home / scout

Kd — all source-verified measurements

All Gold-tier aptamer–target Kd records with verbatim quote + measurement class. Use facets to filter to intrinsic vs apparent/avidity.

Custom SQL query returning 742 rows (hide)

SELECT target_name_canonical, target_type, aptamer_name, kd_reported, kd_log10_molar, measurement_class, assay_method, assay_temperature_k, source_pmid, verbatim_quote FROM v_kd ORDER BY kd_log10_molar ASC

Edit SQL

This data as json, CSV

target_name_canonicaltarget_typeaptamer_namekd_reportedkd_log10_molarmeasurement_classassay_methodassay_temperature_ksource_pmidverbatim_quote
PDGF-BB protein 36aApt 0.036 pM -13.444 non_intrinsic ELISA 298.0 28825469 36aApt | 0.036 ± 0.012 | - 18.33
PDGF-BB protein 38aApt 0.094 pM -13.027 non_intrinsic ELISA 298.0 28825469 38aApt | 0.094 ± 0.008 | - 17.76
IL-8 protein 8A-35 1.72e-12 M -11.764 intrinsic SPR 298.0 24129312 | 8A-35 | 5.78 x 10 4 | 9.95 x 10 -8 | 1.72 x 10 -12 | 2.80 | 3.11 x 10 1 |
human α-Thrombin protein A1 2.0 pM -11.699 intrinsic     31129134 Also for aptamer A1 we measured with MST KD values in the pico- and nanomolar range (2 pM and 52 nM). The lowest KD value is determined with MST (shown as bar) for aptamer A1, which is 2 pM.
SARS-CoV-2 spike protein (wild type) protein DSA1N5 3e-12 M -11.523 avidity_multivalent dot_blot   36926840 DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B).
nucleolin protein Cy5-AT11-B0 3.3e-12 M -11.481 intrinsic     31301466 yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8
SW480 cells cell/EV Apt-nanovesicle 3.66 pM -11.437 non_intrinsic     32049531 The dissociation constant ( K d ) value of Apt-nanovesicle against SW480 cells was found to be 3.66 ± 0.34 pM (Figure 2B)
SARS-CoV-2 spike protein (wild type) protein DSA1N5 3.9e-12 M -11.409 avidity_multivalent dot_blot   36926840 DSA1N5 also demonstrated high binding affinity in undiluted wastewater samples ( K d = 3.0 -3.9 pM for WTPV, Figure S1A,B).
SARS-CoV-2 pseudotyped lentivirus (omicron variant) protein DSA1N5 4.8e-12 M -11.319 avidity_multivalent dot_blot   36926840 This study demonstrates that DSA1N5 has high affinity for recognizing OMPV with a K d value of 4.8 pM, which is in the same order of magnitude as that measured for the WTPV (2.1 pM) in deionized water (DI water)
SARS-CoV-2 pseudotyped lentivirus (omicron variant) protein DSA1N5 5.1e-12 M -11.292 avidity_multivalent dot_blot   36926840 DSA1N5 preserves its binding affinity in 50% wastewater ( K d = 2.1 -4.1 pM for WTPV and 5.1 for OMPV in wastewater).
nucleolin protein Cy5-AT11 5.2e-12 M -11.284 intrinsic     31301466 yielding K D values of 5.2 × 10 -12 and 3.3 × 10 -12 M for Cy5-AT11 G4 C8 and Cy5-AT11-B0 G4 C8
PDGF-BB protein FullApt 5.33 pM -11.273 non_intrinsic ELISA 298.0 28825469 FullApt | 5.33 ± 2.36 | - 15.37
PDGF-BB protein 40Apt 5.92 pM -11.228 non_intrinsic ELISA 298.0 28825469 40Apt | 5.92 ± 1.13 | - 15.31
PDGF-BB protein 38bApt 7.03 pM -11.153 non_intrinsic ELISA 298.0 28825469 38bApt | 7.03 ± 1.28 | - 15.21
nucleolin protein Cy5-AT11 9.1e-12 M -11.041 intrinsic     31301466 K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4
nucleolin protein Cy5-AT11-B0 9.5e-12 M -11.022 intrinsic     31301466 K D values of 9.1 × 10 -12 and 9.5 × 10 -12 M for Cy5-AT11 G4 and Cy5-AT11-B0 G4
thrombin protein HD1-12A-DAB 13.1 pM -10.883 non_intrinsic filter_binding   41053535 HD1-12A-DAB EXACT inhibitor bound to thrombin and prothrombin with K D s of 13.1 pm
P-selectin protein PF377 14.0 pM -10.854 intrinsic filter_binding 310.15 9743465 PF377 | 14
P-selectin protein PF377sl 14.0 pM -10.854 intrinsic filter_binding 296.15 9743465 PF377sl | 14
P-selectin protein PF377 16.0 pM -10.796 intrinsic filter_binding 310.15 9743465 PF377 | 16
P-selectin protein PF377 18.0 pM -10.745 intrinsic filter_binding 277.15 9743465 PF377 | 18
thrombin protein Supra-TBA15/29-GO 1.9e-11 M -10.721 avidity_multivalent     31157200 Supra-TBA15 / 29-GO prepared with GO (40 μ g mL -1 ) at 60 ◦ C exhibited much higher binding affinity toward thrombin ( K d = 1.9 × 10 -11 M, Figure S10 , Supporting Information).
