Kd — all source-verified measurements

All Gold-tier aptamer–target Kd records with verbatim quote + measurement class. Use facets to filter to intrinsic vs apparent/avidity.

Custom SQL query returning 742 rows (hide)

SELECT target_name_canonical, target_type, aptamer_name, kd_reported, kd_log10_molar, measurement_class, assay_method, assay_temperature_k, source_pmid, verbatim_quote FROM v_kd ORDER BY kd_log10_molar ASC

Edit SQL

This data as json, CSV

target_name_canonical	target_type	aptamer_name	kd_reported	kd_log10_molar	measurement_class	assay_method	assay_temperature_k	source_pmid	verbatim_quote
PDGF-BB	protein	36aApt	0.036 pM	-13.444	non_intrinsic	ELISA	298.0	28825469	36aApt \| 0.036 ± 0.012 \| - 18.33
PDGF-BB	protein	38aApt	0.094 pM	-13.027	non_intrinsic	ELISA	298.0	28825469	38aApt \| 0.094 ± 0.008 \| - 17.76
IL-8	protein	8A-35	1.72e-12 M	-11.764	intrinsic	SPR	298.0	24129312	\| 8A-35 \| 5.78 x 10 4 \| 9.95 x 10 -8 \| 1.72 x 10 -12 \| 2.80 \| 3.11 x 10 1 \|
human α-Thrombin	protein	A1	2.0 pM	-11.699	intrinsic			31129134	Also for aptamer A1 we measured with MST KD values in the pico- and nanomolar range (2 pM and 52 nM). The lowest KD value is determined with MST (shown as bar) for aptamer A1, which is 2 pM.
SARS-CoV-2 spike protein (wild type)	protein	DSA1N5	3e-12 M	-11.523	avidity_multivalent	dot_blot		36926840	DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B).
nucleolin	protein	Cy5-AT11-B0	3.3e-12 M	-11.481	intrinsic			31301466	yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8
SW480 cells	cell/EV	Apt-nanovesicle	3.66 pM	-11.437	non_intrinsic			32049531	The dissociation constant ( K d ) value of Apt-nanovesicle against SW480 cells was found to be 3.66 ± 0.34 pM (Figure 2B)
SARS-CoV-2 spike protein (wild type)	protein	DSA1N5	3.9e-12 M	-11.409	avidity_multivalent	dot_blot		36926840	DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B).
SARS-CoV-2 pseudotyped lentivirus (omicron variant)	protein	DSA1N5	4.8e-12 M	-11.319	avidity_multivalent	dot_blot		36926840	This study demonstrates that DSA1N5 has high affinity for recognizing OMPV with a K d value of 4.8 pM, which is in the same order of magnitude as that measured for the WTPV (2.1 pM) in deionized water (DI water)
SARS-CoV-2 pseudotyped lentivirus (omicron variant)	protein	DSA1N5	5.1e-12 M	-11.292	avidity_multivalent	dot_blot		36926840	DSA1N5 preserves its binding affinity in 50% wastewater ( K d = 2.1 -4.1 pM for WTPV and 5.1 for OMPV in wastewater).
nucleolin	protein	Cy5-AT11	5.2e-12 M	-11.284	intrinsic			31301466	yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8
PDGF-BB	protein	FullApt	5.33 pM	-11.273	non_intrinsic	ELISA	298.0	28825469	FullApt \| 5.33 ± 2.36 \| - 15.37
PDGF-BB	protein	40Apt	5.92 pM	-11.228	non_intrinsic	ELISA	298.0	28825469	40Apt \| 5.92 ± 1.13 \| - 15.31
PDGF-BB	protein	38bApt	7.03 pM	-11.153	non_intrinsic	ELISA	298.0	28825469	38bApt \| 7.03 ± 1.28 \| - 15.21
nucleolin	protein	Cy5-AT11	9.1e-12 M	-11.041	intrinsic			31301466	K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4
nucleolin	protein	Cy5-AT11-B0	9.5e-12 M	-11.022	intrinsic			31301466	K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4
thrombin	protein	HD1-12A-DAB	13.1 pM	-10.883	non_intrinsic	filter_binding		41053535	HD1-12A-DAB EXACT inhibitor bound to thrombin and prothrombin with K D s of 13.1 pm
P-selectin	protein	PF377	14.0 pM	-10.854	intrinsic	filter_binding	310.15	9743465	PF377 \| 14
P-selectin	protein	PF377sl	14.0 pM	-10.854	intrinsic	filter_binding	296.15	9743465	PF377sl \| 14
P-selectin	protein	PF377	16.0 pM	-10.796	intrinsic	filter_binding	310.15	9743465	PF377 \| 16
P-selectin	protein	PF377	18.0 pM	-10.745	intrinsic	filter_binding	277.15	9743465	PF377 \| 18
thrombin	protein	Supra-TBA15/29-GO	1.9e-11 M	-10.721	avidity_multivalent			31157200	Supra-TBA15 / 29-GO prepared with GO (40 μ g mL -1 ) at 60 ◦ C exhibited much higher binding affinity toward thrombin ( K d = 1.9 × 10 -11 M, Figure S10 , Supporting Information).
Malate Synthase	protein	MS10-Trunc	19.0 pM	-10.721	intrinsic			31704587	MS10-Trunc aptamer exhibited high af fi nity for MS (equilibrium dissociation constant [KD] 19 pM)
PDGF-C	protein	α-PC	20.0 pM	-10.699	intrinsic	SPR		42138517	SPR analysis demonstrated that the α -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM
SW480 cells	cell/EV	Fixed Apt-nanovesicle	28.06 pM	-10.552	non_intrinsic			32049531	the K d value of fi xed Apt-nanovesicles to SW480 cells was increased to 28.06 ± 3.31 pM (Figure 2D)
P-selectin	protein	PF377sl	29.0 pM	-10.538	intrinsic	filter_binding	310.15	9743465	PF377sl \| 29
VEGF165	protein	3R02 Bivalent	3e-11 M	-10.523	avidity_multivalent			23237717	The K d value of 30 pM for 3R02 Bivalent was calculated by measuring SPR.
bevacizumab	protein	A14#1	44.0 pM	-10.357	intrinsic			35114463	affinity of A14#1 to bevacizumab markedly increased at pH 4.7 ( K D = 44 pM)
P-selectin	protein	PF377sl	46.0 pM	-10.337	intrinsic	filter_binding	310.15	9743465	PF377sl \| 46
thrombin	protein	MP-TBA15/TBA29-T15	5.2e-11 M	-10.284	avidity_multivalent	saturation_binding		22300379	MP-TBA15/TBA29-T15 -Au NPs provided high flexibility and an appropriate orientation and distance between TBA and TBA units for bivalent binding, allowing stronger interactions with thrombin ( K d = 5.2 × 10 -11 M; Supporting Information, Figure S3)
P-selectin	protein	PF373sl	56.0 pM	-10.252	intrinsic	filter_binding	310.15	9743465	PF373sl \| 56
sLe X -BSA	glycan/conjugate	Clone 5	5.7e-11 M	-10.244	intrinsic	SPR	298.15	11178986	sLe X -BSA \| 6.4 3 10 7 \| 3.7 3 10 2 3 \| 1.7 3 10 10 \| 5.7 3 10 2 11
von Willebrand factor A1-domain	protein	Rn-DsDsDs-53mh	61.3 pM	-10.213	intrinsic	SPR	310.15	27966933	RnDsDsDs-53mh ( K D = 61.3 pM)
Myoglobin	protein	anti-Mb aptamer	65.0 pM	-10.187	intrinsic			25957831	The corresponding af fi nity, K D, values calculated from the ratio between dissociation ( k d) and association ( k a ) was found to be 65 pM.
von Willebrand factor A1-domain	protein	Rn-DsDsDs-44	74.9 pM	-10.126	intrinsic	SPR	310.15	27966933	Rn-DsDsDs-44 ( K D = 74.9 pM) exhibited the highest a ffi nity
CCRF-CEM cells	cell/EV	CDN-sgc8	0.08 nM	-10.097	non_intrinsic	fluorescence		35670775	Kd=0.08±0.01 nM
sLe X -BSA	glycan/conjugate	Clone 5	8.5e-11 M	-10.071	intrinsic	SPR	298.15	11178986	Clone 5 \| 1.3 3 10 5 \| 1.1 3 10 2 5 \| 1.1 3 10 10 \| 8.5 3 10 2 11
PDGF-BB	protein	PDGF-B aptamer	0.1 nM	-10.0	intrinsic	filter_binding		9916931	the binding affinity of the aptamer used in the experiments described below ( K d ≈ 0.1 nM)
ofloxacin	protein	Q2	0.11 nM	-9.959	intrinsic			26547431	Their K D values were calculated at K D 1⁄4 0.11 nM ( 7 0.06) for aptamer Q2
MutS	protein	2-06	1.23e-10 M	-9.91	intrinsic			25668425	The best fi t was obtained at K d = 123 pM and [T]0 = 213 pM
MPO	protein	MPO-16	166.0 pM	-9.78	non_intrinsic	flow_cytometry		37277648	MPO16 revealed the highest binding affinity ( K d = 166 pM)
P-selectin	protein	PF398sl	178.0 pM	-9.75	intrinsic	filter_binding	310.15	9743465	PF398sl \| 178
von Willebrand factor A1-domain	protein	Rn-DsDs-51mh2	182.0 pM	-9.74	intrinsic	SPR	310.15	27966933	Rn-DsDs-51mh2 ( K D = 182 pM)
HBcAg	protein	A-9	2.0000000000000003e-10 M	-9.699	intrinsic	affinity_real_time_qPCR		32250595	This aptamer showed strong binding to HBcAg ( K d : 0.2 nM)
ofloxacin	protein	Q8	0.2 nM	-9.699	intrinsic			26547431	K D 1⁄4 0.20 nM ( 7 0.09) for aptamer Q8
OH-BDE47	protein	BDE-A-8	0.2 nM	-9.699	intrinsic			27566357	The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition.
MPO	protein	MPO-02	227.0 pM	-9.644	non_intrinsic	flow_cytometry		37277648	MPO-02 ... 227
P-selectin	protein	PF377sl	250.0 pM	-9.602	non_intrinsic	flow_cytometry	296.15	9743465	PF377sl \| 250
thrombin	protein	29-mer thrombin-specific aptamer	298.0 pM	-9.526	intrinsic			32570818	The n-curve analysis provided a Kd of 298 pM ( + 111 / 81 pM)
VEGF165	protein	3R02	3e-10 M	-9.523	intrinsic			23237717	The K d value for 3R02 was 300 pM
20 Methyl Spirolide G	protein	SPX 7	3e-10 M	-9.523	intrinsic			34144421	The present study, among the aptamers selected, the aptamer with highest affinity had a dissociation constant of 0.3 nM for SPX G
chimeric-tPA	protein	Chi-tPA 1	0.32 nM	-9.495	intrinsic			26876003	selected aptamer having KD values of 0.320 nM
von Willebrand factor A1-domain	protein	ARC1172-41	326.0 pM	-9.487	intrinsic	SPR	310.15	27966933	ARC1172-41 ( K D = 326 pM)
FLRPp (O serotype)	protein	FMD_1	3.46e-10 M	-9.461	intrinsic	SPR		42010751	dissociation constants ( KD ) of 3.46 × 10 -10 M
Human thrombin	protein	Lin08-08	0.4 nM	-9.398	non_intrinsic	SPR		37621412	Lin(08-08) \| 1.63 10^6 \| 6.94 10^-4 \| 0.4
Human thrombin	protein	Pse08-08	0.4 nM	-9.398	non_intrinsic	SPR		37621412	Pse(08-08) \| 1.19 10^6 \| 5.10 10^-4 \| 0.4
HBeAg	protein	EAg3-Py	4.0000000000000007e-10 M	-9.398	intrinsic	affinity_real_time_qPCR		32250595	The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3
CCRF-CEM cells	cell/EV	mono-CDN-sgc8	0.48 nM	-9.319	non_intrinsic	fluorescence		35670775	Kd= 0.48 ± 0.04 nM
PDGF-BB	protein	PDGF-specific aptamer	5e-10 M	-9.301	intrinsic	microcantilever	310.15	24723743	K d , as shown in Fig. 10, decreased from approximately 12 × 10 -10 M to 5 × 10 -10 M as the temperature changed from 19 to 37 ◦ C.
human α-thrombin	protein	Apt29	0.5 nM	-9.301	non_intrinsic			28763192	a 29nucleotide aptamer (5 ′ -AGT CCG TGG TAG GGC AGG TTG GGG TGA CT-3 ′ , denoted as Apt29 here) binds to the heparin-binding site of human α -thrombin with a dissociation constant ( K d) around 0.5 nM.
thrombin	protein	TBA29	0.5 nM	-9.301	non_intrinsic			31614078	The 29-nt TBA29 aptamer has a bimodular duplex-antiparallel G4 structure and binds to thrombin with a binding a ffi nity of 0.5 nM. 30
BDNF	protein	NV_B12	5e-10 M	-9.301	intrinsic	ALISA		38149631	The equilibrium dissociation constant ( K d) for the NV_B12/BDNF interaction was obtained by fitting the equation, Y = B max × X /( K d + X )... The K d value determined to be 0.5 nM (95% CI: 0.4 -0.6 nM)
Thrombin	protein	TBA29	5e-10 M	-9.301	intrinsic			26643617	and TBA29 (~5 × 10 -10 M)
PlanarAu	protein	1N	5.600000000000001e-10 M	-9.252	intrinsic	QCM		30189130	aptamer 1N showing the highest affinity (0.56 nM)
AGEs-HSA	protein	#9s	0.57 nM	-9.244	intrinsic			24012635	Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively.
sLe X -BSA	glycan/conjugate	Selected pool	5.8e-10 M	-9.237	intrinsic	SPR		11178986	Selected pool \| 2.4 3 10 5 \| 1.4 3 10 2 3 \| 1.7 3 10 9 \| 5.8 3 10 2 10
human α-thrombin	protein	5'-TMR-Apt15-T24	0.6 nM	-9.222	non_intrinsic	CE-LIF	298.15	28763192	0.6 nM for 5 ′ -TMR-Apt15-T24
human α-thrombin	protein	5'-TMR-Apt15-T25	0.6 nM	-9.222	non_intrinsic	CE-LIF	298.15	28763192	0.6 nM for 5 ′ -TMR-Apt15-T25
EGFR	protein	Anti-EGF receptor aptamer	0.62 nM	-9.208	non_intrinsic			41877526	Anti-EGF receptor aptamers ( K d : 0.62 nM, DNA aptamers)
AGEs-HSA	protein	#4s	0.63 nM	-9.201	intrinsic			24012635	Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively.
thrombin	protein	HD1-22	6.5e-10 M	-9.187	non_intrinsic	SPR		18826387	HD1-22 \| Thrombin \| K D ( M) \| 6.5 · 10 ) 10
MutS	protein	2-06	6.5e-10 M	-9.187	intrinsic			25668425	The experimental points from the second step resulted in the best fi t with the theoretical dependence of R versus [L] 0 at K d = 650 pM
human α-thrombin	protein	5'-TMR-Apt15-T30	0.7 nM	-9.155	non_intrinsic	CE-LIF	298.15	28763192	0.7 nM for 5 ′ -TMR-Apt15-T30
human α-thrombin	protein	5'-TMR-Apt15-T35	0.7 nM	-9.155	non_intrinsic	CE-LIF	298.15	28763192	0.7 nM for 5 ′ -TMR-Apt15-T35
tetracycline	protein	TC aptamer	770.0 pM	-9.114	intrinsic			25517161	dissociation constant Kd of 770 pM ([Mg 2 þ ] 1⁄4 10 mM)
sLe X -BSA	glycan/conjugate	Clone 2	8e-10 M	-9.097	intrinsic	SPR		11178986	Clone 2 \| 9.8 3 10 5 \| 7.3 3 10 2 5 \| 1.2 3 10 9 \| 8.0 3 10 2 10
PSMA	protein	C3	8.000000000000001e-10 M	-9.097	intrinsic	EMSA		41126016	an exemplar shows very high affinity for PSMA ( K d ∼ 0.8 nM).
Immunoglobulin E	protein	IgE37-T10-FAM	0.8 nM	-9.097	intrinsic			32498825	The FA assay using T10-labeled aptamer with a dissociation constant ( K d) about 0.8 nM
CCRF-CEM cells	cell/EV	individual sgc8	0.82 nM	-9.086	non_intrinsic	fluorescence		35670775	Kd=0.82 ± 0.12 nM
Tasset - thrombin complex	protein	Bock	0.87 nM	-9.06	intrinsic	BSI	283.15	22032342	Bock - [Tasset complex] \| not available \| 0.87 ( 0.18 nM
MPO	protein	MPO-14	897.0 pM	-9.047	non_intrinsic	flow_cytometry		37277648	MPO-14 ... K d : 897 pM
MPO	protein	MPO-03	912.0 pM	-9.04	non_intrinsic	flow_cytometry		37277648	MPO-03 ... 912
alpha-thrombin	protein	RNAR9D-14T	1.0 nM	-9.0	intrinsic	filter_binding	310.15	22385910	Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) and α-thrombin (apparent Kd =1 nM)
P-selectin	protein	PF422sl	1000.0 pM	-9.0	intrinsic	filter_binding	310.15	9743465	PF422sl \| 1 X 103
neomycin	protein	Aptamer A	1e-09 M	-9.0	intrinsic			36453647	The binding affinity of neomycin to Aptamer A shows a strong K d of 1 nM with an enthalpy and entropy value of -100 kJ/mol & -163.1 J/mol. K
Sc3+	protein	Sc-1	1e-09 M	-9.0	intrinsic	fluorescence		39743479	true K d for the binding of Sc-1 to Sc 3+ to be 1.0 nM
PSMA	protein	C3 (without fluorescein)	1e-09 M	-9.0	intrinsic	EMSA		41126016	EMSA data show that Cy5-labeled C3 without fluorescein binds PSMA just as strongly as the parent construct, with an apparent K d of ∼ 1 nM (Figure S9).
von Willebrand factor A1-domain	protein	Pr-DsDsDs-40	1.03 nM	-8.987	intrinsic	SPR	310.15	27966933	Pr-DsDsDs-40 ( K D = 1.03 nM)
Heparin-binding protein	protein	Apt-13	1.04 nM	-8.983	intrinsic			38675537	The KD values of the three aptamers were 3.42, 1.44, and 1.04 nM, respectively
beta-conglutin	protein	11-mer	1.05e-09 M	-8.979	intrinsic	MST	298.15	33498970	KD values determined (Figure 6b) are very similar (11-mer: 1.05 nM
AP65	protein	AP65_A1	1.057e-09 M	-8.976	intrinsic	ELAA	298.15	29972299	A K D value of 1.057 nM was obtained using the sigmoidal dose-response curve model
MPO	protein	MPO-01	1148.0 pM	-8.94	non_intrinsic	flow_cytometry		37277648	MPO-01 ... 1,148
PDGF-BB	protein	PDGF-specific aptamer	1.2e-09 M	-8.921	intrinsic	microcantilever	292.15	24723743	K d , as shown in Fig. 10, decreased from approximately 12 × 10 -10 M to 5 × 10 -10 M as the temperature changed from 19 to 37 ◦ C.
