qPCR         DNA   32250595 10.1021/acs.analchem.9b05740 This aptamer showed strong binding to HBcAg ( K d : 0.2 nM) step2c_acs_v1
548 ofloxacin protein Q9H015 Q8 ATACCAGCTTATTCAATTAGTTGTGTATTGAGGTTTGATCTAGGCATAGTCAACAGAGCACGATCGATCTGGCTTGTTCTACAATCGTAATCAGTTAG 0.2 nM -9.699 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       26547431 10.1016/j.bios.2015.10.069 K D 1⁄4 0.20 nM ( 7 0.09) for aptamer Q8 elsevier_step2c
558 OH-BDE47 protein   BDE-A-8 GACAGCCGGGGCATCAGAGCAGCCGATTGTCTGTTGTGCC 0.2 nM -9.699 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       27566357 10.1016/j.aca.2016.06.040 The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition. elsevier_step2c
234 MPO protein P05164 MPO-02 TATGCGATTTCAAAAATGTTACGATGGATATTGACATTTAAATATGTCGG 227.0 pM -9.644 non_intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI backfill_text_verified   flow_cytometry     selection buffer (DPBS with 2.5 mM MgCl2 , 1 mM CaCl 2 , 0.01% TWEEN-20, 0.2% BSA) 2.5 DNA   37277648 10.1038/s41557-023-01207-z MPO-02 ... 227 step2c_literal_v3
307 P-selectin protein Q14242 PF377sl   250.0 pM -9.602 non_intrinsic Kd Gold v4 extraction_verified pending_manual_figure     flow_cytometry 296.15 7.4 SHMCK buffer 1.0 2'F-RNA   9743465 10.1089/oli.1.1998.8.265 PF377sl | 250 step2c_literal_v3
639 thrombin protein P00734 29-mer thrombin-specific aptamer AGTCCGTGGTAGGGCAGGTTGGGGTGACT 298.0 pM -9.526 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       32570818 10.3390/s20123442 The n-curve analysis provided a Kd of 298 pM ( + 111 / 81 pM) elsevier_step2c
318 VEGF165 protein P15692 3R02 TGTGGGGGTGGACTGGGTGGGTACC 3e-10 M -9.523 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original                 23237717 10.1021/ac303023d The K d value for 3R02 was 300 pM step2c_acs_v1
660 20 Methyl Spirolide G protein   SPX 7 GGCGGTGTGGGTACCACGAGGTTTGGACGCGCGTAGCACCCCATTCAGC 3e-10 M -9.523 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         text       34144421 10.1016/j.foodchem.2021.130332 The present study, among the aptamers selected, the aptamer with highest affinity had a dissociation constant of 0.3 nM for SPX G elsevier_step2c
554 chimeric-tPA protein   Chi-tPA 1 TTCCAACGGTTGGTGGGTGGTT 0.32 nM -9.495 intrinsic Kd Gold elsevier extraction_verified verified_in_text_or_SI original         abstract       26876003 10.1016/j.pep.2016.02.004 selected aptamer having KD values of 0.320 nM elsevier_step2c
55 von Willebrand factor A1-domain protein P04275 ARC1172-41   326.0 pM -9.487 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     SPR 310.15   1 × PBS supplemented with 0.05% (w/v) Nonidet P-40   DNA   27966933 10.1021/jacs.6b10767 ARC1172-41 ( K D = 326 pM) step2c_literal_v3
478 FLRPp (O serotype) protein   FMD_1   3.46e-10 M -9.461 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     SPR         DNA   42010751 10.1021/acs.analchem.5c04748 dissociation constants ( KD ) of 3.46 × 10 -10 M step2c_acs_v1
247 Human thrombin protein P00734 Lin08-08   0.4 nM -9.398 non_intrinsic Kd Gold v4 extraction_verified pending_supp_oa   KEEP_seq_in_figure SPR   7.4 PBS [pH 7.4], 0.05 [v/v%] surfactant Tween 20   DNA   37621412 10.1016/j.omtn.2023.07.038 Lin(08-08) | 1.63 10^6 | 6.94 10^-4 | 0.4 step2c_literal_v3

Next page

Advanced export

JSON shape: default, array, newline-delimited

CSV options:

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';
Powered by Datasette · Queries took 237.953ms · Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target