Malate Synthase protein MS10-Trunc 19.0 pM -10.721 intrinsic     31704587 MS10-Trunc aptamer exhibited high af fi nity for MS (equilibrium dissociation constant [KD] 19 pM)
PDGF-C protein α-PC 20.0 pM -10.699 intrinsic SPR   42138517 SPR analysis demonstrated that the α -PC aptamer bound tightly to PDGF-C with a dissociation constant ( KD ) of 20 pM
SW480 cells cell/EV Fixed Apt-nanovesicle 28.06 pM -10.552 non_intrinsic     32049531 the K d value of fi xed Apt-nanovesicles to SW480 cells was increased to 28.06 ± 3.31 pM (Figure 2D)
P-selectin protein PF377sl 29.0 pM -10.538 intrinsic filter_binding 310.15 9743465 PF377sl | 29
VEGF165 protein 3R02 Bivalent 3e-11 M -10.523 avidity_multivalent     23237717 The K d value of 30 pM for 3R02 Bivalent was calculated by measuring SPR.
bevacizumab protein A14#1 44.0 pM -10.357 intrinsic     35114463 affinity of A14#1 to bevacizumab markedly increased at pH 4.7 ( K D = 44 pM)
P-selectin protein PF377sl 46.0 pM -10.337 intrinsic filter_binding 310.15 9743465 PF377sl | 46
thrombin protein MP-TBA15/TBA29-T15 5.2e-11 M -10.284 avidity_multivalent saturation_binding   22300379 MP-TBA15/TBA29-T15 -Au NPs provided high flexibility and an appropriate orientation and distance between TBA and TBA units for bivalent binding, allowing stronger interactions with thrombin ( K d = 5.2 × 10 -11 M; Supporting Information, Figure S3)
P-selectin protein PF373sl 56.0 pM -10.252 intrinsic filter_binding 310.15 9743465 PF373sl | 56
sLe X -BSA glycan/conjugate Clone 5 5.7e-11 M -10.244 intrinsic SPR 298.15 11178986 sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11
von Willebrand factor A1-domain protein Rn-DsDsDs-53mh 61.3 pM -10.213 intrinsic SPR 310.15 27966933 RnDsDsDs-53mh ( K D = 61.3 pM)
Myoglobin protein anti-Mb aptamer 65.0 pM -10.187 intrinsic     25957831 The corresponding af fi nity, K D, values calculated from the ratio between dissociation ( k d) and association ( k a ) was found to be 65 pM.
von Willebrand factor A1-domain protein Rn-DsDsDs-44 74.9 pM -10.126 intrinsic SPR 310.15 27966933 Rn-DsDsDs-44 ( K D = 74.9 pM) exhibited the highest a ffi nity
CCRF-CEM cells cell/EV CDN-sgc8 0.08 nM -10.097 non_intrinsic fluorescence   35670775 Kd=0.08±0.01 nM
sLe X -BSA glycan/conjugate Clone 5 8.5e-11 M -10.071 intrinsic SPR 298.15 11178986 Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11
PDGF-BB protein PDGF-B aptamer 0.1 nM -10.0 intrinsic filter_binding   9916931 the binding affinity of the aptamer used in the experiments described below ( K d ≈ 0.1 nM)
ofloxacin protein Q2 0.11 nM -9.959 intrinsic     26547431 Their K D values were calculated at K D 1⁄4 0.11 nM ( 7 0.06) for aptamer Q2
MutS protein 2-06 1.23e-10 M -9.91 intrinsic     25668425 The best fi t was obtained at K d = 123 pM and [T]0 = 213 pM
MPO protein MPO-16 166.0 pM -9.78 non_intrinsic flow_cytometry   37277648 MPO16 revealed the highest binding affinity ( K d = 166 pM)
P-selectin protein PF398sl 178.0 pM -9.75 intrinsic filter_binding 310.15 9743465 PF398sl | 178
von Willebrand factor A1-domain protein Rn-DsDs-51mh2 182.0 pM -9.74 intrinsic SPR 310.15 27966933 Rn-DsDs-51mh2 ( K D = 182 pM)
HBcAg protein A-9 2.0000000000000003e-10 M -9.699 intrinsic affinity_real_time_qPCR   32250595 This aptamer showed strong binding to HBcAg ( K d : 0.2 nM)
ofloxacin protein Q8 0.2 nM -9.699 intrinsic     26547431 K D 1⁄4 0.20 nM ( 7 0.09) for aptamer Q8
OH-BDE47 protein BDE-A-8 0.2 nM -9.699 intrinsic     27566357 The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition.