HBeAg	protein	A-9S	1.2e-09 M	-8.921	intrinsic	affinity_real_time_qPCR		32250595	The measured dissociation constant ( K d) is improved by 19 times  from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.
PvTRAg	protein	Apt_16	1.2e-09 M	-8.921	intrinsic			40042916	The K D of Apt_14 and Apt_16 was found to be comparable, 1.9 and 1.2 nM, respectively
ATP	protein	Huizenga-Szostak ATP aptamer	1.3e-09 M	-8.886	intrinsic	fluorescence		25170558	binding a ffi nity can be tuned over 4 orders of magnitude (1.3 nM -203 μ M)
prothrombin	protein	RNAR9D-14T	1.4 nM	-8.854	intrinsic	SPR	298.15	22385910	Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM
PD-L1	protein	8-60	1.4 nM	-8.854	intrinsic			34711320	8 e 60, a representative aptamer with high af fi nity (KD 1⁄4 1.4 nM determined by SPR)
Heparin-binding protein	protein	Apt-02	1.44 nM	-8.842	intrinsic			38675537	The KD values of the three aptamers were 3.42, 1.44, and 1.04 nM, respectively
alkaline phosphatase	protein	ALP binding aptamer	1.49e-09 M	-8.827	avidity_multivalent	PISA		30827094	Similarly, from the response -dose curve (Figure 3B), the K d value for the aptamer -MIP hybrid-coated array was estimated to be 1.49 × 10 -9 M
thrombin	protein	T.7	1.5 nM	-8.824	intrinsic	SPR		37798416	T.7 exhibited the strongest binding signal with a 1.5 nM K d
alkaline phosphatase	protein	ALP binding aptamer	1.5000000000000002e-09 M	-8.824	avidity_multivalent	PISA		30827094	giving cross-reactivity of 3.2 -5.6% and a dissociation constant of 1.5 nM
OH-BDE47	protein	BDE-A-12	1.53 nM	-8.815	intrinsic			27566357	The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition.
IgE	protein	S2	1.5500000000000002e-09 M	-8.81	intrinsic	NECEEM		36144553	Based on the results of these experiments, the K D values of S1 and S2 were estimated to be 0.83 and 1.55 nM, respectively
human α-thrombin	protein	LOOPER modified thrombin aptamer	1.6000000000000003e-09 M	-8.796	intrinsic	SPR		28938065	Using single-cycle kinetics surface plasmon resonance (SPR), the LOOPER aptamer exhibited a Kd of 1.6 nM
hOX40	protein	9C7	1.7 nM	-8.77	intrinsic	filter_binding	310.15	23113766	9C7 \| 11 \| 1.7
HBeAg	protein	EAg3	1.7000000000000001e-09 M	-8.77	intrinsic	affinity_real_time_qPCR		32250595	The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3, as compared to the K d value of 1.7 nM with the unmodi fi ed EAg3 aptamer.
beta-conglutin	protein	TT-11-mer	1.88e-09 M	-8.726	intrinsic	MST	298.15	33498970	KD values determined (Figure 6b) are very similar (... TT-11 mer: 1.88 nM
Bock - thrombin complex	protein	Tasset	1.9 nM	-8.721	intrinsic	BSI	283.15	22032342	Tasset - [Bock complex] \| not available \| 1.9 ( 0.2 nM
CD8a	protein	A3	1.9 nM	-8.721	non_intrinsic	flow_cytometry		31209354	the A1, A3 and A8 aptamers have apparent K D values of 18.3 ± 4.6, 1.9 ± 0.8 and 2.4 ± 0.9 nM, respectively
CD8	protein	CD8 aptamer	1.9 nM	-8.721	non_intrinsic	flow_cytometry		32786336	The aptamer with the highest apparent affinity (1.9 nM) and association rate, measured by flow cytometry and biolayer interferometry, respectively, was chosen for further use in cell isolation.
VWF A1-domain	protein	ARC1779	2.0 nM	-8.699	intrinsic	filter_binding	298.15	19422452	This resulted in a final aptamer (ARC1779) that is a 40-nucleotide modified DNA/RNA oligonucleotide with a K D of 2 nM for the A1-domain.
von Willebrand factor	protein	42-nt DNA aptamer	2.0 nM	-8.699	intrinsic	ELISA		31493779	a biotinylated DNA aptamer was able to bind an antibody-captured VWF in a concentration-dependent manner with a dissociation constant ( KD ) of 2.0 nM 0.3.
von Willebrand factor A1 domain	protein	ARC1779	2.0 nM	-8.699	non_intrinsic			21108551	ARC1779 binds with high affinity (Kd ~ 2 nM) to the vWF A1 domain
VWF A1 domain	protein	ARC1779	2.0 nM	-8.699	non_intrinsic			31315441	ARC1779 has a high binding affinity to VWF A1 domain (K D ≈ 2 nM)
CD8	protein	A3t	2.0 nM	-8.699	non_intrinsic			36149728	A3t, a CD8 receptor-binding aptamer, which binds CD8-expressing cells with an equilibrium dissociation constant K D of 2 nM.
CD8	protein	rvCD8apt	2.0 nM	-8.699	non_intrinsic			36149728	apparent K D = 2 nM for CD8 + cells
CD44-HABD	protein	Motif 4 (ADDA adduct)	2e-09 M	-8.699	intrinsic			23057694	motifs 2 and 4(ADDA adduct) have ~2 nM affinity to CD44-HABD
THY1	protein	XA-B217	2.0 nM	-8.699	intrinsic			33242496	The equilibrium dissociation constants, Kd, were derived from these curves and are determined as ... XA-B217=2 nM
Progesterone	protein	PG13T2	2.1 nM	-8.678	intrinsic			28237255	The dissociation constant of the PG13T2-P4 complex calculated using non-linear regression fi tting of the obtained curve was found to be 2.1 nM.
IL-23	protein	A23P15	2.139 nM	-8.67	intrinsic			38810331	the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively
sLe X -BSA	glycan/conjugate	Clone 15	2.3e-09 M	-8.638	intrinsic	SPR		11178986	Clone 15 \| 3.5 3 10 5 \| 8.1 3 10 2 4 \| 4.3 3 10 8 \| 2.3 3 10 2 9
alpha-fetoprotein	protein	AFP-specific ssDNA aptamer	2.37 nM	-8.625	intrinsic			22410487	The K d of the AFP-specific ssDNA was calculated to be 2.37 nM
thrombin	protein	HD22	2.4e-09 M	-8.62	intrinsic	SPR		18826387	HD22 \| Thrombin \| K D ( M) \| 2.4 · 10 ) 9
CD8a	protein	A8	2.4 nM	-8.62	non_intrinsic	flow_cytometry		31209354	the A1, A3 and A8 aptamers have apparent K D values of 18.3 ± 4.6, 1.9 ± 0.8 and 2.4 ± 0.9 nM, respectively
melatonin	protein	MLT-A-2	2.4 nM	-8.62	intrinsic			36925277	K d = 2.4 ± 2.8 nM for MLT-A-2
melatonin	protein	MLT-A-2F	2.4 nM	-8.62	intrinsic			36925277	MLT-A-2F K d = 2.4 ± 2.8 nM
MPO	protein	MPO-05	2584.0 pM	-8.588	non_intrinsic	flow_cytometry		37277648	MPO-05 ... 2,584
beta-conglutin	protein	11-mer-TT	2.59e-09 M	-8.587	intrinsic	MST	298.15	33498970	KD values determined (Figure 6b) are very similar (... and 11-mer-TT: 2.59 nM)
Human thrombin	protein	Pse08-29	2.6 nM	-8.585	non_intrinsic	SPR		37621412	Pse(08 - 29) \| 1.33 10^6 \| 3.47 10^-3 \| 2.6
Prostate Specific Antigen	protein	Apta	2.6 nM	-8.585	intrinsic			25569871	The change in current is used to determine the PSA -aptamer dissociation constant KD , of ca. 2.6 nM.
Human Cardiac Troponin I	protein	TnIApt 23	2.69 nM	-8.57	intrinsic			26003883	Finally TnIApt 23 showed beast affinity in nanomolar range (2.69 nM) toward the target protein.
beta-conglutin	protein	TT-11-mer-TT	2.71e-09 M	-8.567	intrinsic	MST	298.15	33498970	KD values determined (Figure 6b) are very similar (... TT-11-mer-TT: 2.71 nM
Neuron specific enolase	protein	P-5C8G	2.76 nM	-8.559	intrinsic			38091739	The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively.
thrombin	protein	TBA	2.86e-09 M	-8.544	intrinsic	SPR		16053288	thrombin \| 2.2 10 5 \| 6.3 10 - 4 \| 3.4 10 8 \| 2.86 10 - 9
IL-23	protein	A23P6	2.88 nM	-8.541	intrinsic			38810331	the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively
hCD4	protein	U26	2.93 nM	-8.533	intrinsic	qPCR	298.15	32567629	U26 exhibited the highest binding affinity ( K d = 2.93 ± 1.03 nM) to hCD4-conjugated beads.
S-adenosylmethionine	protein	Bs SAM-I riboswitch	3.0000000000000004e-09 M	-8.523	intrinsic			23343213	Both μ MSA values agree well with results from the in-line probing assays performed using identical buffer conditions: ... 3 nM K d , respectively
S-adenosylmethionine	protein	Pi SAM-I riboswitch	3.0000000000000004e-09 M	-8.523	intrinsic			23343213	which is on the order of the 3 nM value measured using a conventional inline probing assay
dT70	protein	DCC-SSB	3.0000000000000004e-09 M	-8.523	intrinsic			34085169	At a low concentration ( ∼ 2.5 nM), the titration with dT70 gave an approximate assessment of affinity ( K d ∼ 3 nM).
SARS-CoV-2 RBD	protein	CoV2-RBD-1	3.1000000000000005e-09 M	-8.509	intrinsic	flow_cytometry		32551560	the dissociation constant values ( K d) of the CoV2-RBD-1 aptamer ... were 3.1 nM
MPO	protein	MPO-18	3192.0 pM	-8.496	non_intrinsic	flow_cytometry		37277648	MPO-18 ... K d : 3,192 pM
human α-thrombin	protein	Apt15-T25-3'-TMR	3.2 nM	-8.495	non_intrinsic	CE-LIF	298.15	28763192	The apparent K d of Apt15-T25 -3 ′ -TMR was estimated to be about 3.2 nM.
K562	protein	PAM	3.2 nM	-8.495	non_intrinsic			32307868	the K d value (3.2 nM) of PAM in binding the K562 cell is one order of magnitude lower than that of the aptamer alone (41 nM).
sLe X	glycan/conjugate	Clone 5	3.3e-09 M	-8.481	intrinsic	SPR		11178986	sLe X \| 1.7 3 10 5 \| 5.5 3 10 2 4 \| 3.0 3 10 8 \| 3.3 3 10 2 9
transferrin receptor 1	protein	JBA8.26	3.3 nM	-8.481	non_intrinsic	flow_cytometry		35875870	JBA8.26 bound TfR1 hi H9 T-lymphoma cells with an apparent K D of 3.3 ± 0.6 nM
human α-Thrombin	protein	B1	3.4 nM	-8.469	intrinsic			31129134	for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)
prothrombin	protein	HD1	3.5e-09 M	-8.456	non_intrinsic	SPR		18826387	HD1 \| Prothrombin+ phospholipids \| K D ( M) \| 3.5 · 10 ) 9
Immunoglobulin E	protein	Unlabeled anti-IgE aptamer	3.5 nM	-8.456	intrinsic			32498825	close to the K d of the unlabeled aptamer (3.5 nM)
gonyautoxin 1/4	protein	tGO18-T-d	3.6 nM	-8.444	intrinsic			33294137	Corresponding Kd values of GO18-T-d and tGO18-T-d, determined by the average of 8 independent measurements, were 75.63 nM and 3.60 nM, respectively.
Surface Antigen 1	protein	SOK14	3.736 nM	-8.428	intrinsic			40288708	SOK14 (3.736 nM, R 2 = 0.7367)
human α-thrombin	protein	Tasset	3.84 nM	-8.416	intrinsic	BSI	283.15	22032342	Tasset - thrombin \| 0.5 - 1.0 nM 14 \| 3.84 ( 0.68 nM
sLe X -BSA	glycan/conjugate	Clone 18	3.9e-09 M	-8.409	intrinsic	SPR		11178986	Clone 18 \| 5.1 3 10 5 \| 2.0 3 10 2 3 \| 2.5 3 10 8 \| 3.9 3 10 2 9
Carcinoembryonic antigen	protein	GAC-P	3.93 nM	-8.406	intrinsic			35517255	The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively.
human α-thrombin	protein	LOOPER modified thrombin aptamer	4e-09 M	-8.398	intrinsic			28938065	Preliminary binding analysis by label-free microscale thermophoresis showed a promising dissociation constant K d = 4 nM for thrombin
Surface Antigen 1	protein	SOK18	4.034 nM	-8.394	intrinsic			40288708	SOK18 (4.034 nM, R 2 = 0.8422)
Surface Antigen 1	protein	SOK3	4.185 nM	-8.378	intrinsic			40288708	SOK3 (4.185 nM, R 2 = 0.8153)
Mouse thrombin	protein	Pse08-08	4.2 nM	-8.377	non_intrinsic	SPR		37621412	Pse(08-08) \| 7.35 10^5 \| 3.06 10^-3 \| 4.2
CD19	protein	WB15/15.CD19.1_3S	4.3 nM	-8.367	non_intrinsic	flow_cytometry	310.15	41079126	WB15/15.CD19.1_3S \| 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| 3.96 \| N.P. \| 4.3 ± 2.4
MPO	protein	MPO-04	4376.0 pM	-8.359	non_intrinsic	flow_cytometry		37277648	MPO-04 ... 4,376
melamine	protein	Apt M	4.4000000000000005e-09 M	-8.357	intrinsic			37343019	dissociation constant K d = 4.4 nM
RAGE	protein	RAGE-aptamer (clone #2)	4.44 nM	-8.353	intrinsic	QCM		28385802	#2RAGE-aptamer \| tcTgTTcAggTTggTAcggTggAAggTgTgATTcAcgAgg \| 4.44±0.56
Thyroglobulin	protein	Seq.T-2	4.51 nM	-8.346	intrinsic			33303143	kon = 3.2 × 10 5 M 1 s 1 , koff = 1.44 × 10 3 s 1 , Kd = 4.51 nM
Carcinoembryonic antigen	protein	P-ATG	4.62 nM	-8.335	intrinsic			35517255	The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively.
Hemagglutinin (HA) protein of AIV H5N1 (A/Vietnam/1203/04)	protein	Aptamer sequence (2)	4.65 nM	-8.333	intrinsic			23523887	the KD (dissociation constants) was 4.65 nM, indicating strong binding between the HA protein and the selected aptamer.
VEGF165	protein	VEap121	4.700000000000001e-09 M	-8.328	intrinsic	SPR	293.15	23237717	As the calculated K d value of VEap121 was 4.7 nM
Oxytetracycline	protein	OTC3	4.7 nM	-8.328	intrinsic			24011458	The lowest K d value (4.7 nM) was obtained with the aptamer OTC3.
SARS-CoV-2 spike RBD	protein	Aptx2-L	4.900000000000001e-09 M	-8.31	avidity_multivalent	flow_cytometry	298.15	41498844	The Aptx2-L variant showed superior affinity with a dissociation constant ( K d) of 4.9 nM
HFIXa	protein	Seq 11	4.93 nM	-8.307	intrinsic	ITC	298.15	38776649	Seq 11- \| 7.4 \| 0.983 \| 203 ± \| 4.93 \| 130.6 \| 279 \| 47.42
Myoglobin	protein	Myo40-7-27	4.93e-09 M	-8.307	intrinsic			24914856	The aptamer with the highest a ffi nity ( K d = 4.93 nM) was then used for the fabrication of a label-free supersandwich electrochemical biosensor for Myo detection
porcine thrombin	protein	RNAR9D-14T	5.0 nM	-8.301	non_intrinsic	filter_binding		22385910	RNAR9D-14T binds to porcine thrombin (apparent K d=5 nM)
human α-Thrombin	protein	B2	5.0 nM	-8.301	intrinsic			31129134	for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)
transferrin receptor 1	protein	JBA8.1	5.5 nM	-8.26	non_intrinsic	flow_cytometry		35875870	JBA8.1 has an apparent binding affinity (K D ) of 5.5 ± 1.2 nM
CD8a	protein	A8	5.59 nM	-8.253	intrinsic	BLI	298.15	31209354	the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively
sST2	protein	sS9_P	5.6 nM	-8.252	intrinsic			37992929	in case of sS9, parent aptamer has outperformed its truncated counterpart in terms of affinity as it has shown higher affinity (Kd ~5.6 nM).
RAGE	protein	RAGE-aptamer (clone #1)	5.68 nM	-8.246	intrinsic	QCM		28385802	#1RAGE-aptamer \| ccTgATATggTgTcAccgccgccTTAgTATTggTgTcTAc \| 5.68±1.10
HIV-1 Rev	protein	RBA-14	5.9 nM	-8.229	intrinsic			30017564	RBA-14 (Figure S2A) binds to Rev with high affinity (K d = 5.9 nM) (Table S1 and Figure 2A).
human α-thrombin	protein	Bock	5.96 nM	-8.225	intrinsic	BSI	283.15	22032342	Bock - thrombin \| 1.4 - 6.2 nM 19 \| 5.96 ( 0.57 nM
biliverdin	protein	Bvd4	6.000000000000001e-09 M	-8.222	intrinsic			40669049	For the biliverdin selection, the tightest affinity aptamer has a dissociation costant ( K d ) value of 6 nM determined using isothermal titration calorimetry (ITC)
Mouse thrombin	protein	Pse08-29	6.3 nM	-8.201	non_intrinsic	SPR		37621412	Pse(08 - 29) \| 6.72 10^5 \| 4.26 10^-3 \| 6.3
human α-Thrombin	protein	A2	6.3 nM	-8.201	intrinsic			31129134	for SCORE (b-nd analysis) the best are A2 (6.3 nM)
CD64	protein	lw-27	6.676 nM	-8.175	non_intrinsic	flow_cytometry	310.15	42152987	Kd values of aptamers lw-1, lw-9, lw-27 are 12.76 nM, 14.03 nM, and 6.676 nM respectively
Lipopolysaccharide from Klebsiella pneumoniae ATCC 15380	protein	aptamer seq. 5	6.68e-09 M	-8.175	intrinsic	DPV		41323700	The binding affinity of aptamer seq. 5 was 6.68 nM (Fig. 9C).