MPO protein MPO-02 227.0 pM -9.644 non_intrinsic flow_cytometry   37277648 MPO-02 ... 227
P-selectin protein PF377sl 250.0 pM -9.602 non_intrinsic flow_cytometry 296.15 9743465 PF377sl | 250
thrombin protein 29-mer thrombin-specific aptamer 298.0 pM -9.526 intrinsic     32570818 The n-curve analysis provided a Kd of 298 pM ( + 111 / 81 pM)
VEGF165 protein 3R02 3e-10 M -9.523 intrinsic     23237717 The K d value for 3R02 was 300 pM
20 Methyl Spirolide G protein SPX 7 3e-10 M -9.523 intrinsic     34144421 The present study, among the aptamers selected, the aptamer with highest affinity had a dissociation constant of 0.3 nM for SPX G
chimeric-tPA protein Chi-tPA 1 0.32 nM -9.495 intrinsic     26876003 selected aptamer having KD values of 0.320 nM
von Willebrand factor A1-domain protein ARC1172-41 326.0 pM -9.487 intrinsic SPR 310.15 27966933 ARC1172-41 ( K D = 326 pM)
FLRPp (O serotype) protein FMD_1 3.46e-10 M -9.461 intrinsic SPR   42010751 dissociation constants ( KD ) of 3.46 × 10 -10 M
Human thrombin protein Lin08-08 0.4 nM -9.398 non_intrinsic SPR   37621412 Lin(08-08) | 1.63 10^6 | 6.94 10^-4 | 0.4
Human thrombin protein Pse08-08 0.4 nM -9.398 non_intrinsic SPR   37621412 Pse(08-08) | 1.19 10^6 | 5.10 10^-4 | 0.4
HBeAg protein EAg3-Py 4.0000000000000007e-10 M -9.398 intrinsic affinity_real_time_qPCR   32250595 The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3
CCRF-CEM cells cell/EV mono-CDN-sgc8 0.48 nM -9.319 non_intrinsic fluorescence   35670775 Kd= 0.48 ± 0.04 nM
PDGF-BB protein PDGF-specific aptamer 5e-10 M -9.301 intrinsic microcantilever 310.15 24723743 K d , as shown in Fig. 10, decreased from approximately 12 × 10 -10 M to 5 × 10 -10 M as the temperature changed from 19 to 37 ◦ C.
human α-thrombin protein Apt29 0.5 nM -9.301 non_intrinsic     28763192 a 29nucleotide aptamer (5 ′ -AGT CCG TGG TAG GGC AGG TTG GGG TGA CT-3 ′ , denoted as Apt29 here) binds to the heparin-binding site of human α -thrombin with a dissociation constant ( K d) around 0.5 nM.
thrombin protein TBA29 0.5 nM -9.301 non_intrinsic     31614078 The 29-nt TBA29 aptamer has a bimodular duplex-antiparallel G4 structure and binds to thrombin with a binding a ffi nity of 0.5 nM. 30
BDNF protein NV_B12 5e-10 M -9.301 intrinsic ALISA   38149631 The equilibrium dissociation constant ( K d) for the NV_B12/BDNF interaction was obtained by fitting the equation, Y = B max × X /( K d + X )... The K d value determined to be 0.5 nM (95% CI: 0.4 -0.6 nM)
Thrombin protein TBA29 5e-10 M -9.301 intrinsic     26643617 and TBA29 (~5 × 10 -10 M)
PlanarAu protein 1N 5.600000000000001e-10 M -9.252 intrinsic QCM   30189130 aptamer 1N showing the highest affinity (0.56 nM)
AGEs-HSA protein #9s 0.57 nM -9.244 intrinsic     24012635 Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively.
sLe X -BSA glycan/conjugate Selected pool 5.8e-10 M -9.237 intrinsic SPR   11178986 Selected pool | 2.4 3 10 5 | 1.4 3 10 2 3 | 1.7 3 10 9 | 5.8 3 10 2 10
human α-thrombin protein 5'-TMR-Apt15-T24 0.6 nM -9.222 non_intrinsic CE-LIF 298.15 28763192 0.6 nM for 5 ′ -TMR-Apt15-T24
human α-thrombin protein 5'-TMR-Apt15-T25 0.6 nM -9.222 non_intrinsic CE-LIF 298.15 28763192 0.6 nM for 5 ′ -TMR-Apt15-T25
EGFR protein Anti-EGF receptor aptamer 0.62 nM -9.208 non_intrinsic     41877526 Anti-EGF receptor aptamers ( K d : 0.62 nM, DNA aptamers)
AGEs-HSA protein #4s 0.63 nM -9.201 intrinsic     24012635 Surface plasmon resonance analysis revealed that K D values of #4s, #7s and #9s were 0.63, 0.36, and 0.57 nM, respectively.