Mouse thrombin	protein	Lin08-08	6.7 nM	-8.174	non_intrinsic	SPR		37621412	Lin(08-08) \| 6.41 10^5 \| 4.30 10^-3 \| 6.7
human β-defensin 2	protein	A ad1	6.8 nM	-8.167	intrinsic			32067984	As a result, A ad1 was found to bind strongly, with a K d of 6.8 nM (Fig. 2).
transferrin receptor 1	protein	JBA8.26	6.87 nM	-8.163	intrinsic	BLI		35875870	Using BLI, JBA8.26 was found to bind immobilized TfR1 with a K D of 6.87 ± 0.04 nM
human α-Thrombin	protein	A3	6.9 nM	-8.161	intrinsic			31129134	for SCORE (b-nd analysis) the best are A2 (6.3 nM) and A3 (6.9 nM)
Carcinoembryonic antigen	protein	P	6.95 nM	-8.158	intrinsic			35517255	The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively.
Salmonella enteritidis	protein	SENT-9	7.000000000000001e-09 M	-8.155	apparent_cellular			22971146	It was observed that the aptamer pool collected at the seventh round of selection had the highest binding a ffi nity to the bacteria ( K D = 7 nM).
thrombin	protein	HD1	7.1e-09 M	-8.149	intrinsic	SPR		18826387	HD1 \| Thrombin \| K D ( M) \| 7.1 · 10 ) 9
PTK7	protein	4AsF	7.2 nM	-8.143	intrinsic	SPR	310.15	41065179	4AsF, which exhibited a 10-fold reduction compared to 4APS (0.77 vs 7.20 nM)
VEGF165	protein	cot-pega	7.33 nM	-8.135	intrinsic			26956592	The K D of cot-pega for VEGF was 7.33 nM (Fig. 1b)
Carcinoembryonic antigen	protein	P-GTG	7.33 nM	-8.135	intrinsic			35517255	The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively.
sLe X -BSA	glycan/conjugate	Clone 4	7.4e-09 M	-8.131	intrinsic	SPR		11178986	Clone 4 \| 4.1 3 10 5 \| 3.1 3 10 2 3 \| 1.3 3 10 8 \| 7.4 3 10 2 9
human α-Thrombin	protein	B3	7.6 nM	-8.119	intrinsic			31129134	for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)
Surface Antigen 1	protein	SOK16	7.6 nM	-8.119	intrinsic			40288708	SOK16 (7.6 nM, R 2 = 0.8704)
murine OX40	protein	9.8	8.0 nM	-8.097	intrinsic	filter_binding		18635004	Aptamer 9.8 was chosen for further study, since it had the highest affinity for the OX40 fusion protein.
Cu2+	protein	Co-1	8e-09 M	-8.097	intrinsic			40656531	The corresponding true K d values were ... 8 nM for Cu 2+
human α-Thrombin	protein	A3	8.0 nM	-8.097	intrinsic			31129134	For BLI it was found that aptamer A3 (8 nM and 25.5 nM) is the best binder
EsxG	protein	G43	8.04 nM	-8.095	intrinsic			24813997	The dissociation constants of the G43 and G78 aptamers were 8.04 ± 1.90 and 78.85 ± 9.40 nM, respectively.
NP	protein	NP-C04	8.1e-09 M	-8.092	intrinsic	fluorescence		30740973	the K d values of NP-D01, NP-C04, and NP-D02 were 76..1 ± 10.9, 8.1 ± 2.4, and 41.3 ± 9.5 nM, respectively.
digoxin	protein	D1	8.2e-09 M	-8.086	intrinsic			23021809	Binding studies of fluorescein-labeled truncated (without primer binding region) D1 and D2 and full length D1 anti-digoxin aptamers were performed and their corresponding dissociation constants values were 8.2 × 10 -9 , 44.0 × 10 -9 and 17.8 × 10 -9 M, respectively.
EN2	protein	EBA	8.26 nM	-8.083	intrinsic			35798816	EBA had K d = 8.26 nM (R 2 = 0.971)
human thrombin	protein	Azo-1	8.3 nM	-8.081	intrinsic			33039563	The K d values of Azo-1 binding to human thrombin were calculated to be around 3.1 and 8.3 nM before and after irradiation, respectively. However, the reproducibility of K d value measurements is poor (n = 3; S.D. = 2.2 and 5.1 nM, respectively).
human β-defensin 2	protein	A ad1-3	8.4 nM	-8.076	intrinsic			32067984	In contrast, a clone with a 5 ʹ terminal truncation (A ad1 -3 , 69mer, Fig. 4a) could bind to HBD-2 with roughly the same strength as the original sequence ( K d = 8.4 nM, Fig. 4c).
Okadaic Acid	protein	OA-LC2-TF	8.735 nM	-8.059	intrinsic	BLI		36322695	The terminal-fixed OA-LC2 (OA-LC2-TF) exhibited a K d of 8.735 ± 0.606 nM
MPO	protein	MPO-25	8778.0 pM	-8.057	non_intrinsic	flow_cytometry		37277648	MPO-25 ... K d : 8,778 pM
human α-thrombin	protein	5'-TMR-T25-Apt15	8.8 nM	-8.056	non_intrinsic	CE-LIF	298.15	28763192	The apparent K d values of T25-Apt15-3 ′ -TMR and 5 ′ -TMR-T25-Apt15 were estimated as 228 nM and 8.8 nM, respectively
MPT64	protein	aptamer sequence (17)	8.92 nM	-8.05	intrinsic			28454652	KD (dissociation equilibrium constant) was 8.92 nM
Streptococcus pyogenes M-type mixture	protein	20A24P	9.000000000000001e-09 M	-8.046	apparent_cellular	flow_cytometry		21504182	Two aptamers, 20A24P and 15A3P (with estimated binding dissociation constants of 9 and 10 nM, respectively)
TAR RNA	protein	TAR RNA aptamer (best binding)	9.000000000000001e-09 M	-8.046	intrinsic			39167715	A Biolayer Interferometry (BLI) experiment revealed that TAR RNA aptamers with the best binding affinity exhibited the dissociation constant ( K D) at 9 nM
HBeAg	protein	EAg2	9.2e-09 M	-8.036	intrinsic	affinity_real_time_qPCR		32250595	A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1, 9.2 nM for EAg2
human α-Thrombin	protein	B1	9.2 nM	-8.036	intrinsic			31129134	For SCORE (Anabel analysis) the best is B1 (9.2 nM)
CD19	protein	WB15/15.CD19.1_2S	9.5 nM	-8.022	non_intrinsic	flow_cytometry	310.15	41079126	WB15/15.CD19.1_2S \| 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| 2.64 \| 356 ± 534 \| 9.5 ± 5.0
HBeAg	protein	EAg1	9.5e-09 M	-8.022	intrinsic	affinity_real_time_qPCR		32250595	A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1
SP6 RNA polymerase	protein	S05	9.5 nM	-8.022	intrinsic			22426482	The dissociation constant and 50% inhibitory concentration of the aptamer were estimated 9.5 nM and 24.8 nM, respectively.
PDGFR β	protein	Gint4.T	9.6 nM	-8.018	intrinsic	filter_binding		24566984	This aptamer is able to specifically bind to the human PDGFR β ectodomain (Kd: 9.6 nM)
thrombin	protein	3G	9.8 nM	-8.009	intrinsic	MST		33614235	3G \| 52.9 \| 9.8 ± 0.6 \| 3.34
α-thrombin	protein	TBA-iT7	9.9 nM	-8.004	non_intrinsic	SPR	298.15	30735210	TBA-iT7 \| 9.9
sLe X -BSA	glycan/conjugate	Clone 9	1e-08 M	-8.0	intrinsic	SPR		11178986	Clone 9 \| 3.5 3 10 5 \| 3.1 3 10 2 3 \| 9.5 3 10 7 \| 1.0 3 10 2 8
prothrombin	protein	RNAR9D-14T	10.0 nM	-8.0	intrinsic	filter_binding	310.15	22385910	Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM)
hOX40	protein	11F11	10.0 nM	-8.0	intrinsic	filter_binding	310.15	23113766	11F11 \| 8 \| 10
Streptococcus pyogenes M-type mixture	protein	15A3P	1e-08 M	-8.0	apparent_cellular	flow_cytometry		21504182	Two aptamers, 20A24P and 15A3P (with estimated binding dissociation constants of 9 and 10 nM, respectively)
streptavidin	protein	S8	1e-08 M	-8.0	intrinsic			30520292	At pH 7.4, we determined that S8 has a K d of 10 nM
bevacizumab	protein	A14#1	10.0 nM	-8.0	intrinsic			35114463	One of the three mutants, A14#1_GC2, showed higher affinity than A14#1 ( K D = 10 nM, Supplementary Fig. S3a).
MPO	protein	MPO-08	10050.0 pM	-7.998	non_intrinsic	flow_cytometry		37277648	MPO-08 ... 10,050
Neuron specific enolase	protein	P-4A29C	10.13 nM	-7.994	intrinsic			38091739	The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively.
trastuzumab	protein	CH1S-3	1.0300000000000001e-08 M	-7.987	intrinsic	MST	298.15	32516525	a ffi nity with a K d value of aptamer CH1S-3 of 10.3 nM
Sc3+	protein	Sc-1	1.0300000000000001e-08 M	-7.987	intrinsic	fluorescence		39743479	an apparent K d value of 10.3 nM was obtained
CD8	protein	CD8AP17	10.59 nM	-7.975	non_intrinsic	flow_cytometry	277.15	23791505	Kd=10.59 nM
thrombin	protein	3Leu	10.9 nM	-7.963	intrinsic	MST		33614235	3Leu \| 54.3 \| 10.9 ± 0.2 \| 4.15
transferrin receptor 1	protein	tJBA8.1	10.9 nM	-7.963	non_intrinsic	flow_cytometry		35875870	versus that of 10.9 ± 2.4 nM for tJBA8.1
CD19	protein	WB15/15.CD19.1_1S	11.0 nM	-7.959	non_intrinsic	flow_cytometry	310.15	41079126	WB15/15.CD19.1_1S \| 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| 1.32 \| 125 ± 68 \| 11 ± 6.1
17 β -Estradiol	protein	22-mer aptamer	1.1000000000000001e-08 M	-7.959	intrinsic			25803717	new 35-mer and 22-mer aptamers were generated with K D ' s of 14 and 11 nM
PLN 1-32	protein	RNA-Apt30	11.0 nM	-7.959	intrinsic			25240642	Such binding was dependent on the concentration of aptamer, with a dissociation constant ( K d) of 11 nM (Fig. 2A).
25-HydroxyvitaminD3	protein	VDBA14	11.0 nM	-7.959	intrinsic			27520502	the dissociation constants (Kd) of the VDBA14 was estimated to be 11 nM based on a non-linear regression method.
β-conglutin	protein	unmodified β-CBA II aptamer	11.1 nM	-7.955	intrinsic			36354481	with a similar KD of 11.1 nM and 18.5 nM obtained for the unmodified and modified aptamer, respectively.
CD8	protein	CD8AP17	11.23 nM	-7.95	non_intrinsic	flow_cytometry	277.15	23791505	The binding affinity of CD8AP17 to Sup-T1 cells ( K d 5 11.23 nM)
MPO	protein	MPO-06	11223.0 pM	-7.95	non_intrinsic	flow_cytometry		37277648	MPO-06 ... 11,223
thrombin-HRP	protein	TBA	1.13e-08 M	-7.947	intrinsic	SPR		16053288	thrombin-HRP \| 6.7 10 4 \| 7.6 10 - 4 \| 8.7 10 7 \| 1.13 10 - 8
Immunoglobulin E	protein	IgE37-T10-FAM (4-bp truncated)	11.4 nM	-7.943	intrinsic			32498825	When 4-base pairs and 5-base pairs were truncated from the stem, the K ds of the aptamers increased to 11.4 nM and 90.5 nM, respectively.
α-thrombin	protein	TBA-iT9	11.5 nM	-7.939	non_intrinsic	SPR	298.15	30735210	TBA-iT9 \| 11.5
Thyroid-Stimulating Hormone Receptor (TSHR) 6X His tag	protein	ZMXLY-2a	11.5 nM	-7.939	non_intrinsic	flow_cytometry		40588369	As determined by flow cytometry, the K d of ZMXLY-2a was 11.5 ± 9.3 nM (Figure 2G)
thrombin	protein	3L	11.6 nM	-7.936	intrinsic	MST		33614235	3L \| 51.5 \| 11.6 ± 0.5 \| 5.28
CTLA-4	protein	aptCTLA-4	11.84 nM	-7.927	intrinsic			28918052	dissociation constant (Kd) being 11.84 nM
Salmonella typhimurium	protein	NTri-triApt	1.1890000000000001e-08 M	-7.925	avidity_multivalent	ELISA	310.15	37893744	the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively
LPS	protein	NH2-5'-CTT CTG CCC GCC TCC TTC CTAG CCG GAT CGC GCT GGC CAG ATG ATA TAA AGG GTC AGC CCC CCA -GGA GAC GAG ATA GGC GGA CAC T-3'	11.9 nM	-7.924	intrinsic			22182428	Amine-terminated aptamer exhibiting high affinity ( K d = 11.9 nM) to LPS
streptavidin	protein	SA23	12.0 nM	-7.921	intrinsic			23312325	The respective Kd values for streptavidin binding in the monofunctional aptamer ... were 12 nM
coat protein of grouper nervous necrosis virus	protein	A5	12.0 nM	-7.921	intrinsic			26892075	calculated binding affinities ( Kd ) of 12 nM for A5
bevacizumab	protein	A14#1	12.0 nM	-7.921	intrinsic			35114463	A14#1 showed binding capacity with K D = 12 nM.
thrombin	protein	Uyne A - AUyne	12.16 nM	-7.915	intrinsic	BLI		37531184	U yne A - AUyne \| 12.16 ± 0.02
U87MG GBM with IDH1 htz mutation	protein	Gli-55	1.22e-08 M	-7.914	apparent_cellular	flow_cytometry	298.15	39682297	The apparent dissociation constant measured for U87MG GBM with the IDH1 htz mutation ( Kd ) of Gli-55 is 12.2 nM
α-thrombin	protein	TBA-G8-iT8	12.4 nM	-7.907	non_intrinsic	SPR	298.15	30735210	TBA-G8-iT8 \| 12.4
RAGE	protein	RAGE-aptamer (clone #3)	12.44 nM	-7.905	intrinsic	QCM		28385802	#3RAGE-aptamer \| tTccAcTgAgTgccgcggAcTgTTgTTgggAggTggTgTg \| 12.44±1.52
CD64	protein	lw-1	12.76 nM	-7.894	non_intrinsic	flow_cytometry	310.15	42152987	Kd values of aptamers lw-1, lw-9, lw-27 are 12.76 nM, 14.03 nM, and 6.676 nM respectively
CD8	protein	CD8AP17s	12.86 nM	-7.891	non_intrinsic	flow_cytometry	277.15	23791505	Kd=12.86 nM
HIV-1 Rev	protein	Stem IIB	12.9 nM	-7.889	intrinsic			30017564	The 35-nt hairpin with the Stem IIB sequence (Figure S2B) binds to Rev with a similar affinity (K d = 12.9 nM) (Table S1 and Figure 2B).
human α-thrombin	protein	5'-TMR-Apt15-T18	13.0 nM	-7.886	non_intrinsic	CE-LIF	298.15	28763192	the apparent dissociation constants ( K d) of TMR-labeled Apt15 having polyT tail with length ranging from 18 to 35 T were estimated and are summarized in Figure 1C: 13 nM for 5 ′ -TMR-Apt15-T18
sST2	protein	sS9_P	13.0 nM	-7.886	intrinsic			37992929	The best performing aptamer candidate sS9_P (80mer) has shown affinity in low nanomolar range (~5.6 nM in ALISA and ~13 nM in ITC)
PlanarAu	protein	1N truncated	1.304e-08 M	-7.885	intrinsic	QCM		30189130	1N truncated (Kd = 13.04 nM)
Bisphenol A	protein	38-mer BPA aptamer	13.17 nM	-7.88	intrinsic			32113141	The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM
Staphylococcal enterotoxin A	protein	Apt5	13.36 nM	-7.874	intrinsic			38762575	The aptamer with the highest affinity showed an experimental dissociation constant (K D) of 13.36 ± 18.62 nM.
CD25	protein	Apt51	13.4 nM	-7.873	intrinsic			29055191	Using non-linear regression analysis, the Kd of Apt51 and Apt70 aptamers were found to be 13.4 nM and 138.6 nM, respectively
Staphylococcal enterotoxin D	protein	Aptamer 1	13.43 nM	-7.872	intrinsic			39894103	The KD of the aptamer for SED was determined using SPR and ELASA. The KD values were calculated as 4.4 ± 2.26 nM and 13.43 nM, respectively.
SARS-CoV-2 RBD	protein	CoV2-RBD-4	1.3600000000000001e-08 M	-7.866	intrinsic	flow_cytometry		32551560	the dissociation constant values ( K d) of the ... CoV2-RBD-4 aptamer ... were ... 13.6 nM
U87MG GBM with IDH1 htz mutation	protein	Gli-35	1.3600000000000001e-08 M	-7.866	apparent_cellular	flow_cytometry	298.15	39682297	while for Gli-35, it is 13.6 nM.
thrombin	protein	Uyne A - Uyne Uyne	13.96 nM	-7.855	intrinsic	BLI		37531184	U yne A - U yne U yne \| 13.96 ± 0.03
Le A	protein	Clone 5	1.4e-08 M	-7.854	intrinsic	SPR		11178986	Le A \| 7.3 3 10 2 \| 1.0 3 10 2 5 \| 7.2 3 10 7 \| 1.4 3 10 2 8
IL4Rα	protein	cl.42	14.0 nM	-7.854	intrinsic	FACS		22282665	The calculated K d (14 nM, Fig. 2D) was within the range of anti -IL4R a antibodies
CD20	protein	WB1/1.CD20.1_3S	14.0 nM	-7.854	non_intrinsic	flow_cytometry	310.15	41079126	WB1/1.CD20.1_3S \| 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' \| 3.96 \| 15 ± 7.4 \| 14 ± 8.3
17 β -Estradiol	protein	35-mer aptamer	1.4000000000000001e-08 M	-7.854	intrinsic			25803717	new 35-mer and 22-mer aptamers were generated with K D ' s of 14 and 11 nM
Oxytetracycline	protein	OTC16	14.0 nM	-7.854	intrinsic			24011458	The other 3 aptamers, that is, OTC6, OTC9, and OTC16, showed higher K d values, that is, 9.5, 8.0, and 14.0 nM, respectively
CD64	protein	lw-9	14.03 nM	-7.853	non_intrinsic	flow_cytometry	310.15	42152987	Kd values of aptamers lw-1, lw-9, lw-27 are 12.76 nM, 14.03 nM, and 6.676 nM respectively
enrofloxacin	protein	Apt58	14.19 nM	-7.848	intrinsic			29574118	The obtained Kd of Apt58 and Apt6, with non-linear regression analysis, were 14.19 nM and 50.77 nM, respectively.