thrombin protein HD1-22 6.5e-10 M -9.187 non_intrinsic SPR   18826387 HD1-22 | Thrombin | K D ( M) | 6.5 · 10 ) 10
MutS protein 2-06 6.5e-10 M -9.187 intrinsic     25668425 The experimental points from the second step resulted in the best fi t with the theoretical dependence of R versus [L] 0 at K d = 650 pM
human α-thrombin protein 5'-TMR-Apt15-T30 0.7 nM -9.155 non_intrinsic CE-LIF 298.15 28763192 0.7 nM for 5 ′ -TMR-Apt15-T30
human α-thrombin protein 5'-TMR-Apt15-T35 0.7 nM -9.155 non_intrinsic CE-LIF 298.15 28763192 0.7 nM for 5 ′ -TMR-Apt15-T35
tetracycline protein TC aptamer 770.0 pM -9.114 intrinsic     25517161 dissociation constant Kd of 770 pM ([Mg 2 þ ] 1⁄4 10 mM)
sLe X -BSA glycan/conjugate Clone 2 8e-10 M -9.097 intrinsic SPR   11178986 Clone 2 | 9.8 3 10 5 | 7.3 3 10 2 5 | 1.2 3 10 9 | 8.0 3 10 2 10
PSMA protein C3 8.000000000000001e-10 M -9.097 intrinsic EMSA   41126016 an exemplar shows very high affinity for PSMA ( K d ∼ 0.8 nM).
Immunoglobulin E protein IgE37-T10-FAM 0.8 nM -9.097 intrinsic     32498825 The FA assay using T10-labeled aptamer with a dissociation constant ( K d) about 0.8 nM
CCRF-CEM cells cell/EV individual sgc8 0.82 nM -9.086 non_intrinsic fluorescence   35670775 Kd=0.82 ± 0.12 nM
Tasset - thrombin complex protein Bock 0.87 nM -9.06 intrinsic BSI 283.15 22032342 Bock - [Tasset complex] | not available | 0.87 ( 0.18 nM
MPO protein MPO-14 897.0 pM -9.047 non_intrinsic flow_cytometry   37277648 MPO-14 ... K d : 897 pM
MPO protein MPO-03 912.0 pM -9.04 non_intrinsic flow_cytometry   37277648 MPO-03 ... 912
alpha-thrombin protein RNAR9D-14T 1.0 nM -9.0 intrinsic filter_binding 310.15 22385910 Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) and α-thrombin (apparent Kd =1 nM)
P-selectin protein PF422sl 1000.0 pM -9.0 intrinsic filter_binding 310.15 9743465 PF422sl | 1 X 103
neomycin protein Aptamer A 1e-09 M -9.0 intrinsic     36453647 The binding affinity of neomycin to Aptamer A shows a strong K d of 1 nM with an enthalpy and entropy value of -100 kJ/mol & -163.1 J/mol. K
Sc3+ protein Sc-1 1e-09 M -9.0 intrinsic fluorescence   39743479 true K d for the binding of Sc-1 to Sc 3+ to be 1.0 nM
PSMA protein C3 (without fluorescein) 1e-09 M -9.0 intrinsic EMSA   41126016 EMSA data show that Cy5-labeled C3 without fluorescein binds PSMA just as strongly as the parent construct, with an apparent K d of ∼ 1 nM (Figure S9).
von Willebrand factor A1-domain protein Pr-DsDsDs-40 1.03 nM -8.987 intrinsic SPR 310.15 27966933 Pr-DsDsDs-40 ( K D = 1.03 nM)
Heparin-binding protein protein Apt-13 1.04 nM -8.983 intrinsic     38675537 The KD values of the three aptamers were 3.42, 1.44, and 1.04 nM, respectively
beta-conglutin protein 11-mer 1.05e-09 M -8.979 intrinsic MST 298.15 33498970 KD values determined (Figure 6b) are very similar (11-mer: 1.05 nM
AP65 protein AP65_A1 1.057e-09 M -8.976 intrinsic ELAA 298.15 29972299 A K D value of 1.057 nM was obtained using the sigmoidal dose-response curve model
MPO protein MPO-01 1148.0 pM -8.94 non_intrinsic flow_cytometry   37277648 MPO-01 ... 1,148
PDGF-BB protein PDGF-specific aptamer 1.2e-09 M -8.921 intrinsic microcantilever 292.15 24723743 K d , as shown in Fig. 10, decreased from approximately 12 × 10 -10 M to 5 × 10 -10 M as the temperature changed from 19 to 37 ◦ C.
HBeAg protein A-9S 1.2e-09 M -8.921 intrinsic affinity_real_time_qPCR   32250595 The measured dissociation constant ( K d) is improved by 19 times  from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.
PvTRAg protein Apt_16 1.2e-09 M -8.921 intrinsic     40042916 The K D of Apt_14 and Apt_16 was found to be comparable, 1.9 and 1.2 nM, respectively
ATP protein Huizenga-Szostak ATP aptamer 1.3e-09 M -8.886 intrinsic fluorescence   25170558 binding a ffi nity can be tuned over 4 orders of magnitude (1.3 nM -203 μ M)
prothrombin protein RNAR9D-14T 1.4 nM -8.854 intrinsic SPR 298.15 22385910 Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM
PD-L1 protein 8-60 1.4 nM -8.854 intrinsic     34711320 8 e 60, a representative aptamer with high af fi nity (KD 1⁄4 1.4 nM determined by SPR)
Heparin-binding protein protein Apt-02 1.44 nM -8.842 intrinsic     38675537 The KD values of the three aptamers were 3.42, 1.44, and 1.04 nM, respectively
alkaline phosphatase protein ALP binding aptamer 1.49e-09 M -8.827 avidity_multivalent PISA   30827094 Similarly, from the response -dose curve (Figure 3B), the K d value for the aptamer -MIP hybrid-coated array was estimated to be 1.49 × 10 -9 M
thrombin protein T.7 1.5 nM -8.824 intrinsic SPR   37798416 T.7 exhibited the strongest binding signal with a 1.5 nM K d
alkaline phosphatase protein ALP binding aptamer 1.5000000000000002e-09 M -8.824 avidity_multivalent PISA   30827094 giving cross-reactivity of 3.2 -5.6% and a dissociation constant of 1.5 nM
OH-BDE47 protein BDE-A-12 1.53 nM -8.815 intrinsic     27566357 The dissociation constant (Kd) of BDE-A-8 and BDE-A-12 were 0.20 nM (~0.08 ppb) and 1.53 nM (~0.8 ppb), respectively, in PBS buffer condition.
IgE protein S2 1.5500000000000002e-09 M -8.81 intrinsic NECEEM   36144553 Based on the results of these experiments, the K D values of S1 and S2 were estimated to be 0.83 and 1.55 nM, respectively
human α-thrombin protein LOOPER modified thrombin aptamer 1.6000000000000003e-09 M -8.796 intrinsic SPR   28938065 Using single-cycle kinetics surface plasmon resonance (SPR), the LOOPER aptamer exhibited a Kd of 1.6 nM
hOX40 protein 9C7 1.7 nM -8.77 intrinsic filter_binding 310.15 23113766 9C7 | 11 | 1.7
HBeAg protein EAg3 1.7000000000000001e-09 M -8.77 intrinsic affinity_real_time_qPCR   32250595 The K d value is 0.4 nM for the HBeAg complex with the pyrrolo-dC modi fi ed aptamer EAg3, as compared to the K d value of 1.7 nM with the unmodi fi ed EAg3 aptamer.
beta-conglutin protein TT-11-mer 1.88e-09 M -8.726 intrinsic MST 298.15 33498970 KD values determined (Figure 6b) are very similar (... TT-11 mer: 1.88 nM
Bock - thrombin complex protein Tasset 1.9 nM -8.721 intrinsic BSI 283.15 22032342 Tasset - [Bock complex] | not available | 1.9 ( 0.2 nM
CD8a protein A3 1.9 nM -8.721 non_intrinsic flow_cytometry   31209354 the A1, A3 and A8 aptamers have apparent K D values of 18.3 ± 4.6, 1.9 ± 0.8 and 2.4 ± 0.9 nM, respectively
CD8 protein CD8 aptamer 1.9 nM -8.721 non_intrinsic flow_cytometry   32786336 The aptamer with the highest apparent affinity (1.9 nM) and association rate, measured by flow cytometry and biolayer interferometry, respectively, was chosen for further use in cell isolation.
VWF A1-domain protein ARC1779 2.0 nM -8.699 intrinsic filter_binding 298.15 19422452 This resulted in a final aptamer (ARC1779) that is a 40-nucleotide modified DNA/RNA oligonucleotide with a K D of 2 nM for the A1-domain.
von Willebrand factor protein 42-nt DNA aptamer 2.0 nM -8.699 intrinsic ELISA   31493779 a biotinylated DNA aptamer was able to bind an antibody-captured VWF in a concentration-dependent manner with a dissociation constant ( KD ) of 2.0 nM 0.3.
von Willebrand factor A1 domain protein ARC1779 2.0 nM -8.699 non_intrinsic     21108551 ARC1779 binds with high affinity (Kd ~ 2 nM) to the vWF A1 domain
VWF A1 domain protein ARC1779 2.0 nM -8.699 non_intrinsic     31315441 ARC1779 has a high binding affinity to VWF A1 domain (K D ≈ 2 nM)
CD8 protein A3t 2.0 nM -8.699 non_intrinsic     36149728 A3t, a CD8 receptor-binding aptamer, which binds CD8-expressing cells with an equilibrium dissociation constant K D of 2 nM.