Escherichia coli O157:H7	protein	E. coli O157:H7-specific aptamer	1.4400000000000002e-08 M	-7.842	apparent_cellular	fluorescence	298.15	41850902	the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM).
thrombin	protein	3Ser	14.6 nM	-7.836	intrinsic	MST		33614235	3Ser \| 51.7 \| 14.6 ± 0.3 \| 2.51
CD8a	protein	A3	14.7 nM	-7.833	intrinsic	BLI	298.15	31209354	the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively
Neuron specific enolase	protein	P-4G10T	14.82 nM	-7.829	intrinsic			38091739	The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively.
human immunoglobulin E	protein	T40-AptIgE-3'-TMR	15.0 nM	-7.824	non_intrinsic	CE-LIF	298.15	28763192	The K d of T40-AptIgE-3 ′ -TMR was about 15 nM
CD20	protein	WB1/1.CD20.1_3S	15.0 nM	-7.824	non_intrinsic	flow_cytometry	277.15	41079126	WB1/1.CD20.1_3S \| 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' \| 3.96 \| 15 ± 7.4 \| 14 ± 8.3
thrombin	protein	TBA15-AnBtz	1.5000000000000002e-08 M	-7.824	intrinsic			37857354	apparent dissociation constant ( K d ) of 15 nM
XBP1	protein	R6 pool	15.0 nM	-7.824	intrinsic			26874109	dissociation equilibrium constant equal to 15 nM
hexahistidine peptide	protein	AptHis-1	15.0 nM	-7.824	intrinsic			32739349	the Kd was as low as 15 nM (Table S1)
hexahistidine peptide	protein	AptHis-2	15.0 nM	-7.824	intrinsic			32739349	the Kd was as low as 15 nM (Table S1)
hexahistidine peptide	protein	AptHis-3	15.0 nM	-7.824	intrinsic			32739349	the Kd was as low as 15 nM (Table S1)
THY1	protein	XA-A9	15.0 nM	-7.824	intrinsic			33242496	The equilibrium dissociation constants, Kd, were derived from these curves and are determined as XA-A9=15 nM
Dinophysistoxin	protein	DTX-SL1-TF	15.45 nM	-7.811	intrinsic	BLI		36322695	DTX-SL1-TF showed a K d of 15.45 ± 1.92 nM
human α-Thrombin	protein	B1	15.7 nM	-7.804	intrinsic			31129134	for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)
α-thrombin	protein	TBA-iT7	15.9 nM	-7.799	non_intrinsic	SPR	298.15	30735210	TBA-iT7 \| 15.9
N-acetyl-5-hydroxytryptamine	protein	MLT-A-4F	0.016 μM	-7.796	intrinsic			36925277	for NAT very low K d value was observed i.e., 0.016 μM
fibrin	protein	FA	16.6 nM	-7.78	non_intrinsic	microscale thermophoresis		33395250	Interestingly, it was determined that FA has a higher a ffi nity toward fi brin, with the K d of 16.6 nM
sLe A	glycan/conjugate	Clone 5	1.7e-08 M	-7.77	intrinsic	SPR		11178986	sLe A \| 1.2 3 10 3 \| 1.9 3 10 2 5 \| 5.9 3 10 7 \| 1.7 3 10 2 8
CD19	protein	WB17/17.CD19.1_3S	17.0 nM	-7.77	non_intrinsic	flow_cytometry	310.15	41079126	WB17/17.CD19.1_3S \| 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| 3.96 \| 18 ± 6.4 \| 17 ± 5.5
Progesterone	protein	P4G13	1.7e-08 M	-7.77	intrinsic			25486123	The dissociation constant of the best aptamer, designated as P4G13, was estimated to be 17 nM by electrochemical impedance spectroscopy (EIS) as well as fl uorometric assay.
VEGF-165	protein	bivalent construct for VEGF-165 (no linker)	1.7e-08 M	-7.77	avidity_multivalent			27043498	this bivalent construct had about 28-fold higher binding affinity ( K D = 17 nM)
human α-Thrombin	protein	A2	17.0 nM	-7.77	intrinsic			31129134	for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)
hnRNP A1	protein	AS1411	1.75e-08 M	-7.757	intrinsic	BLI		38784467	for AS1411, the K d value was 17.5 nM (Fig. 6B)
human α-Thrombin	protein	B3	17.6 nM	-7.754	intrinsic			31129134	for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)
GTX1/4	protein	GO18-T-d	17.7 nM	-7.752	intrinsic			26802576	we truncated GTX1/4 aptamer and obtained the aptamer core sequence with a higher K d of 17.7 nM.
digoxin	protein	D1	1.78e-08 M	-7.75	intrinsic			23021809	Truncated (without primer binding region) D1, truncated D2 and full length D1 were bound to digoxin-BSA with Kd value of 8.2 × 10 -9 , 44 × 10 -9 and 17.8 × 10 -9 M, respectively
CD19	protein	WB17/17.CD19.1_3S	18.0 nM	-7.745	non_intrinsic	flow_cytometry	277.15	41079126	WB17/17.CD19.1_3S \| 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| 3.96 \| 18 ± 6.4 \| 17 ± 5.5
CD8a	protein	A1	18.3 nM	-7.738	non_intrinsic	flow_cytometry		31209354	the A1, A3 and A8 aptamers have apparent K D values of 18.3 ± 4.6, 1.9 ± 0.8 and 2.4 ± 0.9 nM, respectively
β-conglutin	protein	biotinylated dUTPs aptamer	18.5 nM	-7.733	intrinsic			36354481	with a similar KD of 11.1 nM and 18.5 nM obtained for the unmodified and modified aptamer, respectively.
Escherichia coli O157:H7	protein	E. coli O157:H7-specific aptamer	1.92e-08 M	-7.717	apparent_cellular	fluorescence	298.15	41850902	the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM).
LDL-R	protein	RNV-L7	19.6 nM	-7.708	intrinsic			31841991	RNV-L7 aptamer showed speci fi c binding to its LDL-R target with a binding af fi nity value of 19.6 nM.
CD19	protein	WB17/17.CD19.1_4S	20.0 nM	-7.699	non_intrinsic	flow_cytometry	310.15	41079126	WB17/17.CD19.1_4S \| 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| 5.28 \| 21 ± 13 \| 20 ± 12
hMMP-9	protein	F3Bomf	2e-08 M	-7.699	intrinsic	SPR	296.15	23043415	The K d was taken as the concentration leading to half saturation, i.e., about 20 nM.
hMMP-9	protein	F3	2e-08 M	-7.699	intrinsic			23043415	exhibits a strong a ffi nity for hMMP-9 ( K d = 20 nM)
xanthylacrylamide	protein	XAA-1	2e-08 M	-7.699	intrinsic			40261307	The true K d of aptamer XAA-1 was calculated to be 20 nM after accounting for the competitive effect of the quencher-labeled strand
CD8a	protein	A1	20.1 nM	-7.697	intrinsic	BLI	298.15	31209354	the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively
thrombin	protein	TBA	20.2 nM	-7.695	intrinsic	MST		33614235	TBA \| 50.7 \| 20.2 ± 1.3 \| 4.81
thrombin	protein	12G	20.7 nM	-7.684	intrinsic	MST		33614235	12G \| 53.4 \| 20.7 ± 2.8 \| 2.88
hexahistidine peptide	protein	AptHis-C	20.8 nM	-7.682	intrinsic			32739349	its dissociation constant was as low as 20.8 nM
CD19	protein	WB17/17.CD19.1_4S	21.0 nM	-7.678	non_intrinsic	flow_cytometry	277.15	41079126	WB17/17.CD19.1_4S \| 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| 5.28 \| 21 ± 13 \| 20 ± 12
hnRNP A1	protein	TBA	2.1100000000000004e-08 M	-7.676	intrinsic	BLI		38784467	for TBA, the K d value was 21.1 nM (Fig. 6A)
saxitoxin	protein	45e	21.2 nM	-7.674	intrinsic			35324725	aptamer 45e with a K d value of 21.2 nM
thrombin	protein	3Ala	21.4 nM	-7.67	intrinsic	MST		33614235	3Ala \| 50.9 \| 21.4 ± 2.8 \| 3.67
SARS-CoV-2 spike RBD	protein	Aptx2-S	2.17e-08 M	-7.664	avidity_multivalent	flow_cytometry	298.15	41498844	compared to 21.7 nM for Aptx2-S
Dinophysistoxin	protein	DTX-SL1	21.75 nM	-7.663	intrinsic	BLI		36322695	DTX-SL1 showed the lowest K d at 21.75 ± 1.42 nM
CD117	protein	Apta02	21.8 nM	-7.662	intrinsic	BLI	298.15	40487293	Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 µ m, respectively ( Figure 2 a,b).
SARS-CoV-2 spike trimer	protein	S14	21.8 nM	-7.662	intrinsic			34188971	The aptamer S14 evinced 3-fold higher affinity (KD = 21.8 nM) then S1 (KD = 68.9 nM).
GTX1/4	protein	GO18-T-d	21.9 nM	-7.66	intrinsic			26802576	Therefore, we further removed inactive nucleotides from GO18-T-a and obtained the core aptamer sequence GO18-T-d with a K d of 21.9 nM
Mouse thrombin	protein	TBA29	22.0 nM	-7.658	intrinsic	SPR		37621412	TBA29 \| 2.76 10^5 \| 6.07 10^-3 \| 22.0
thrombin	protein	3Phe	22.6 nM	-7.646	intrinsic	MST		33614235	3Phe \| 54.3 \| 22.6 ± 4.8 \| 3.39
M2-like macrophage	protein	A2	22.81 nM	-7.642	non_intrinsic	flow_cytometry	277.15	32589412	apparent dissociation constants ( K d ) of 44.12 ± 8.0 and 22.81 ± 5.6 nM to M0- and M2-like macrophages, respectively
HBeAg	protein	A-9	2.29e-08 M	-7.64	intrinsic	affinity_real_time_qPCR		32250595	The measured dissociation constant ( K d) is improved by 19 times  from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.
prometryn	protein	P60-1	23.0 nM	-7.638	intrinsic			37453395	The Kd value of P60-1 aptamer for prometryn was approximately 23 nM
beta-conglutin	protein	11-mer	2.3300000000000003e-08 M	-7.633	intrinsic	BLI	303.15	33498970	A 2:1 heterogenous model was used to fit the data and calculate the binding affinities resulting in two different KD values of 6.95 and 23.30 nM.
Neuron specific enolase	protein	P	23.83 nM	-7.623	intrinsic			38091739	Each of them exhibited higher affinity to NSE than the parent aptamer ( K d = 23.83 nM).
Le X	protein	Clone 5	2.4e-08 M	-7.62	intrinsic	SPR		11178986	Le X \| 6.7 3 10 2 \| 1.6 3 10 2 5 \| 4.1 3 10 7 \| 2.4 3 10 2 8
CD19	protein	WB17.CD19	24.0 nM	-7.62	non_intrinsic	flow_cytometry	310.15	41079126	WB17.CD19 \| 5'-AGAGACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGTGGCTTCTT-3' \| - \| N.P. \| 24 ± 4.1
melamine	protein	Mel36-1	2.4000000000000003e-08 M	-7.62	non_intrinsic		298.15	42261635	Mel36-1 has the most sensitive response with an apparent K d of 24 nM
Cry j 2	protein	CJ2-06	24.0 nM	-7.62	intrinsic			25083924	Scatchard analysis based on ELONA showed that BioCJ206 exhibited a high af fi nity for Cry j 2 with a dissociation constant of 24 nM
prostate-cancer-derived small extracellular vesicles	cell/EV	seq25	24.02 nM	-7.619	non_intrinsic	SPR		41646885	The affinity of seq25 for positive selection was significantly higher than that of the other aptamers, with a KD of 24.02 nM
NMP22	protein	NT2a	2.4260000000000003e-08 M	-7.615	intrinsic	MST		42173503	The K d values were also determined using MicroScale Thermophoresis (MST), and the K d values of NT2a and NT4a were determined to be 24.26 ± 10.47 and 77.29 ± 25.78 nM (Figures 2d and S3).
MPO	protein	MPO-34	24910.0 pM	-7.604	non_intrinsic	flow_cytometry		37277648	MPO-34 ... K d : 24,910 pM
murine OX40	protein	11.2	25.0 nM	-7.602	intrinsic	filter_binding		18635004	11.2 \| AUACCAGGAUCACAUCCUGAGGAACCCCGGCUCCCAACCU \| 25 \| 4
murine OX40	protein	11.4	25.0 nM	-7.602	intrinsic	filter_binding		18635004	11.4 \| CUUUAAUCCUCGCACUCAGCGCGCAUCACCCUUGACAUCA \| 25 \| 5
murine OX40	protein	9.3	25.0 nM	-7.602	intrinsic	filter_binding		18635004	9.3 \| CAAACCAGCUAUUUCCUGAGGUACCCCGGCUCUCCAUGG \| 25 \| 4
CD20	protein	WB1/1.CD20.1_4S	25.0 nM	-7.602	non_intrinsic	flow_cytometry	277.15	41079126	WB1/1.CD20.1_4S \| 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' \| 5.28 \| 25 ± 12 \| 65 ± 38
CD19	protein	WB15/17.CD19.1_3S	25.0 nM	-7.602	non_intrinsic	flow_cytometry	310.15	41079126	WB15/17.CD19.1_3S \| 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| 3.96 \| N.P. \| 25 ± 7.1
Salmonella typhimurium	protein	STYP-3	2.5000000000000002e-08 M	-7.602	apparent_cellular			23075417	It was observed that the aptamer pool collected at the seventh round of selection had the highest binding a ffi nity to the bacteria ( K D = 25 nM).
S-adenosylmethionine	protein	Bs SAM-I riboswitch	2.5000000000000002e-08 M	-7.602	intrinsic			23343213	Both μ MSA values agree well with results from the in-line probing assays performed using identical buffer conditions: 25 nM K d
16mer peptide from collagen XI alpha 1 chain	protein	D1	25.0 nM	-7.602	intrinsic			34815029	The K d values were identical (about 25 nM)
16mer peptide from collagen XI alpha 1 chain	protein	C1	25.0 nM	-7.602	intrinsic			34815029	The K d values were identical (about 25 nM)
transferrin receptor 1	protein	tJBA8.1	25.11 nM	-7.6	intrinsic	BLI		35875870	tJBA8.1 bound the TfR1 protein with a K D value of 25.11 ± 0.19 nM
rmCD3 d ε	protein	CD3_Apt1 dimer	25.2 nM	-7.599	non_intrinsic	BLI	298.15	38745854	The affinity of the dimeric aptamer was determined by OCTET and was 25.2 nM for Apt1 dimer
Sterigmatocystin	protein	H Seq02	2.53e-08 M	-7.597	intrinsic	ITC		38175632	The final fitting curve showed a reduced chi-squared (kcal/mol) 2 of 0.871, and the K D value was 25.3 nM.
human α-Thrombin	protein	A3	25.5 nM	-7.593	intrinsic			31129134	For BLI it was found that aptamer A3 (8 nM and 25.5 nM) is the best binder
transferrin receptor 1	protein	tJBA8.1	25.6 nM	-7.592	non_intrinsic	flow_cytometry		35875870	compared to tJBA8.1's apparent K D of 25.6 ± 13.0 nM for these cells
Staphylococcal enterotoxin B	protein	A2	26.0 nM	-7.585	intrinsic			25624325	A2 and A11 both bound with high affinity to SEB, with dissociation constants of 26 nM and 64 nM, respectively
adenosine monophosphate	protein	AMP aptamer	26.0 nM	-7.585	intrinsic			35934372	BHQ-2-(NH2)2 binds DNA aptamer for AMP with KD = 26 nM.
human α-Thrombin	protein	A2	26.4 nM	-7.578	intrinsic			31129134	for iRIf aptamer A2 is the best (26.4 nM)
Bisphenol A	protein	12-mer BPA aptamer	27.05 nM	-7.568	intrinsic			32113141	The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM
thrombin	protein	3Nic	27.1 nM	-7.567	intrinsic	MST		33614235	3Nic \| 52.1 \| 27.1 ± 4.2 \| 3.69
thrombin	protein	12L	27.2 nM	-7.565	intrinsic	MST		33614235	12L \| 51.0 \| 27.2 ± 3.0 \| 4.17
α-thrombin	protein	TBA	27.2 nM	-7.565	non_intrinsic	SPR	298.15	30735210	TBA \| 27.2
MPO	protein	MPO-07	27751.0 pM	-7.557	non_intrinsic	flow_cytometry		37277648	MPO-07 ... 27,751
thrombin	protein	HD22 (TA-TT)	27.8 nM	-7.556	intrinsic	BLI		37531184	TA - TT \| 27.80 ± 0.09
FGFR3 K650E	protein	SU-3	2.82e-08 M	-7.55	intrinsic	SPR		31265241	The predicted K D was 28.2 × 10 -9 ± 19.6 × 10 -9 M( n = 5) in 1 × PBS bu ff er, using 1:1 Langmuir binding model.
CD71	protein	rvCD71apt	28.5 nM	-7.545	non_intrinsic	flow_cytometry	277.15	36149728	rvCD71apt binds at a high affinity to both activated CD4 + and CD8 + T cells, with apparent K D around 28.5 and 35 nM, respectively (Figure 4A,B).
hOX40	protein	9C7T	29.0 nM	-7.538	intrinsic	filter_binding	310.15	23113766	observed Kd of * 29nM
dT35	protein	DCC-SSB	2.9e-08 M	-7.538	intrinsic			34085169	The second stage was fitted to a hyperbola to give a K d value of 29 nM.
thrombin	protein	3Amide	29.2 nM	-7.535	intrinsic	MST		33614235	3Amide \| 52.6 \| 29.2 ± 0.4 \| 4.17
Thrombin	protein	aptamer 2S	2.9400000000000002e-08 M	-7.532	intrinsic	SPR		32268723	The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 μM and 29.4 nM, respectively
verrucarin A	protein	Ver1_JYP	2.9500000000000003e-08 M	-7.53	intrinsic	fluorescence		39404132	The novel ssDNA aptamer exhibited a binding affinity of 29.5 nM
thrombin	protein	3Bz	30.0 nM	-7.523	intrinsic	MST		33614235	3Bz \| 52.3 \| 30.0 ± 6.6 \| 4.54
L-TAR RNA	protein	D-6-4t	3.0000000000000004e-08 M	-7.523	intrinsic			23977945	The Kd of in vitro transcribed D-6-4t for L-TAR is 30 nM
Nucleolin (NCL)	protein	rG4-C8 (short loop)	30.0 nM	-7.523	intrinsic			31325486	The K D values for the binding interaction between the short loop (112) rG4 and its rG4-C8 complex with NCL were 309 ± 45 nM and 30 ± 22 nM, respectively.
thrombin	protein	12Amide	30.6 nM	-7.514	intrinsic	MST		33614235	12Amide \| 51.2 \| 30.6 ± 6.1 \| 3.97
Mycobacterium tuberculosis H37Rv	protein	NK2	31.0 nM	-7.509	non_intrinsic	flow_cytometry		21643749	\| NK2 \| 31 ± 4 \|
Ciprofloxacin	protein	R10K6	3.1e-08 M	-7.509	intrinsic			30609709	a dissociation constant (KD) for the RNA-ligand complex of 31 nM was determined.