CD8 protein rvCD8apt 2.0 nM -8.699 non_intrinsic     36149728 apparent K D = 2 nM for CD8 + cells
CD44-HABD protein Motif 4 (ADDA adduct) 2e-09 M -8.699 intrinsic     23057694 motifs 2 and 4(ADDA adduct) have ~2 nM affinity to CD44-HABD
THY1 protein XA-B217 2.0 nM -8.699 intrinsic     33242496 The equilibrium dissociation constants, Kd, were derived from these curves and are determined as ... XA-B217=2 nM
Progesterone protein PG13T2 2.1 nM -8.678 intrinsic     28237255 The dissociation constant of the PG13T2-P4 complex calculated using non-linear regression fi tting of the obtained curve was found to be 2.1 nM.
IL-23 protein A23P15 2.139 nM -8.67 intrinsic     38810331 the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively
sLe X -BSA glycan/conjugate Clone 15 2.3e-09 M -8.638 intrinsic SPR   11178986 Clone 15 | 3.5 3 10 5 | 8.1 3 10 2 4 | 4.3 3 10 8 | 2.3 3 10 2 9
alpha-fetoprotein protein AFP-specific ssDNA aptamer 2.37 nM -8.625 intrinsic     22410487 The K d of the AFP-specific ssDNA was calculated to be 2.37 nM
thrombin protein HD22 2.4e-09 M -8.62 intrinsic SPR   18826387 HD22 | Thrombin | K D ( M) | 2.4 · 10 ) 9
CD8a protein A8 2.4 nM -8.62 non_intrinsic flow_cytometry   31209354 the A1, A3 and A8 aptamers have apparent K D values of 18.3 ± 4.6, 1.9 ± 0.8 and 2.4 ± 0.9 nM, respectively
melatonin protein MLT-A-2 2.4 nM -8.62 intrinsic     36925277 K d = 2.4 ± 2.8 nM for MLT-A-2
melatonin protein MLT-A-2F 2.4 nM -8.62 intrinsic     36925277 MLT-A-2F K d = 2.4 ± 2.8 nM
MPO protein MPO-05 2584.0 pM -8.588 non_intrinsic flow_cytometry   37277648 MPO-05 ... 2,584
beta-conglutin protein 11-mer-TT 2.59e-09 M -8.587 intrinsic MST 298.15 33498970 KD values determined (Figure 6b) are very similar (... and 11-mer-TT: 2.59 nM)
Human thrombin protein Pse08-29 2.6 nM -8.585 non_intrinsic SPR   37621412 Pse(08 - 29) | 1.33 10^6 | 3.47 10^-3 | 2.6
Prostate Specific Antigen protein Apta 2.6 nM -8.585 intrinsic     25569871 The change in current is used to determine the PSA -aptamer dissociation constant KD , of ca. 2.6 nM.
Human Cardiac Troponin I protein TnIApt 23 2.69 nM -8.57 intrinsic     26003883 Finally TnIApt 23 showed beast affinity in nanomolar range (2.69 nM) toward the target protein.
beta-conglutin protein TT-11-mer-TT 2.71e-09 M -8.567 intrinsic MST 298.15 33498970 KD values determined (Figure 6b) are very similar (... TT-11-mer-TT: 2.71 nM
Neuron specific enolase protein P-5C8G 2.76 nM -8.559 intrinsic     38091739 The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively.
thrombin protein TBA 2.86e-09 M -8.544 intrinsic SPR   16053288 thrombin | 2.2 10 5 | 6.3 10 - 4 | 3.4 10 8 | 2.86 10 - 9
IL-23 protein A23P6 2.88 nM -8.541 intrinsic     38810331 the Kd values for A23P3, A23P6, and A23P15 were determined to be 1.37, 2.88, and 2.139 nM, respectively
hCD4 protein U26 2.93 nM -8.533 intrinsic qPCR 298.15 32567629 U26 exhibited the highest binding affinity ( K d = 2.93 ± 1.03 nM) to hCD4-conjugated beads.
S-adenosylmethionine protein Bs SAM-I riboswitch 3.0000000000000004e-09 M -8.523 intrinsic     23343213 Both μ MSA values agree well with results from the in-line probing assays performed using identical buffer conditions: ... 3 nM K d , respectively
S-adenosylmethionine protein Pi SAM-I riboswitch 3.0000000000000004e-09 M -8.523 intrinsic     23343213 which is on the order of the 3 nM value measured using a conventional inline probing assay
dT70 protein DCC-SSB 3.0000000000000004e-09 M -8.523 intrinsic     34085169 At a low concentration ( ∼ 2.5 nM), the titration with dT70 gave an approximate assessment of affinity ( K d ∼ 3 nM).
SARS-CoV-2 RBD protein CoV2-RBD-1 3.1000000000000005e-09 M -8.509 intrinsic flow_cytometry   32551560 the dissociation constant values ( K d) of the CoV2-RBD-1 aptamer ... were 3.1 nM
MPO protein MPO-18 3192.0 pM -8.496 non_intrinsic flow_cytometry   37277648 MPO-18 ... K d : 3,192 pM
human α-thrombin protein Apt15-T25-3'-TMR 3.2 nM -8.495 non_intrinsic CE-LIF 298.15 28763192 The apparent K d of Apt15-T25 -3 ′ -TMR was estimated to be about 3.2 nM.