Clenbuterol	protein	CLB-2	3.1e-08 M	-7.509	intrinsic			42204903	The ITC of the CLB2 aptamer showed a complex pattern with a fitted K d of 31 nM (Figure S4)
tetrodotoxin	protein	A36	32.4 nM	-7.489	intrinsic			40435760	Aptamer A36, which exhibited high binding affinity (32.4 nM) and stability ( Δ G = 2.58 kcal/mol), was identified as the optimal TTX aptamer.
PDGF-C	protein	α-PC	33.0 nM	-7.481	intrinsic	SPR		42138517	SPR analysis demonstrated that the α -PC aptamer bound tightly to mouse PDGF-C with a high affinity ( KD = 33 nM
Thrombin	protein	Antithrombin aptamer	3.3000000000000004e-08 M	-7.481	intrinsic			31580650	Antithrombin aptamer with KD of 33 nM was successfully isolated by four rounds of MCP-SELEX.
Alpha-fetoprotein	protein	Group I aptamer	33.0 nM	-7.481	intrinsic			22166203	The aptamer interacted with the AFP with a K D of 33 nM.
α-thrombin	protein	TBA-iT3	33.9 nM	-7.47	non_intrinsic	SPR	298.15	30735210	TBA-iT3 \| 33.9
Alpha-fetoprotein	protein	Group I aptamer	33.9 nM	-7.47	intrinsic			22166203	with a K D of 33.9 nM (group I RNA)
human α-Thrombin	protein	A3	34.6 nM	-7.461	intrinsic			31129134	For SCORE (Anabel analysis) the best is B1 (9.2 nM) and the poorest A3 (34.6 nM)
paramylon	protein	Par-15	3.49e-08 M	-7.457	intrinsic	fluorescence		31809034	The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 ± 2.61, 34.90 ± 5.83, 64.06 ± 6.72, 123.81 ± 13.41, and 249.52 ± 46.39 nM, respectively.
HNP 1-3	protein	6J	35.0 nM	-7.456	intrinsic	ELISA		38591344	Regression analysis (Figure 4a) yielded a K d value of 35 nM
Mycobacterium tuberculosis H37Rv	protein	NK7	35.0 nM	-7.456	non_intrinsic	flow_cytometry		21643749	\| NK7 \| 35 ± 9 \|
CD71	protein	rvCD71apt	35.0 nM	-7.456	non_intrinsic	flow_cytometry	277.15	36149728	rvCD71apt binds at a high affinity to both activated CD4 + and CD8 + T cells, with apparent K D around 28.5 and 35 nM, respectively (Figure 4A,B).
Progesterone	protein	PG13	35.0 nM	-7.456	intrinsic			28237255	The full length PG13 aptamer which showed the highest af fi nity (Kd 1⁄4 35 nM)
Enrofloxacin	protein	ENR-Apt 6	35.08 nM	-7.455	intrinsic			38540931	Figure 4A shows the non-linear fitting curve of ENR-Apt 6, with a Kd value of 35.08 nM.
CD71	protein	rvCD71apt	35.2 nM	-7.453	non_intrinsic	flow_cytometry	277.15	36149728	rvCD71apt binds to the same cell line with an apparent K D of around 35.2 nM (Figure 2B).
Zearalenone	protein	M1	35.83 nM	-7.446	intrinsic			38608399	resulting in a slightly higher Kd value of 35.83 nM
Ciprofloxacin	protein	R10K6_V11	3.6000000000000005e-08 M	-7.444	intrinsic			30609709	The determined dissociation constant of 36 nM for V11 is similar to the original full-length aptamer R10K6 (31 nM).
THY1	protein	XA-B216	36.0 nM	-7.444	intrinsic			33242496	The equilibrium dissociation constants, Kd, were derived from these curves and are determined as ... XA-B216=36 nM
Ara h1	protein	CB-APT1	3.63e-08 M	-7.44	avidity_multivalent	MST	298.15	40083221	Among them, CBAPT1 exhibited the strongest binding to Ara h1 with a K d value of 36.3 nM in aqueous solutions.
Human thrombin	protein	TBA29	36.9 nM	-7.433	intrinsic	SPR		37621412	TBA29 \| 1.34 10^5 \| 4.94 10^-3 \| 36.9
α-thrombin	protein	TBA-iT12	37.0 nM	-7.432	non_intrinsic	SPR	298.15	30735210	TBA-iT12 \| 37.0
Ni2+	protein	Co-1	3.7e-08 M	-7.432	intrinsic			40656531	The corresponding true K d values were ... 37 nM for Ni 2+
human α-Thrombin	protein	B1	37.0 nM	-7.432	intrinsic			31129134	and the poorest B1 (37 nM)
α-thrombin	protein	TBA-G8-iT8	37.1 nM	-7.431	non_intrinsic	SPR	298.15	30735210	TBA-G8-iT8 \| 37.1
ceftiofur	protein	Apt-9	37.68 nM	-7.424	intrinsic			40203705	Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were ... 37.68 nM
rmCD3 d ε -Fc	protein	CD3_Apt5	37.9 nM	-7.421	intrinsic	SPR	298.15	38745854	aptamer 5 was the strongest binder (37.9 nM)
Lipopolysaccharide	protein	B2	38.0 nM	-7.42	intrinsic			22370280	The SPR-based K d between the immobilized B2 and the LPS was found to be approximately 38 nM.
thrombin	protein	TA-AT	38.7 nM	-7.412	intrinsic	BLI		37531184	TA - AT \| 38.7 ± 0.5
methionyl-tRNA synthetase	protein	70mer pool	38.8 nM	-7.411	intrinsic			23399565	The dissociation constants of the selected 70 and 42mer pools to M. tuberculosis MRS were 38.8 and 51.3 nM, respectively.
thrombin	protein	LOOP	39.0 nM	-7.409	intrinsic	QCM		16725379	LOOP \| 3.27±1.22 \| 127±100 \| 0.026±0.018 \| 39±27
α-thrombin	protein	TBA-iT9	41.0 nM	-7.387	non_intrinsic	SPR	298.15	30735210	TBA-iT9 \| 41.0
K562	protein	aptamer-FAM	41.0 nM	-7.387	non_intrinsic			32307868	the K d value (3.2 nM) of PAM in binding the K562 cell is one order of magnitude lower than that of the aptamer alone (41 nM).
BTX-2	protein	BT10	42.0 nM	-7.377	intrinsic			25725463	Under these optimum conditions, we have again estimated the binding af fi nity of the BT10 aptamer and a K d value of 42 nM was obtained.
tobramycin	protein	Ap 4	42.12 nM	-7.376	intrinsic			30268963	The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively
CD71	protein	XQ 2d	42.34 nM	-7.373	non_intrinsic	flow_cytometry		40156524	aptamers (HG1-9, K d = 43.23 ± 4.62 nM and XQ-2d, K d = 42.34 ± 5.15 nM))
saxitoxin	protein	STX-G4-45	42.6 nM	-7.371	intrinsic			35324725	STX-G4-45 ( K d: 42.6 nM, Table S1)
α-thrombin	protein	TBA	42.7 nM	-7.37	non_intrinsic	SPR	298.15	30735210	TBA \| 42.7
Salmonella typhimurium	protein	NTri-biApt	4.3090000000000004e-08 M	-7.366	avidity_multivalent	ELISA	310.15	37893744	the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively
CD71	protein	HG1-9	43.23 nM	-7.364	non_intrinsic	flow_cytometry		40156524	aptamers (HG1-9, K d = 43.23 ± 4.62 nM and XQ-2d, K d = 42.34 ± 5.15 nM))
cefquinome	protein	Apt-9	43.3 nM	-7.364	intrinsic			40203705	Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were ... 43.30 nM
cefapirin	protein	Apt-9	43.68 nM	-7.36	intrinsic			40203705	Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were 43.68 nM
digoxin	protein	D2	4.4e-08 M	-7.357	intrinsic			23021809	Truncated (without primer binding region) D1, truncated D2 and full length D1 were bound to digoxin-BSA with Kd value of 8.2 × 10 -9 , 44 × 10 -9 and 17.8 × 10 -9 M, respectively
Total Phthalate Esters (TP)	protein	Truncated 24-mer aptamer	44.1 nM	-7.356	intrinsic			33524734	that of the truncated 24-mer aptamer was 44.1 nM
M0-like macrophage	protein	A2	44.12 nM	-7.355	non_intrinsic	flow_cytometry	277.15	32589412	apparent dissociation constants ( K d ) of 44.12 ± 8.0 and 22.81 ± 5.6 nM to M0- and M2-like macrophages, respectively
HBeAg	protein	EAg0	4.4200000000000005e-08 M	-7.355	intrinsic	affinity_real_time_qPCR		32250595	A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0
monocyte	protein	A2	45.0 nM	-7.347	non_intrinsic	flow_cytometry	277.15	32589412	aptamer A2 bound CD14 + cells (monocytes) with high speci fi city ( K d ∼ 45 ± 9.1 nM)
Oxytetracycline	protein	OTC5	4.5000000000000006e-08 M	-7.347	intrinsic			35777074	the binding was slightly enhanced when NaCl was decreased (Figure 3B, K d reached 45 nM when no NaCl was present)
Ara h1	protein	CB-APT1	4.5000000000000006e-08 M	-7.347	avidity_multivalent	MST	298.15	40083221	Notably, a similar binding affinity was observed even in a complex matrix that contained 80% w/w total peanut proteins ( K d = 45.0 nM, Figures 3 and S5).
α-thrombin	protein	TBA-iT12	46.8 nM	-7.33	non_intrinsic	SPR	298.15	30735210	TBA-iT12 \| 46.8
Zearalenone	protein	A2	47.1 nM	-7.327	intrinsic			38608399	The GO method showed that the Kd value for A2 was 47.1 nM
Human thrombin	protein	M08s	47.2 nM	-7.326	intrinsic	SPR		37621412	M08s \| 7.04 10^5 \| 3.33 10^-2 \| 47.2
ASPH	protein	AP-Cell 1	4.751e-08 M	-7.323	apparent_cellular	flow_cytometry		36959438	three proper oligomers, AP-Cell 1, AP-Cell 2, and AP-Cell 3 with reasonable dissociation constants ( K d ) of 47.51, 39.38, and 65.23 nM, respectively, were achieved.
sCD80	protein	CD80-16	47.69 nM	-7.322	intrinsic			37816286	CD80-4 and CD80-16 aptamers showed the lowest K d values of 200.5 nM and 47.69 nM, respectively
ODAM	protein	OD64	4.771e-08 M	-7.321	intrinsic	SPR		33455205	the obtained OD64 and OD35 (aptamer cognate pair) presented high a ffi nity and excellent speci fi city, along with dissociation constants ( K d ) of 47.71 nM (OD64)
tobramycin	protein	Ap 3	47.79 nM	-7.321	intrinsic			30268963	The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively
ODAM	protein	OD64	47.71 nM	-7.321	intrinsic			30396019	From this dose-dependency curves, the Kd values of OD64 and OD35, estimated by adopting non-linear regression analysis, were 47.71 nM and 51.36 nM, for OD64 and OD35, respectively.
Mycobacterium tuberculosis H37Rv	protein	NK1	48.0 nM	-7.319	non_intrinsic	flow_cytometry		21643749	\| NK1 \| 48 ± 13 \|
CD71	protein	ATL	48.17 nM	-7.317	non_intrinsic	flow_cytometry	277.15	41412185	K(pH 6.5) = 48.17 ± 2.70 nM
Immunoglobulin E	protein	IgE37-T10-FAM (no MgCl2)	49.0 nM	-7.31	intrinsic			32498825	Without MgCl2 in the binding buffer, the K d of IgE37-T10-FAM increased to 49 nM
SEC1	protein	C36.2	49.43 nM	-7.306	intrinsic			25053102	The Kd values are 49.43 ± 11.76, 65.14 ± 11.64 and 154.9 ± 45.67 nM, respectively.
lysozyme	protein	lysozyme-binding aptamer	49.5 nM	-7.305	intrinsic			21616496	average ligand-site dissociation constant ( k d ) of 49.5 nM ± 8.3 nM
murine OX40	protein	11.8	50.0 nM	-7.301	intrinsic	filter_binding		18635004	11.8 \| AUACCAGCGAAUAACUCGCUGAGGAACCCGACUCACAAA \| 50 \| 1
human immunoglobulin E	protein	AptIgE-3'-TMR	50.0 nM	-7.301	non_intrinsic	CE-LIF	298.15	28763192	The apparent K d of AptIgE-3 ′ -TMR was about 50 nM
CD20	protein	WB1/1.CD20.1_2S	50.0 nM	-7.301	non_intrinsic	flow_cytometry	310.15	41079126	WB1/1.CD20.1_2S \| 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' \| 2.64 \| 53 ± 40 \| 50 ± 2.3
CD19	protein	WB15.CD19	50.0 nM	-7.301	non_intrinsic	flow_cytometry	310.15	41079126	WB15.CD19 \| 5'-AGAGACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGTGGCTTCTT-3' \| - \| N.P. \| 50 ± 9.1
HAP 1b	protein	Aptamer 21	5.0000000000000004e-08 M	-7.301	intrinsic			21899290	A high-affinity RNA aptamer (K d = 50 nM) was efficiently identified by SELEX against a heteroaryl dihydropyrimidine structure
Ochratoxin A	protein	OBA36	5.0000000000000004e-08 M	-7.301	intrinsic			35442665	OBA36 binds OTA with a dissociation constant ( K d) down to ∼ 50 nM
human prothrombin	protein	thrombin aptamer	50.0 nM	-7.301	intrinsic			21700444	the thrombin aptamer does bind prothrombin but with a lower KD (50 nM versus 2 nM for thrombin)
17 β -estradiol	protein	E2 aptamer	50.0 nM	-7.301	intrinsic			24594593	Kd was determined to be 50 nM.
HSV-1 gD	protein	DApt	50.0 nM	-7.301	intrinsic			29246315	Our 45-nt-long DNA aptamer showed high af fi nity for HSV-1 gD (binding af fi nity constant [Kd] = 50 nM)
enrofloxacin	protein	Apt6	50.77 nM	-7.294	intrinsic			29574118	The obtained Kd of Apt58 and Apt6, with non-linear regression analysis, were 14.19 nM and 50.77 nM, respectively.
thrombin	protein	12Ala	51.0 nM	-7.292	intrinsic	MST		33614235	12Ala \| 51.7 \| 51.0 ± 3.8 \| 2.74
kanamycin	protein	KAN8-1	5.1e-08 M	-7.292	intrinsic			41914599	Its top sequence, named KAN8 -1, shows a K d of 51 nM at pH 7.5 for kanamycin as measured by isothermal titration calorimetry
adenosine monophosphate	protein	AMP aptamer	51.0 nM	-7.292	intrinsic			35934372	KD of BHQ-2-(NH2)2-AMP aptamer complex was 51 nM
methionyl-tRNA synthetase	protein	42mer pool	51.3 nM	-7.29	intrinsic			23399565	The dissociation constants of the selected 70 and 42mer pools to M. tuberculosis MRS were 38.8 and 51.3 nM, respectively.
Zearalenone	protein	M2	51.31 nM	-7.29	intrinsic			38608399	However, the fluorescence-measured Kd value was 51.31 nM
ODAM	protein	OD35	5.1360000000000005e-08 M	-7.289	intrinsic	SPR		33455205	the obtained OD64 and OD35 (aptamer cognate pair) presented high a ffi nity and excellent speci fi city, along with dissociation constants ( K d ) of 47.71 nM (OD64) and 51.36 nM (OD35).
ODAM	protein	OD35	51.36 nM	-7.289	intrinsic			30396019	From this dose-dependency curves, the Kd values of OD64 and OD35, estimated by adopting non-linear regression analysis, were 47.71 nM and 51.36 nM, for OD64 and OD35, respectively.
human α-Thrombin	protein	A1	52.0 nM	-7.284	intrinsic			31129134	Also for aptamer A1 we measured with MST KD values in the pico- and nanomolar range (2 pM and 52 nM).
tobramycin	protein	Ap 1	52.37 nM	-7.281	intrinsic			30268963	Compared with Ap 1 (Kd =52.37nM), the a ffi nity of the aptamer maintains and slightly increases with the removing of the redundant sequence.
CD20	protein	WB1/1.CD20.1_2S	53.0 nM	-7.276	non_intrinsic	flow_cytometry	277.15	41079126	WB1/1.CD20.1_2S \| 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' \| 2.64 \| 53 ± 40 \| 50 ± 2.3
BHQ-2-(NH(NH)NH2)2	protein	AMP aptamer	53.0 nM	-7.276	intrinsic			35934372	Incubation of the aptamer with AMP decreased KD down to 53 nM
CD8	protein	CD8AP17s-Stemloop2	53.04 nM	-7.275	non_intrinsic	flow_cytometry	277.15	23791505	Kd=53.04 nM
Aβ42 oligomer	protein	Aβ-Apt	5.33e-08 M	-7.273	intrinsic	SPR	298.15	35019631	suggesting that the binding a ffi nity of A β -Apt with A β 42 oligomer ( K d = 53.3 nM) was stronger than that of A β -Apt with A β 42 monomer.
Ochratoxin A	protein	OBA33	5.4e-08 M	-7.268	intrinsic			35442665	The binding a ffi nity of OBA33 is 54 nM for OTA
HSV-1 gD	protein	DApt	53.92 nM	-7.268	intrinsic			29246315	a nonlinear regression analysis of the determined values was plotted to give a speci fi c Kd of 53.92 nM (Figure 1C).
Thyroid-Stimulating Hormone Receptor (TSHR)	protein	TSHRly-1c	54.37 nM	-7.265	non_intrinsic	flow_cytometry		40588369	As shown in Figure 4E, the apparent equilibrium dissociation constant ( K d) of TSHRly-1c was determined to be 54.37 ± 8.22 nM.
tobramycin	protein	Ap 2	54.58 nM	-7.263	intrinsic			30268963	The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively
Mycobacterium tuberculosis H37Rv	protein	NK20	55.0 nM	-7.26	non_intrinsic	flow_cytometry		21643749	\| NK20 \| 55 ± 16 \|
CD19	protein	WB17/17.CD19.1_1S	56.0 nM	-7.252	non_intrinsic	flow_cytometry	310.15	41079126	WB17/17.CD19.1_1S \| 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| 1.32 \| 530 ± 1278 \| 56 ± 49
Surface Antigen 1	protein	SOK11	56.66 nM	-7.247	intrinsic			40288708	SOK11 (56.66 nM, R 2 = 0.8128)
ofloxacin	protein	Q1	56.9 nM	-7.245	intrinsic			26547431	Aptamer Q1 was found to have an af fi nity constant of K D 1⁄4 56.9 nM ( 7 11.3)
α-thrombin	protein	TBA-iT3	57.3 nM	-7.242	non_intrinsic	SPR	298.15	30735210	TBA-iT3 \| 57.3
Salmonella typhimurium	protein	NTri-monoApt	5.7320000000000006e-08 M	-7.242	apparent_cellular	ELISA	310.15	37893744	the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively
PTK7	protein	Sgc8c-Si6	5.7230000000000004e-08 M	-7.242	apparent_cellular	flow_cytometry	277.15	40415219	Sgc8c-Si6 maintained strong binding affinity ( K d = 57.23 nM)
CD63	protein	CD63 Aptamer	5.8e-08 M	-7.237	intrinsic	SPR		26500145	The equilibrium constant of the aptamer immobilized via 3 0 end was found to be KD = 5.8 -10 8 M.
t-Bu Hoechst dye	protein	Aptamer II	58.2 nM	-7.235	intrinsic			38613867	The Aptamer II sequence has a fluorescence-determined KD of 58.2 nM (Table 2)
CD20	protein	WB1.CD20.1	59.0 nM	-7.229	non_intrinsic	flow_cytometry	310.15	41079126	WB1.CD20.1 \| 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' \| - \| N.P. \| 59 ± 19
Rat beta-crosslaps	protein	BC2	59.0 nM	-7.229	intrinsic			33379043	The BC1 and BC2 aptamers show high affinity in the nanomolar range, 69 and 59 nM, respectively
Rat osteocalcin	protein	OC2	59.0 nM	-7.229	intrinsic			33379043	The high-affinity aptamers of OC and BC showed the Kd values of 59 and 55 nM respectively.
melamine	protein	Mel36-1	6.000000000000001e-08 M	-7.222	intrinsic			42261635	The highest affinity aptamers exhibited a dissociation constant ( K d) of ∼ 60 nM
adenosine monophosphate	protein	AMP aptamer	60.0 nM	-7.222	intrinsic			35934372	KD in saturated AMP concentration (500 μ M) was 60 nM
prothrombin	protein	ARC-183	60.7 nM	-7.217	intrinsic	SPR	298.15	22385910	Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM and ARC-183 = 60.7 nM)
prothrombin	protein	HD1-22	6.1e-08 M	-7.215	intrinsic	SPR		18826387	HD1-22 \| Prothrombin \| K D ( M) \| 6.1 · 10 ) 8
Tau	protein	Apt	62.5 nM	-7.204	intrinsic	SPR	298.15	41034513	Surface plasmon resonance (SPR) assay revealed that Apt could specifically bind to Tau proteins with high affinity (dissociation constant = 62.5 ± 1.1 nM)
Pb2+	protein	TBA-4PI[T3]	6.300000000000001e-08 M	-7.201	intrinsic		298.15	34543022	a titration of Pb(NO3)2 to 1 μ M TBA-4PI[T3] provided an apparent dissociate constant ( K d) of 63 nM
Aβ42 monomer	protein	Aβ-Apt	6.34e-08 M	-7.198	intrinsic	SPR	298.15	35019631	It was evaluated that A β -Apt showed the ability to bind A β 42 with a K d of 63.4 nM.
SipA	protein	Apt17	63.4 nM	-7.198	intrinsic			31953175	Apt17 displayed Kd values of 114.9 and 63.4 nM at 27 °C and 37 °C, respectively
Staphylococcal enterotoxin B	protein	A11	64.0 nM	-7.194	intrinsic			25624325	A2 and A11 both bound with high affinity to SEB, with dissociation constants of 26 nM and 64 nM, respectively
paramylon	protein	Par-18	6.406e-08 M	-7.193	intrinsic	fluorescence		31809034	The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 ± 2.61, 34.90 ± 5.83, 64.06 ± 6.72, 123.81 ± 13.41, and 249.52 ± 46.39 nM, respectively.
CD20	protein	WB1/1.CD20.1_4S	65.0 nM	-7.187	non_intrinsic	flow_cytometry	310.15	41079126	WB1/1.CD20.1_4S \| 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' \| 5.28 \| 25 ± 12 \| 65 ± 38
ASPH	protein	AP-Cell 3	6.523000000000001e-08 M	-7.186	apparent_cellular	flow_cytometry		36959438	three proper oligomers, AP-Cell 1, AP-Cell 2, and AP-Cell 3 with reasonable dissociation constants ( K d ) of 47.51, 39.38, and 65.23 nM, respectively, were achieved.
Total Phthalate Esters (TP)	protein	Parental 39-mer aptamer	65.7 nM	-7.182	intrinsic			33524734	Compared with the Kd (TP) of 65.7 nM for the parental 39-mer aptamer
prothrombin	protein	HD1-22	6.7e-08 M	-7.174	non_intrinsic	SPR		18826387	HD1-22 \| Prothrombin+ phospholipids \| K D ( M) \| 6.7 · 10 ) 8
thrombin	protein	12Trp	67.3 nM	-7.172	intrinsic	MST		33614235	12Trp \| 54.7 \| 67.3 ± 12.1 \| 3.12
SARS-CoV-2 spike trimer	protein	S1	68.9 nM	-7.162	intrinsic			34188971	The aptamer S14 evinced 3-fold higher affinity (KD = 21.8 nM) then S1 (KD = 68.9 nM).
Rat beta-crosslaps	protein	BC1	69.0 nM	-7.161	intrinsic			33379043	The BC1 and BC2 aptamers show high affinity in the nanomolar range, 69 and 59 nM, respectively
chlorpromazine	protein	CHL-3	69.8 nM	-7.156	intrinsic			36049339	The Kd value of CHL-3 is 69.8 nM.
RA-FLSs	protein	SAPT8	71.2 nM	-7.148	non_intrinsic	flow_cytometry	310.15	39237134	The equilibrium dissociation constants (Kd) of SAPT4 and SAPT8 with RA-FLSs were 101.7 ± 29.6 and 71.2 ± 15.0 nM, respectively ( fi gure 1H).
thrombin	protein	12Leu	72.2 nM	-7.141	intrinsic	MST		33614235	12Leu \| 53.6 \| 72.2 ± 0.9 \| 4.14
Nampt	protein	no. 19	72.52 nM	-7.14	intrinsic			22704839	dissociation constant ( Kd ) was calculated to be 72.52 nM for the no. 19 aptamer
SCAF4	protein	PTf-SRiApt	0.073 µM	-7.137	intrinsic	fluorescence		40574704	0.073 ± 0.003 µ m for PTf -SRiApt
CD20	protein	WB1-CD20	73.0 nM	-7.137	non_intrinsic	flow_cytometry	298.15	35829681	The apparent affinities of WB1-CD20 and WB2-CD20 were calculated as 73 nM and 163 nM at 25°C, respectively
Fok I	protein	F6#71	74.0 nM	-7.131	intrinsic			27899266	dissociation constants of F6#8 and #71 were 82 nM and 74 nM, respectively
HFIXa	protein	Seq 5	74.07 nM	-7.13	intrinsic	ITC	298.15	38776649	Seq 5- \| 7.4 \| 0.921 \| 13.5 \| 74.07 \| 209.1 \| 565 \| 40.43
alkaline phosphatase	protein	ALP binding aptamer	7.49e-08 M	-7.126	intrinsic	PISA		30827094	From the response -dose curve (Figure 3A), the dissociation constant ( K d ) for aptamermodi fi ed array was estimated by the logistic function fi tting to be 7.49 × 10 -8 M
neomycin-B	protein	NEO7A	75.0 nM	-7.125	intrinsic			23535583	NEO7A bound neomycin-B with a Kd of 75 nM in buffer A
gonyautoxin 1/4	protein	GO18-T-d	75.63 nM	-7.121	intrinsic			33294137	Corresponding Kd values of GO18-T-d and tGO18-T-d, determined by the average of 8 independent measurements, were 75.63 nM and 3.60 nM, respectively.
Co2+	protein	Co-1	7.6e-08 M	-7.119	intrinsic			40656531	The corresponding true K d values were ... 76 nM for Co 2+
PAUF	protein	P12FR2	77.0 nM	-7.114	intrinsic			21963224	the equilibrium dissociation constant calculated from the relation of KD = kd / ka was 77 nM
prothrombin	protein	HD1	7.8e-08 M	-7.108	intrinsic	SPR		18826387	HD1 \| Prothrombin \| K D ( M) \| 7.8 · 10 ) 8
hemagglutinin (HA) protein of H1N1 influenza virus (A/Puerto Rico/8/1934)	protein	aptamer 1	78.0 nM	-7.108	intrinsic	fluorescence	310.15	26904922	As it showed a higher binding affinity for HA protein (Kd = 78 -1nM), aptamer 1 was tested
kanamycin	protein	Ky2	78.8 nM	-7.103	intrinsic			21530479	The dissociation constants ( K d [kanamycin] = 78.8 nM
kanamycin	protein	Ky2	78.8 nM	-7.103	intrinsic			28259207	The dissociation constants (Kd [kanamycin] = 78.8 nM
Plasmodium falciparum glutamate dehydrogenase	protein	NG3	79.0 nM	-7.102	intrinsic			29909195	A thiolated ssDNA aptamer (NG3) that binds speci fi cally to Pf GDH antigen with high a ffi nity (K d= 79 nM) was used to develop the aptasensor.
BCMA	protein	apt69.T	79.4 nM	-7.1	non_intrinsic	qRT-PCR	310.15	31778956	with an apparent dissociation constant (KD = 79.4 nM) (Figure 2C)
lysozyme	protein	lysozyme-binding aptamer	80.0 nM	-7.097	intrinsic			21616496	average dissociation constant ( k d ) was 80.0nM ± 14nM
MUP13	protein	Apt-1.4	80.0 nM	-7.097	intrinsic			35026634	The equilibrium dissociation constants ( KD ) were 180 ± 80 nM for Apt-2.5 and 80 ± 44 nM for Apt-1.4.
CD19	protein	WB17.CD19.1	81.0 nM	-7.092	non_intrinsic	flow_cytometry	310.15	41079126	WB17.CD19.1 \| 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| - \| N.P. \| 81 ± 16
patulin	protein	PAT C3	8.2e-08 M	-7.086	intrinsic	SPR		35546052	PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 × 10 -8 and 1.9 × 10 -7 M, respectively
Oxytetracycline	protein	OTC5	8.2e-08 M	-7.086	intrinsic			35777074	In a buffer containing 300 mM NaCl and 10 mM MgCl2, the fitted K d value was 82 nM (Figure 3B, black trace)
Fok I	protein	F6#8	82.0 nM	-7.086	intrinsic			27899266	dissociation constants of F6#8 and #71 were 82 nM and 74 nM, respectively
CD20	protein	WB1/1.CD20.1_1S	83.0 nM	-7.081	non_intrinsic	flow_cytometry	277.15	41079126	WB1/1.CD20.1_1S \| 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' \| 1.32 \| 83 ± 58 \| inconclusive
Neuron specific enolase	protein	NSE-Apt5-5BioTEG	83.0 nM	-7.081	intrinsic			35495513	Through kinetic analysis, the binding rate constant and dissociation rate constant were determined to be 1.21 -10 4 Ms 1 and 1.004 -10 3 s 1 , respectively... Though this SPR analysis, the dissociation constant ( K d) was determined to be about 83 nM
Staphylococcal enterotoxin B	protein	PEGA11	83.5 nM	-7.078	intrinsic			25624325	PEGA11 had a dissociation constant of 83.5 nM in selection buffer
kanamycin B	protein	Ky2	84.5 nM	-7.073	intrinsic			21530479	K d [kanamycin B] = 84.5 nM
kanamycin B	protein	Ky2	84.5 nM	-7.073	intrinsic			28259207	Kd [kanamycin B] = 84.5 nM
kanamycin	protein	Kana2	85.6 nM	-7.068	intrinsic			21530479	The K d values of Kana2 and Ky2 as determined by fluorescence measurement were 85.6 and 78.8 nM, respectively
thrombin	protein	12Ser	86.6 nM	-7.062	intrinsic	MST		33614235	12Ser \| 52.0 \| 86.6 ± 4.5 \| 2.34
CD20	protein	WB1.CD20	87.0 nM	-7.06	non_intrinsic	flow_cytometry	310.15	41079126	WB1.CD20 \| 5'-AGAGACCCTGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTTGCTTCTTGGACACGGTGGCTTCTT-3' \| - \| N.P. \| 87 ± 24
Zearalenone	protein	Z100	87.22 nM	-7.059	intrinsic			38608399	Moreover, the Kd value of Z100 measured by the GO method was found to be 87.22 nM
thrombin	protein	APTA	88.0 nM	-7.056	intrinsic	QCM		16725379	APTA \| 0.97±0.45 \| 86±73 \| 0.011±0.006 \| 88±52
fibrinogen	protein	FA	89.6 nM	-7.048	intrinsic	microscale thermophoresis		33395250	The K d calculated for the fi brinogen target was 89.6 nM
HspX	protein	H63 SL-2 M6	9e-08 M	-7.046	intrinsic			30205966	H63 SL-2 M6 displayed a speci fi c and high a ffi nity interaction with HspX (Kd ∼ 9.0 × 10 -8 M).
Zearalenone	protein	A1	90.25 nM	-7.045	intrinsic			38608399	The Kd value was 90.25 nM as determined by the GO method
Immunoglobulin E	protein	IgE37-T10-FAM (5-bp truncated)	90.5 nM	-7.043	intrinsic			32498825	When 4-base pairs and 5-base pairs were truncated from the stem, the K ds of the aptamers increased to 11.4 nM and 90.5 nM, respectively.
N-acetylneuraminic acid	protein	Neu5Ac aptamer	91.0 nM	-7.041	intrinsic	ITC	310.15	37217750	To validate ARPLA, we first determined the binding affinity ( K d ) of the Neu5Ac aptamer by isothermal titration calorimetry (ITC) as 91 nM (Extended Data Fig. 2a,b)
mouse IL-2	protein	M20	91.0 nM	-7.041	intrinsic			35756119	The results indicated that the af fi nity of the M20 aptamer was greater than the M15, and its predicted Kd was 91 nM
Okadaic Acid	protein	OA-LC2	91.13 nM	-7.04	intrinsic	BLI		36322695	OA-LC2 exhibited K d of 91.13 ± 4.64 nM
rmCD3 d ε -Fc	protein	CD3_Apt1	91.3 nM	-7.04	intrinsic	SPR	298.15	38745854	aptamer 1 (91.3 nM)
6'-sialyllactose	protein	Apt9-1	9.175000000000001e-08 M	-7.037	intrinsic	fluorescence	298.15	36700646	A 35 nt truncated aptamer Apt9-1 ( K d = 91.75 nM) with higher affinity than Apt9 was finally obtained.
BHQ-2-(NH(NH)NH2)2	protein	AMP aptamer	92.0 nM	-7.036	intrinsic			35934372	BHQ-2-(NH(NH)NH2)2 had lower affinity to the aptamer in the low salt buffer. KD was 92 nM
17 β -estradiol	protein	HEV1	9.276e-08 M	-7.033	intrinsic	MST		38276613	the dissociation constant (KD value) is 92.76 ± 66.02 nM as calculated by the calculation function that comes with the system.
Mycobacterium tuberculosis H37Rv	protein	NK10	95.0 nM	-7.022	non_intrinsic	flow_cytometry		21643749	\| NK10 \| 95 ± 28 \|
Gymnodimine-A	protein	G48nop	95.3 nM	-7.021	intrinsic			35324692	The resulting K D value of G48nop (95.30 nM) was about one third of that of G48 (288 nM)
EpCAM	protein	SYL3C	9.700000000000001e-08 M	-7.013	apparent_cellular			36856721	SYL3C can bind to SW480 cells (EpCAM+) with a K d of 97 nM
thrombin	protein	TBA15	97.0 nM	-7.013	intrinsic			23850569	A K D value of 97 nM 1 nM was determined for the TBA/Thr complex in the MST assay
Oxytetracycline	protein	OTC5	9.8e-08 M	-7.009	intrinsic			35777074	we fitted the peak fluorescence to obtain a K d of 98 nM (Figure 4B)
neomycin	protein	NAN-NEO	98.101 nM	-7.008	intrinsic			22321384	Using the LineweaverBurk equation (Equation 1), we calculated the dissociation constant (Kd) to be 98.101 nM (Figure 5, B ).
thrombin	protein	12Phe	99.1 nM	-7.004	intrinsic	MST		33614235	12Phe \| 54.3 \| 99.1 ± 6.3 \| 4.07
BSA	glycan/conjugate	Clone 5	1e-07 M	-7.0	intrinsic	SPR		11178986	BSA \| 2.2 3 10 4 \| 2.3 3 10 2 3 \| 9.9 3 10 6 \| 1.0 3 10 2 7
human α-thrombin	protein	Apt15	100.0 nM	-7.0	non_intrinsic			28763192	One 15-mer DNA aptamer (5 ′ -GGT TGG TGT GGT TGG-3 ′ , denoted as Apt15 here) binds to the fi brinogen-binding site of human α -thrombin with a K d around 100 nM.
D-TAR RNA	protein	L-6-4t	1.0000000000000001e-07 M	-7.0	intrinsic			23977945	the K d of the L-aptamer for D-TAR RNA is 100 nM
Bisphenol A	protein	BPA-specific aptamer	1.0000000000000001e-07 M	-7.0	intrinsic			25329684	the K d value for free BPA binding to the BPA aptamer was determined experimentally using MST to be ∼ 100 nM
Thrombin	protein	TBA15	1e-07 M	-7.0	intrinsic			26643617	K d of free TBA15 (~1 × 10 -7 M)
human β-defensin 2	protein	U gu1	100.0 nM	-7.0	intrinsic			32067984	Besides, clone U gu1 bound somewhat poorly to HBD-2 ( K d = 100 nM, Fig. S2).
RA-FLSs	protein	SAPT4	101.7 nM	-6.993	non_intrinsic	flow_cytometry	310.15	39237134	The equilibrium dissociation constants (Kd) of SAPT4 and SAPT8 with RA-FLSs were 101.7 ± 29.6 and 71.2 ± 15.0 nM, respectively ( fi gure 1H).
CD9	protein	CD9-26	101.96 nM	-6.992	intrinsic	fluorescence	277.15	37585601	CD9-26 \| 5 ′ -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG TGC GCA CTA GAG CAG GTA CGG TGT CA-3 ′ \| - 8.92
human α-Thrombin	protein	A3	101.9 nM	-6.992	intrinsic			31129134	and as poorest binder aptamer A3 (101.9 nM).
tobramycin	protein	Ky2	103.0 nM	-6.987	intrinsic			21530479	and K d [tobramycin] = 103 nM)
tobramycin	protein	Ky2	103.0 nM	-6.987	intrinsic			28259207	and Kd [tobramycin] = 103nM
Okadaic Acid	protein	OA-SL2	103.4 nM	-6.985	intrinsic	BLI		36322695	from OA-SL1 to OASL2, K d was lowered from 340.5 ± 14.5 to 103.4 ± 7.0 nM
aflatoxin B2	protein	A50-T26-TMR	105.0 nM	-6.979	intrinsic			30086944	the K d for AFB2 was determined to be 105 nM in our study.