K562 protein PAM 3.2 nM -8.495 non_intrinsic     32307868 the K d value (3.2 nM) of PAM in binding the K562 cell is one order of magnitude lower than that of the aptamer alone (41 nM).
sLe X glycan/conjugate Clone 5 3.3e-09 M -8.481 intrinsic SPR   11178986 sLe X | 1.7 3 10 5 | 5.5 3 10 2 4 | 3.0 3 10 8 | 3.3 3 10 2 9
transferrin receptor 1 protein JBA8.26 3.3 nM -8.481 non_intrinsic flow_cytometry   35875870 JBA8.26 bound TfR1 hi H9 T-lymphoma cells with an apparent K D of 3.3 ± 0.6 nM
human α-Thrombin protein B1 3.4 nM -8.469 intrinsic     31129134 for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)
prothrombin protein HD1 3.5e-09 M -8.456 non_intrinsic SPR   18826387 HD1 | Prothrombin+ phospholipids | K D ( M) | 3.5 · 10 ) 9
Immunoglobulin E protein Unlabeled anti-IgE aptamer 3.5 nM -8.456 intrinsic     32498825 close to the K d of the unlabeled aptamer (3.5 nM)
gonyautoxin 1/4 protein tGO18-T-d 3.6 nM -8.444 intrinsic     33294137 Corresponding Kd values of GO18-T-d and tGO18-T-d, determined by the average of 8 independent measurements, were 75.63 nM and 3.60 nM, respectively.
Surface Antigen 1 protein SOK14 3.736 nM -8.428 intrinsic     40288708 SOK14 (3.736 nM, R 2 = 0.7367)
human α-thrombin protein Tasset 3.84 nM -8.416 intrinsic BSI 283.15 22032342 Tasset - thrombin | 0.5 - 1.0 nM 14 | 3.84 ( 0.68 nM
sLe X -BSA glycan/conjugate Clone 18 3.9e-09 M -8.409 intrinsic SPR   11178986 Clone 18 | 5.1 3 10 5 | 2.0 3 10 2 3 | 2.5 3 10 8 | 3.9 3 10 2 9
Carcinoembryonic antigen protein GAC-P 3.93 nM -8.406 intrinsic     35517255 The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively.
human α-thrombin protein LOOPER modified thrombin aptamer 4e-09 M -8.398 intrinsic     28938065 Preliminary binding analysis by label-free microscale thermophoresis showed a promising dissociation constant K d = 4 nM for thrombin
Surface Antigen 1 protein SOK18 4.034 nM -8.394 intrinsic     40288708 SOK18 (4.034 nM, R 2 = 0.8422)
Surface Antigen 1 protein SOK3 4.185 nM -8.378 intrinsic     40288708 SOK3 (4.185 nM, R 2 = 0.8153)
Mouse thrombin protein Pse08-08 4.2 nM -8.377 non_intrinsic SPR   37621412 Pse(08-08) | 7.35 10^5 | 3.06 10^-3 | 4.2
CD19 protein WB15/15.CD19.1_3S 4.3 nM -8.367 non_intrinsic flow_cytometry 310.15 41079126 WB15/15.CD19.1_3S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 3.96 | N.P. | 4.3 ± 2.4
MPO protein MPO-04 4376.0 pM -8.359 non_intrinsic flow_cytometry   37277648 MPO-04 ... 4,376
melamine protein Apt M 4.4000000000000005e-09 M -8.357 intrinsic     37343019 dissociation constant K d = 4.4 nM
RAGE protein RAGE-aptamer (clone #2) 4.44 nM -8.353 intrinsic QCM   28385802 #2RAGE-aptamer | tcTgTTcAggTTggTAcggTggAAggTgTgATTcAcgAgg | 4.44±0.56
Thyroglobulin protein Seq.T-2 4.51 nM -8.346 intrinsic     33303143 kon = 3.2 × 10 5 M 1 s 1 , koff = 1.44 × 10 3 s 1 , Kd = 4.51 nM
Carcinoembryonic antigen protein P-ATG 4.62 nM -8.335 intrinsic     35517255 The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively.
Hemagglutinin (HA) protein of AIV H5N1 (A/Vietnam/1203/04) protein Aptamer sequence (2) 4.65 nM -8.333 intrinsic     23523887 the KD (dissociation constants) was 4.65 nM, indicating strong binding between the HA protein and the selected aptamer.
VEGF165 protein VEap121 4.700000000000001e-09 M -8.328 intrinsic SPR 293.15 23237717 As the calculated K d value of VEap121 was 4.7 nM
Oxytetracycline protein OTC3 4.7 nM -8.328 intrinsic     24011458 The lowest K d value (4.7 nM) was obtained with the aptamer OTC3.