Mycobacterium tuberculosis H37Rv	protein	NK8	107.0 nM	-6.971	non_intrinsic	flow_cytometry		21643749	\| NK8 \| 107 ± 44 \|
luteolin	protein	LUT#28	107.0 nM	-6.971	intrinsic			29524380	The value of Kd for LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively.
luteolin	protein	LUT#3	109.0 nM	-6.963	intrinsic			29524380	The value of Kd for LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively.
domoic acid	protein	C1-d	1.09e-07 M	-6.963	intrinsic			36421085	Biolayer interferometry assay illustrated that C1-d possessed a K on (1/Ms) value of 2.94 × 10 5 , a K dis (1/s) value of 5.13 × 10 -2 , and a K D (M) value of 1.09 × 10 -7 M in the interaction with DA.
thrombin	protein	HD1	110.0 nM	-6.959	intrinsic	filter_binding		41053535	HD1 binds both thrombin (K D = 110 nm)
BHQ-2-(NH2)2	protein	off-target DNA hairpin	110.0 nM	-6.959	intrinsic			35934372	KD of the complex between BHQ-2-(NH2)2 and off-target DNA hairpin ... was twice higher, 110 nM
PA toxin	protein	Apt11	1.1200000000000001e-07 M	-6.951	intrinsic			20136122	The aptamer was developed in-house by capillary electrophoresis systematic evolution of ligands by exponential enrichment (CE-SELEX) and had a dissociation constant (K d ) of 112 nM.
polysialic acid	protein	Apt3	114.0 nM	-6.943	intrinsic			35151974	The K d value of candidate Apt3 is the lowest among all the tested candidate aptamer sequences, which is 114.0 nM
trisialic acid	protein	Apt3	114.0 nM	-6.943	intrinsic			40545079	aptamer Apt3 ( K d = 114.0 nM)
CD19	protein	WB15.CD19.1	117.0 nM	-6.932	non_intrinsic	flow_cytometry	310.15	41079126	WB15.CD19.1 \| 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| - \| N.P. \| 117 ± 28
human α-Thrombin	protein	A3	117.8 nM	-6.929	intrinsic			31129134	and the poorest binder is A3 (117.8 nM).
Moraxella osloensis	protein	MO9	1.1890000000000001e-07 M	-6.925	apparent_cellular	fluorescence		41784024	high-a ffi nity aptamer (K d = 118.9 nM)
SCAF4	protein	PT1/2-SRiApt	0.121 µM	-6.917	intrinsic	fluorescence		40574704	0.121 ± 0.054 µ m for PT1/2 -SRiApt
SIRT2	protein	Apt 45	1.233e-07 M	-6.909	intrinsic	fluorescence	310.15	40200675	selected Apt 45 ( K d = 123.3 nM) to fabricate the 'turn-on' fluorescent biosensor
CD19	protein	WB15/15.CD19.1_1S	125.0 nM	-6.903	non_intrinsic	flow_cytometry	277.15	41079126	WB15/15.CD19.1_1S \| 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| 1.32 \| 125 ± 68 \| 11 ± 6.1
Netilmicin	protein	APT-21	126.0 nM	-6.9	intrinsic			35752088	Intriguingly, the Kd value in the experiment (Fig. 4B) is 126.0 nM
thrombin	protein	A4	127.0 nM	-6.896	intrinsic			23850569	The K D value determined for A4 (127 nM 1.4 nM) was very close to that of TBA15
human α-Thrombin	protein	A1	129.8 nM	-6.887	intrinsic			31129134	for iRIf aptamer A2 is the best (26.4 nM) and aptamer A1 the poorest (129.8 nM)
sLe X -BSA	glycan/conjugate	Original pool	1.3e-07 M	-6.886	intrinsic	SPR		11178986	Original pool \| 2.6 3 10 4 \| 3.3 3 10 2 3 \| 7.6 3 10 6 \| 1.3 3 10 2 7
H-Thr	protein	Seq-1	136.0 nM	-6.866	intrinsic			31103164	The good af fi nity of Seq-1 (Fig. S2) with 136 nM and Apt-29 with 199 nM were obtained
saxitoxin	protein	75a	136.0 nM	-6.866	intrinsic			35324725	aptamer 75a with a K d value of 136 nM
CD25	protein	Apt70	138.6 nM	-6.858	intrinsic			29055191	Using non-linear regression analysis, the Kd of Apt51 and Apt70 aptamers were found to be 13.4 nM and 138.6 nM, respectively
guanine	protein	R10G2	1.4e-07 M	-6.854	intrinsic			38194356	In our R10G2 aptamer, a K d of 140 nM guanine was achieved
SW480 cells	cell/EV	SYL3C	142.5 nM	-6.846	non_intrinsic			32049531	monovalent SYL3C aptamer ( K d = 142.50 ± 20.55 nM, Figure 2A)
Oxytetracycline	protein	OTC5	1.47e-07 M	-6.833	intrinsic		298.15	35777074	a representative sequence named OTC5 had a dissociation constant of 147 nM measured by isothermal titration calorimetry.
AP65	protein	AP65_A1	1.48e-07 M	-6.83	intrinsic			29972299	The resulting K D was 148 nM
6'-sialyllactose	protein	Apt9	1.5230000000000003e-07 M	-6.817	intrinsic	fluorescence	298.15	36700646	The ssDNA aptamer Apt9 ( K d = 152.3 nM) with a length of 79 nucleotides (nt) was demonstrated as the optimal aptamer candidate
Surface Antigen 1	protein	SOK10	152.9 nM	-6.816	intrinsic			40288708	SOK10 (152.9 nM, R 2 = 0.7217)
CD19	protein	WB15-CD19	153.0 nM	-6.815	non_intrinsic	flow_cytometry	298.15	35829681	At 25 °C, WB15-CD19 showed an apparent affinity of 153 nM
progastrin-releasing peptide (31-98)	protein	ProGRP-48-5BioTEG	153.0 nM	-6.815	intrinsic			35495513	The dissociation constant ( K d) of ProGRP31-98 to aptamer was calculated to be 153 nM
D-TAR RNA	protein	L-6-4t	1.6e-07 M	-6.796	intrinsic			23977945	The L-6-4t aptamer has somewhat reduced affinity for D-TAR RNA under the low-salt conditions (K d = 160 nM)
Hen egg white lysozyme	protein	DNA analog a2	161.0 nM	-6.793	intrinsic			21167858	The aptamerlysozyme equilibrium dissociation constant of 161 ± 16nM agrees reasonably well with the Kd from fluorescence anisotropy (467 ± 140nM). The overall free energy and enthalpy changes are -9.32 ± 0.06kcal/mol and 2.2 ± 1.0 kcal/mol, respectively.
CD20	protein	WB2-CD20	163.0 nM	-6.788	non_intrinsic	flow_cytometry	298.15	35829681	The apparent affinities of WB1-CD20 and WB2-CD20 were calculated as 73 nM and 163 nM at 25°C, respectively
thrombin	protein	3NB	163.5 nM	-6.786	intrinsic	MST		33614235	3NB \| 51.7 \| 163.5 ± 3.5 \| 3.82
Phosphatidylserine	protein	PS-LC3-TF	166.2 nM	-6.779	intrinsic	BLI		36322695	The terminal-fixed PS-LC3-TF exhibited an even lower K d at 166.2 ± 10.7 nM
xanthylacrylamide	protein	XAA-1	1.6800000000000002e-07 M	-6.775	intrinsic			40261307	an apparent K d value of 168 nM was obtained
CD19	protein	WB15/17.CD19.1_2S	173.0 nM	-6.762	non_intrinsic	flow_cytometry	277.15	41079126	WB15/17.CD19.1_2S \| 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| 2.64 \| 173 ± 82 \| inconclusive
Tramadol hydrochloride	protein	Apt39	178.4 nM	-6.749	intrinsic			33965888	the Kd of Apt39 was measured to be 178.4 nM
CD19	protein	WB15/17.CD19.1_1S	183.0 nM	-6.738	non_intrinsic	flow_cytometry	277.15	41079126	WB15/17.CD19.1_1S \| 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| 1.32 \| 183 ± 140 \| inconclusive
CD19	protein	WB17-CD19	187.0 nM	-6.728	non_intrinsic	flow_cytometry	298.15	35829681	and WB17-CD19 showed an apparent affinity of 187 nM (Figure S12A-B).
patulin	protein	PAT C4	1.9e-07 M	-6.721	intrinsic	SPR		35546052	PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 × 10 -8 and 1.9 × 10 -7 M, respectively
Sc3+	protein	Sc-1	1.9200000000000003e-07 M	-6.717	intrinsic			39743479	obtained an apparent K d value of 192 nM
Netilmicin	protein	APT-21	194.1 nM	-6.712	intrinsic			35752088	APT-21 bound to NET with high affinity (Kd = 194.1 nM)
CD20	protein	WB1.CD20.2	196.0 nM	-6.708	non_intrinsic	flow_cytometry	310.15	41079126	WB1.CD20.2 \| 5'-TGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACAC-3' \| - \| N.P. \| 196 ± 117
streptomycin	protein	STR1	199.1 nM	-6.701	intrinsic			23601877	the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively.
H-Thr	protein	Apt-29	199.0 nM	-6.701	intrinsic			31103164	The good af fi nity of Seq-1 (Fig. S2) with 136 nM and Apt-29 with 199 nM were obtained
malachite green	protein	MGA	200.0 nM	-6.699	intrinsic			27591602	Based on the fl uorescence enhancement of MG, the initial dissociation constant ( K d) is determined to be 200 nM as seen in Figs. 2A and B
sCD80	protein	CD80-4	200.5 nM	-6.698	intrinsic			37816286	CD80-4 and CD80-16 aptamers showed the lowest K d values of 200.5 nM and 47.69 nM, respectively
bilirubin	protein	Brb7	2.03e-07 M	-6.693	intrinsic			40669049	The tightest binding bilirubin aptamer has a K d value of 203 nM based on ITC
rmCD3 d ε -Fc	protein	CD3_Apt12	206.0 nM	-6.686	intrinsic	SPR	298.15	38745854	aptamer 12 (206 nM)
AP65	protein	AP65_A1	2.09e-07 M	-6.68	intrinsic			29972299	K D of 209 nM was obtained
saxitoxin	protein	STX-R-75	209.4 nM	-6.679	intrinsic			35324725	STX-R-75 ( K d: 209.4 nM, Table S1)
di-2-ethylhexyl phthalate	protein	PT01 aptamer	213.0 nM	-6.672	intrinsic			30189334	The dissociation constant, Kd, of the PT01 aptamer was calculated as 213.0 nM using Eq. (1).
CD8	protein	CD8AP17s-Stemloop1	217.0 nM	-6.664	non_intrinsic	flow_cytometry	277.15	23791505	Kd=217.0 nM
rmCD3 d ε	protein	CD3_Apt12 dimer	218.0 nM	-6.662	non_intrinsic	BLI	298.15	38745854	218 nM for Apt12 dimer
rhGH	protein	rhGH-specific aptamer	218.0 nM	-6.662	intrinsic			19500672	the affinity constant was K D = 218 nM rhGH
Cd2+	protein	probe	2.2e-07 M	-6.658	intrinsic			32618180	the disassociation constant ( K D) between Cd 2+ and its aptamer were calculated to be 96 M -1 S -1 , 2.11 × 10 -5 S -1 , and 220 nM, respectively
streptomycin	protein	STR3	221.3 nM	-6.655	intrinsic			23601877	the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively.
SCAF4	protein	PT1/3-SRiApt	0.223 µM	-6.652	intrinsic	fluorescence		40574704	0.223 ± 0.030 µ m for PT 1/3 -SRiApt
xanthylacrylamide	protein	XAA-1	2.2400000000000002e-07 M	-6.65	intrinsic			40261307	Using the ThT assay, an apparent K d of 224 nM was obtained for XAA-1
benzovindiflupyr	protein	Apt.BZF01	2.2650000000000002e-07 M	-6.645	intrinsic	fluorescence		41614999	corrected KDs of 226.5 nM (Apt.BZF01)
human α-thrombin	protein	T25-Apt15-3'-TMR	228.0 nM	-6.642	non_intrinsic	CE-LIF	298.15	28763192	The apparent K d values of T25-Apt15-3 ′ -TMR and 5 ′ -TMR-T25-Apt15 were estimated as 228 nM and 8.8 nM, respectively
Adenosine	protein	Ade1301b	2.3000000000000002e-07 M	-6.638	intrinsic			36947745	Ade1301b showed an even lower K d of 230 nM
aflatoxin M1	protein	A50-T26-TMR	230.0 nM	-6.638	intrinsic			30086944	The aptamer showed almost the same FA responses to AFM1 and AFM2, with K ds to be 230 nM and 302 nM, respectively.
urea	protein	U38	232.0 nM	-6.635	intrinsic			26002019	isolate a urea speci fi c DNA aptamer with a dissociation constant ( K d) of 232 nM
Okadaic Acid	protein	OA-SL3	234.4 nM	-6.63	intrinsic	BLI		36322695	When OA-SL1 was tripled to get the chimera OA-SL3, K d rose to 234.4 ± 15.6 nM
urea	protein	U38	238.0 nM	-6.623	intrinsic			26002019	The K d of aptamer was calculated to be 238 nM
Sr2+	protein	Thrombin Binding Aptamer	240.0 nM	-6.62	intrinsic	mass_spectrometry	298.15	18318508	the Kd determined from the best-fit curve is 240 ( 50 nM for the interaction of TBA and Sr 2 +
Zika NS1	protein	10 (truncated)	2.4000000000000003e-07 M	-6.62	intrinsic			29120623	comparable binding affinities (24 and 45 pM for 100-nt and 41-nt 2 , and 134 and 240 nM for 100-nt and 54-nt 10 , respectively)
dT20	protein	DCC-SSB	2.4000000000000003e-07 M	-6.62	intrinsic		293.15	34085169	Titrations of dT 27 and dT20 at low concentrations of DCCSSB gave smaller fluorescence changes, and the data were fit to give single K d values of 43 and 240 nM, respectively
cortisol	protein	CSS.3	2.4000000000000003e-07 M	-6.62	intrinsic			38270529	Our own internal work confirmed that CSS.3 had the best binding affinity in binding buffer with a K D of 240 nM
kanamycin	protein	Apt 1/Apt 2 (split aptamers)	247.0 nM	-6.607	intrinsic			35316405	With the (GlcN)5 added in the binding buffer, the Kd was measured to be 247 nM
Ni2+	protein	Ni-4	2.5700000000000004e-07 M	-6.59	intrinsic			40656531	and 257 nM for Ni 2+ in the same titration
rHuEPOa	protein	813	260.0 nM	-6.585	intrinsic			20971648	The K d values of sequences of 807, 813, and 850 were 82 ± 32 nM, 260 ± 117 nM, and 590 ± 354 nM, respectively
Tetracycline	protein	OTC5	2.6400000000000003e-07 M	-6.578	intrinsic			35777074	they also showed a similar fluorescence enhancement with a K d of 264 nM TC
streptomycin	protein	STR6	272.0 nM	-6.565	intrinsic			23601877	the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively.
5-Methoxytryptamine	protein	MLT-C-1F	0.274 μM	-6.562	intrinsic			36925277	For L-TRP and 5-MT very low K d were observed i.e., 0.324 μM and 0.274 μM respectively
human α-Thrombin	protein	A1	279.0 nM	-6.554	intrinsic			31129134	Whereas the highest value was determined with iRIf for aptamer A1, which is 279 nM.
trisialic acid	protein	Apt3-1	282.7 nM	-6.549	intrinsic			40545079	Apt3 -1 ( K d = 282.7 nM)
VEGF165	protein	no. 529	2.8800000000000004e-07 M	-6.541	intrinsic			36215718	The K D values of 524, 64, and 529, were 36.3, 79.3, and 288 nM, respectively.
Lactose	protein	Clone 5	2.9e-07 M	-6.538	intrinsic	SPR		11178986	Lactose \| 6.3 3 10 2 \| 1.8 3 10 2 4 \| 3.4 3 10 6 \| 2.9 3 10 2 7
CD9	protein	CD9-28	289.67 nM	-6.538	intrinsic	fluorescence	277.15	37585601	CD9-28 \| 5 ′ -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG GGC GCA CTA GAG CAG GTA CGG TGT CA-3 ′ \| - 8.80
prothrombin	protein	HD1-12A-DAB	296.0 nM	-6.529	non_intrinsic	filter_binding		41053535	and prothrombin with K D s of 13.1 pm and 296 nm
Sc3+	protein	Sc-1b	3.0200000000000003e-07 M	-6.52	intrinsic			39743479	its K d (302 nM) was comparable to that of Sc-1
aflatoxin M2	protein	A50-T26-TMR	302.0 nM	-6.52	intrinsic			30086944	The aptamer showed almost the same FA responses to AFM1 and AFM2, with K ds to be 230 nM and 302 nM, respectively.
kanamycin	protein	Apt 1/Apt 2 (split aptamers)	304.0 nM	-6.517	intrinsic			35316405	The split aptamers exhibited high affinity towards the kanamycin, with an Kd of 304 nM.
CD20	protein	WB1.CD20.3	309.0 nM	-6.51	non_intrinsic	flow_cytometry	310.15	41079126	WB1.CD20.3 \| 5'-TGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' \| - \| N.P. \| 309 ± 100
SW620	protein	XL-33-1	3.22e-07 M	-6.492	apparent_cellular			25867099	Binding affinity of XL-33-1 against SW620 at 37 ° C was found to be 322 nM.
streptomycin	protein	STR12	340.64 nM	-6.468	intrinsic			23601877	the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively.
CD19	protein	WB15/15.CD19.1_2S	356.0 nM	-6.449	non_intrinsic	flow_cytometry	277.15	41079126	WB15/15.CD19.1_2S \| 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| 2.64 \| 356 ± 534 \| 9.5 ± 5.0
serotonin	protein	Serotonin Aptamer	3.6000000000000005e-07 M	-6.444	intrinsic			36704862	The steady-state binding responses were fitted to the affinity model in eq 1, as shown in Figure 3B, which yielded a K d of 360 nM.
Hen egg white lysozyme	protein	DNA analog a1	378.0 nM	-6.423	intrinsic			21167858	The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 ◦ C are 378nM, 467nM and 573nM, respectively.
benzylpenicillin	protein	BBA1	383.4 nM	-6.416	intrinsic			28522308	a Kd of 383.4 nM (dissociation constant) was determined.
benzylpenicillin	protein	BBA1	383.4 nM	-6.416	intrinsic			33184760	a Kd of 383.4 nM (dissociation constant) was determined.
bilirubin	protein	Bvd4	3.9e-07 M	-6.409	intrinsic			40669049	We then performed a careful bilirubin titration (Figure S3A), and a clear binding was observed with an apparent K d of 390 nM bilirubin (Figure S3B).
dT20	protein	DCC-SSB	3.96e-07 M	-6.402	intrinsic		293.15	34085169	With dT20, the intercept suggests a dissociation rate constant of 49 s -1 , producing a value of 396 nM for the equilibrium dissociation constant
biliverdin	protein	Bvd4	4.0999999999999994e-07 M	-6.387	intrinsic	fluorescence		40669049	Titration of biliverdin into 1 μM Bvd4 aptamer led to an approximate 90% fluorescence drop (Figure 3A), and the fitted dissociation constant ( K d ) was 0.41 μM
H-6 cells	cell/EV	Apta25	0.42 µM	-6.377	non_intrinsic	flow_cytometry	310.15	40487293	H-6 cells showed binding with Apta25 ( K D value-0.42 ± 0.093 µ m)
theophylline	protein	ΔTCT8-4 theophylline-binding aptamer	4.2e-07 M	-6.377	intrinsic			41248478	Analysis of the SPR dose -response data gave a binding affinity of 420 nM.
rmCD3 d ε -Fc	protein	CD3_Apt3	430.0 nM	-6.367	intrinsic	SPR	298.15	38745854	aptamer 3 (430 nM)
Kringle 5	protein	KG-4	432.0 nM	-6.365	intrinsic			37149949	The preferred aptamer KG-4, which demonstrated a low dissociation constant ( K d) of ~ 432 nM
mannose-capped lipoarabinomannan	protein	ZXL1	436.3 nM	-6.36	intrinsic	ELONA	310.15	24572295	The K d of 436.3 ± 37.84 nM was established as described in the Methods section.
Uric Acid	protein	Apt2	4.61e-07 M	-6.336	intrinsic			42095518	Microscale thermophoresis (MST) analysis yielded a Kd value of 461 nM for Apt2
Hen egg white lysozyme	protein	DNA analog a2	467.0 nM	-6.331	intrinsic			21167858	The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 ◦ C are 378nM, 467nM and 573nM, respectively.
Muscovy duck parvovirus	protein	Apt-10	467.0 nM	-6.331	intrinsic			28917743	the ssDNA aptamer Apt-10, which specifically bound to MDPV with high affinity ( Kd = 467 nM) was successfully screened
Fe2+	protein	Co-1	4.68e-07 M	-6.33	intrinsic			40656531	The corresponding true K d values were ... 468 nM for Fe 2+
SCAF4	protein	SRiApt	0.469 µM	-6.329	intrinsic	fluorescence		40574704	The binding affinities (K D ) were determined to be 0.469 ± 0.010 µ m for unmodified SRiApt
Bisphenol A	protein	63-mer BPA aptamer	491.69 nM	-6.308	intrinsic			32113141	The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM
CD9	protein	CD9-08	494.37 nM	-6.306	non_intrinsic	fluorescence	277.15	37585601	CD9-08 \| 5 ′ -TGA CAC CGT ACC TGC TCT AGT GCG CAC TGA ACG ATC CTG CGT CAA GTT CAA GGT TGT GAA GCA CGC CAA GGG ACT AT-3 ′ \| - 11.71
Mouse thrombin	protein	M08s	495.0 nM	-6.305	intrinsic	SPR		37621412	M08s \| 3.56 10^5 \| 1.76 10^-1 \| 495
thrombospondin-1	protein	M55	0.5 μM	-6.301	intrinsic	ELISA		24434496	The K D value of the aptamer M55 binding to thrombospondin-1 was determined as 0.5 7 0.2 μ M
adenine	protein	R10A4	5.000000000000001e-07 M	-6.301	intrinsic			38194356	our R10A4 aptamer has a comparable K d of 500 nM
CD19	protein	WB17/17.CD19.1_1S	530.0 nM	-6.276	non_intrinsic	flow_cytometry	277.15	41079126	WB17/17.CD19.1_1S \| 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' \| 1.32 \| 530 ± 1278 \| 56 ± 49
mannose-capped lipoarabinomannan	protein	12th-round ssDNA pool	537.5 nM	-6.27	non_intrinsic	ELONA	310.15	24572295	The dissociation constant ( K d values) of the 12th-round pool was determined to be 537.5 ± 69.98 nM
Clenbuterol	protein	CLB-1	5.61e-07 M	-6.251	intrinsic			42204903	the apparent K d was 561 nM (Figure 3B)
Hen egg white lysozyme	protein	DNA analog a3	573.0 nM	-6.242	intrinsic			21167858	The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 ◦ C are 378nM, 467nM and 573nM, respectively.
mouse IL-2	protein	M15	600.0 nM	-6.222	intrinsic			35756119	The calculation of the dissociation constant predicted 91 and 600 nM Kd for M20 and M15, respectively
K-1 cells	cell/EV	Apta30	0.66 µM	-6.18	non_intrinsic	flow_cytometry	310.15	40487293	Apta30 ( K D -0.66 ± 0.12 µ m)
human β-defensin 2	protein	A ad1-2	676.0 nM	-6.17	intrinsic			32067984	a clone with a truncation at the 3 ʹ terminal (A ad1 -2 , 58mer, Fig. 4a) was found to bind more weakly to HBD-2 ( K d = 676 nM, Fig. 4b).
CD71	protein	ATL	696.7 nM	-6.157	non_intrinsic	flow_cytometry	277.15	41412185	K(pH 7.5)= 696.7 ± 68.03 nM
HER3	protein	HBR	700.0 nM	-6.155	intrinsic			33770580	The dissociation constant ( K D) of HBR was calculated from the resulting BLI sensorgrams was 700 nM.
Alternariol	protein	AOH 6C	701.0 nM	-6.154	intrinsic			34655971	The apparent KD of AOH 6C, B-2-3 and T-23 were 701 nM, 445 nM and 274 nM, respectively
Co2+	protein	Co-1	7.310000000000001e-07 M	-6.136	intrinsic			40656531	the Co-1 aptamer has a K d of 731 nM for Co 2+
Dinophysistoxin	protein	anti-DTX parent aptamer	778.1 nM	-6.109	intrinsic	BLI		36322695	antiDTX parent aptamer ( K d = 778.1 ± 73.5 nM)
IL4Rα	protein	cl.42	788.0 nM	-6.103	non_intrinsic	FACS	310.15	22282665	with an apparent K d of 788 nM (Supplementary Fig. S3B)
EpCAM	protein	TD05	7.92e-07 M	-6.101	apparent_cellular			36856721	TD05's K d value is 792 nM
Clenbuterol	protein	CLB-1	7.98e-07 M	-6.098	intrinsic			42204903	CLB binding was preserved in the absence of Mg 2+ ( K d 798 nM)
Clenbuterol	protein	CLB-1	8.850000000000001e-07 M	-6.053	intrinsic			42204903	ITC showed that the CLB-1 aptamer has a K d of 885 nM (Figure 3D)... The enthalpy ( Δ H = -24.9 kcal mol -1 ) and entropy ( Δ S = -55.9 cal K -1 mol -1 )
Co2+	protein	Ni-4	9.01e-07 M	-6.045	intrinsic			40656531	Ni-4 exhibited a K d of 901 nM for Co 2+
prothrombin	protein	HD1	992.0 nM	-6.003	intrinsic	filter_binding		41053535	and prothrombin (K D = 992 nm)
Thrombin	protein	aptamer 1S	1.08e-06 M	-5.967	intrinsic	SPR		32268723	The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 μM and 29.4 nM, respectively
CD117	protein	Apta04	1100.0 nM	-5.959	intrinsic	BLI	298.15	40487293	Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 µ m, respectively ( Figure 2 a,b).
H-6 cells	cell/EV	Apta30	1.107 µM	-5.956	non_intrinsic	flow_cytometry	310.15	40487293	H-6 cells showed binding with ... Apta30 ( K D -1.107 ± 0.208 µ m)
CD123	protein	Apta25	1.16 µM	-5.936	intrinsic	BLI	298.15	40487293	BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 µ m for ZW25 and 15.6 µ m for CY30 (Figure S2, Supporting Information).
Bisphenol A	protein	23-mer BPA aptamer	1190.61 nM	-5.924	intrinsic			32113141	The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM
CD20	protein	Aptamer 2	1.2 μM	-5.921	intrinsic	ITC	298.15	39004051	\| 2 \| 1.2 ± 0.2 \| 1.49 ± 0.01 \| > mM \| N/D \|
IL-8	protein	8A-30	1.22e-06 M	-5.914	intrinsic	SPR	298.0	24129312	\| 8A-30 \| 1.32 x 10 6 \| 1.62 \| 1.22 x 10 -6 \| 4.62 x 10 -5 \| 1.06 x 10 -3 \|
K-1 cells	cell/EV	Apta25	1.358 µM	-5.867	non_intrinsic	flow_cytometry	310.15	40487293	Apta25 ( K D value-1.358 ± 0.201 µ m)
bilirubin	protein	Brb7	1.4e-06 M	-5.854	intrinsic	fluorescence		40669049	After titrating bilirubin into 1.0 μM Brb7 aptamer, the saturation fluorescence decrease reached 99% (Figure 6A) and its K d was fitted to be 1.4 μM
Okadaic Acid	protein	anti-OA parent aptamer	1402.0 nM	-5.853	intrinsic	BLI		36322695	anti-OA aptamer with high affinity from its parent aptamer ( K d = 1402 ± 58 nM, Figure 1a)
amikacin	protein	Aptamer A1	1.5e-06 M	-5.824	intrinsic	ITC	298.15	36453647	Aptamer A1 binds 7-fold stronger to amikacin with a K d value of 1.5 μM
domoic acid	protein	C1-s	1.5e-06 M	-5.824	intrinsic			36421085	BLI results showed that the affinity of C1-s ( K D value, 1.50 × 10 -6 M) and C1 for DAwas at an equivalent level.
thrombin	protein	TBA15	1690.0 nM	-5.772	intrinsic			23850569	The addition of 10% blood plasma to the working buffer changed the K D values significantly ( K D TBA 1⁄4 1690 nM 15 nM
ESAT6/CFP10 fusion protein	protein	Aptamer 3 (core 21-nt)	1.81e-06 M	-5.742	intrinsic			40359808	retaining only the core 21-nucleotide sequence at the 5 ′ end results in a dramatic reduction of the K d value to 1.81E-6
K-1 cells	cell/EV	Apta02	1.821 µM	-5.74	non_intrinsic	flow_cytometry	310.15	40487293	Apta02 ( K D value-1.821 ± 0.117 µ m)
K-1 cells	cell/EV	Apta04	1.867 µM	-5.729	non_intrinsic	flow_cytometry	310.15	40487293	Apta04 ( K D value-1.867 ± 0.19 µ m)
cRNA	protein	CRP-specific RNA aptamer	1.98 μM	-5.703	intrinsic			22365749	Binding kinetics as determined by incubating different target concentrations against constant number of aptamers immobilized on sensor surface showed the K d values of 1.98 and 2.4 μM for cRNA and CRP, respectively.
biliverdin	protein	Bvd1	2e-06 M	-5.699	intrinsic	fluorescence		40669049	The same trend was also observed for the Bvd1 aptamer (Figure S1), and the fitted K d was 2.0 μM.
CTNNA1	protein	EA2	2.07 µM	-5.684	intrinsic	MST		40265971	The K d values (2.07 ± 0.60 µ M) obtained from MST assay (Figure 2l) further corroborated the specific binding between CTNNA1 and EA2.
verrucarin A	protein	14_Ver1	2.2e-06 M	-5.658	intrinsic	fluorescence		39404132	The binding test demonstrated that the decrease in fluorescence was correlated with increasing verrucarin A concentration with K D = 2.2 μM.
verrucarin A	protein	Ver1_JYP (C32G mutant)	2.2999999999999996e-06 M	-5.638	intrinsic	fluorescence		39404132	guanine with both functional groups exhibited partially recovered binding activity ( K D = 2.3 μM).
C-reactive protein	protein	CRP-specific RNA aptamer	2.4 μM	-5.62	intrinsic			22365749	Binding kinetics as determined by incubating different target concentrations against constant number of aptamers immobilized on sensor surface showed the K d values of 1.98 and 2.4 μM for cRNA and CRP, respectively.
hemin	protein	Sequence D	2.9 μM	-5.538	intrinsic	fluorescence		40368877	Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 μ M for sequences C and D, respectively.
thrombin	protein	A4	3040.0 nM	-5.517	intrinsic			23850569	K D A4 1⁄4 3040 nM 65 nM
swine C5a	protein	S1	4.0 μM	-5.398	intrinsic			30336124	Aptamer S1 bound specifically to swine C5a with a dissociation constant of 4 μM as measured by surface plasmon resonance (SPR).
Brevetoxin-2	protein	Bap5	4.83 uM	-5.316	intrinsic			28058132	The Kd value for the binding between the Bap5 aptamer and BTX-2 was 4.83 uM
H-9 cells	cell/EV	Apta02	4.93 µM	-5.307	non_intrinsic	flow_cytometry	310.15	40487293	H-9 cells showed binding with Apta02 ( K D value-4.93 ± 0.367 µ m)
K+	protein	Thrombin Binding Aptamer	5000.0 nM	-5.301	intrinsic	mass_spectrometry	298.15	18318508	the Kd determined from the bestfit curve is 5000 ( 1000 nM for the interaction of TBA and K +
H-9 cells	cell/EV	Apta04	5.402 µM	-5.267	non_intrinsic	flow_cytometry	310.15	40487293	H-9 cells showed binding with ... Apta04 ( K D value-5.402 ± 0.795 µ m)
CD20	protein	Aptamer 2-f1	5.5 μM	-5.26	intrinsic	ITC	298.15	39004051	\| 2-f1 \| 5.5 ± 1.3 \| 1.46 ± 0.03 \| > mM \| N/D \|
CD20	protein	Aptamer 1	6.4 μM	-5.194	intrinsic	ITC	298.15	39004051	\| 1 \| 6.4 ± 1.0 \| 0.86 ± 0.01 \| N/D \| N/D \|
hemin	protein	Sequence C	8.3 μM	-5.081	intrinsic	fluorescence		40368877	Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 μ M for sequences C and D, respectively.
CD20	protein	Aptamer 1-f1	9.0 μM	-5.046	intrinsic	ITC	298.15	39004051	\| 1-f1 \| 9.0 ± 2.4 \| 0.98 ± 0.02 \| > mM \| N/D \|
P-selectin	protein	NX244	9000000.0 pM	-5.046	intrinsic	filter_binding	310.15	9743465	NX244 \| 9 X 106
bilirubin	protein	Brb9	9e-06 M	-5.046	intrinsic	fluorescence		40669049	The same trend was also observed in the Brb9 aptamer (Figure S4), which showed a K d of 9.0 μM.
amikacin	protein	Aptamer A	9.999999999999999e-06 M	-5.0	intrinsic			36453647	native Aptamer A, which has a K d value of 10 μM
Patulin	protein	PTL-1	1.2499999999999999e-05 M	-4.903	intrinsic	ITC	298.15	41473783	The measured K d from ITC value was 12.5 μM
CD123	protein	Apta30	15.6 µM	-4.807	intrinsic	BLI	298.15	40487293	BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 µ m for ZW25 and 15.6 µ m for CY30 (Figure S2, Supporting Information).
Patulin	protein	PTL-1	1.8399999999999997e-05 M	-4.735	intrinsic	fluorescence		41473783	yielding an apparent K d of 18.4 μM
CD20	protein	Aptamer 1-f2	18.9 μM	-4.724	intrinsic	ITC	298.15	39004051	\| 1-f2 \| 18.9 ± 3.3 \| 1.07 ± 0.03 \| > mM \| N/D \|
dehydroepiandrosterone sulfate	protein	DHEAS aptamer (stem, Rp)	32.03 μM	-4.494	intrinsic	fluorescence		40368877	Values calculated are 32.03 μ M for stem Rp
dehydroepiandrosterone sulfate	protein	DHEAS aptamer (loop, Rp)	33.28 μM	-4.478	intrinsic	fluorescence		40368877	33.28 μ M for loop Rp
dehydroepiandrosterone sulfate	protein	DHEAS aptamer (stem, Sp)	36.57 μM	-4.437	intrinsic	fluorescence		40368877	36.57 μ M for stem Sp
patulin	protein	PAT Rep	4e-05 M	-4.398	intrinsic	SPR		35546052	PAT Rep showed a K D value of 4.0 × 10 -5 M
Patulin	protein	PAT-6	4.8e-05 M	-4.319	intrinsic	fluorescence		41473783	PAT-6 has weaker binding affinities ( Kd = 48 μM by ThT, Fig. 4S)
thiamethoxam	protein	Thi-5R-18	4.935e-05 M	-4.307	intrinsic			36831921	According to the ITC results (Figure 5), the Kd value was 4.935 × 10 -5 Mfor Thi-5R-18 combined with the target to release heat
dehydroepiandrosterone sulfate	protein	DHEAS aptamer (loop, Sp)	59.62 μM	-4.225	intrinsic	fluorescence		40368877	59.62 μ M for loop Sp
YRLFRK	protein	BC 007	86.7 μM	-4.062	intrinsic			33163683	followed by YRLFRK with Kd = 86.7 μM
L-lactate	protein	D-Lac1103	8.999999999999999e-05 M	-4.046	intrinsic	fluorescence		41779931	The true K d for D-Lac1103 was calculated to be 0.09 mM for L-lactate
L-lactate	protein	Lac2059	0.00011 M	-3.959	intrinsic	ITC	298.15	41779931	The K d from ITC was determined to be 0.11 mM
L-lactate	protein	Lac201	0.0009000000000000001 M	-3.046	intrinsic	fluorescence	296.15	41779931	the fitted K d was 0.9 mM (Figure 5C, black line)
D-lactate	protein	D-Lac1103	0.0025 M	-2.602	intrinsic	fluorescence	295.15	41779931	In addition, the apparent K d values for D-Lac1103 are 0.46 mMfor L-lactate and 2.5 mM for D-lactate
Tris(hydroxymethyl)aminomethane	protein	Tris aptamer	0.0026000000000000003 M	-2.585	intrinsic	fluorescence		40905906	ThT yielded K d values changed modestly from 1.6 to 2.6 mM
L-lactate	protein	Lac2059	0.0033 M	-2.481	intrinsic	fluorescence	296.15	41779931	The fitted K d was 3.3 mM for this 2AP-labeled aptamer
L-lactate	protein	Lac201	0.0043 M	-2.367	intrinsic	fluorescence	296.15	41779931	although the obtained K d (4.3 mM) was about 5-fold higher than that obtained using Mg 2+ .
acrylamide	protein	AA-1	0.0047 M	-2.328	intrinsic	fluorescence		40261307	Similarly, the AA-1 aptamer exhibited a true K d value of 4.7 mM via the strand-displacement assay
acrylamide	protein	AA-1	0.0105 M	-1.979	intrinsic	fluorescence		40261307	the fitted K d value was 10.5 mM