SARS-CoV-2 spike RBD protein Aptx2-L 4.900000000000001e-09 M -8.31 avidity_multivalent flow_cytometry 298.15 41498844 The Aptx2-L variant showed superior affinity with a dissociation constant ( K d) of 4.9 nM
HFIXa protein Seq 11 4.93 nM -8.307 intrinsic ITC 298.15 38776649 Seq 11- | 7.4 | 0.983 | 203 ± | 4.93 | 130.6 | 279 | 47.42
Myoglobin protein Myo40-7-27 4.93e-09 M -8.307 intrinsic     24914856 The aptamer with the highest a ffi nity ( K d = 4.93 nM) was then used for the fabrication of a label-free supersandwich electrochemical biosensor for Myo detection
porcine thrombin protein RNAR9D-14T 5.0 nM -8.301 non_intrinsic filter_binding   22385910 RNAR9D-14T binds to porcine thrombin (apparent K d=5 nM)
human α-Thrombin protein B2 5.0 nM -8.301 intrinsic     31129134 for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)
transferrin receptor 1 protein JBA8.1 5.5 nM -8.26 non_intrinsic flow_cytometry   35875870 JBA8.1 has an apparent binding affinity (K D ) of 5.5 ± 1.2 nM
CD8a protein A8 5.59 nM -8.253 intrinsic BLI 298.15 31209354 the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively
sST2 protein sS9_P 5.6 nM -8.252 intrinsic     37992929 in case of sS9, parent aptamer has outperformed its truncated counterpart in terms of affinity as it has shown higher affinity (Kd ~5.6 nM).
RAGE protein RAGE-aptamer (clone #1) 5.68 nM -8.246 intrinsic QCM   28385802 #1RAGE-aptamer | ccTgATATggTgTcAccgccgccTTAgTATTggTgTcTAc | 5.68±1.10
HIV-1 Rev protein RBA-14 5.9 nM -8.229 intrinsic     30017564 RBA-14 (Figure S2A) binds to Rev with high affinity (K d = 5.9 nM) (Table S1 and Figure 2A).
human α-thrombin protein Bock 5.96 nM -8.225 intrinsic BSI 283.15 22032342 Bock - thrombin | 1.4 - 6.2 nM 19 | 5.96 ( 0.57 nM
biliverdin protein Bvd4 6.000000000000001e-09 M -8.222 intrinsic     40669049 For the biliverdin selection, the tightest affinity aptamer has a dissociation costant ( K d ) value of 6 nM determined using isothermal titration calorimetry (ITC)
Mouse thrombin protein Pse08-29 6.3 nM -8.201 non_intrinsic SPR   37621412 Pse(08 - 29) | 6.72 10^5 | 4.26 10^-3 | 6.3
human α-Thrombin protein A2 6.3 nM -8.201 intrinsic     31129134 for SCORE (b-nd analysis) the best are A2 (6.3 nM)
CD64 protein lw-27 6.676 nM -8.175 non_intrinsic flow_cytometry 310.15 42152987 Kd values of aptamers lw-1, lw-9, lw-27 are 12.76 nM, 14.03 nM, and 6.676 nM respectively
Lipopolysaccharide from Klebsiella pneumoniae ATCC 15380 protein aptamer seq. 5 6.68e-09 M -8.175 intrinsic DPV   41323700 The binding affinity of aptamer seq. 5 was 6.68 nM (Fig. 9C).
Mouse thrombin protein Lin08-08 6.7 nM -8.174 non_intrinsic SPR   37621412 Lin(08-08) | 6.41 10^5 | 4.30 10^-3 | 6.7
human β-defensin 2 protein A ad1 6.8 nM -8.167 intrinsic     32067984 As a result, A ad1 was found to bind strongly, with a K d of 6.8 nM (Fig. 2).
transferrin receptor 1 protein JBA8.26 6.87 nM -8.163 intrinsic BLI   35875870 Using BLI, JBA8.26 was found to bind immobilized TfR1 with a K D of 6.87 ± 0.04 nM
human α-Thrombin protein A3 6.9 nM -8.161 intrinsic     31129134 for SCORE (b-nd analysis) the best are A2 (6.3 nM) and A3 (6.9 nM)
Carcinoembryonic antigen protein P 6.95 nM -8.158 intrinsic     35517255 The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively.
Salmonella enteritidis protein SENT-9 7.000000000000001e-09 M -8.155 apparent_cellular     22971146 It was observed that the aptamer pool collected at the seventh round of selection had the highest binding a ffi nity to the bacteria ( K D = 7 nM).
thrombin protein HD1 7.1e-09 M -8.149 intrinsic SPR   18826387 HD1 | Thrombin | K D ( M) | 7.1 · 10 ) 9
PTK7 protein 4AsF 7.2 nM -8.143 intrinsic SPR 310.15 41065179 4AsF, which exhibited a 10-fold reduction compared to 4APS (0.77 vs 7.20 nM)
VEGF165 protein cot-pega 7.33 nM -8.135 intrinsic     26956592 The K D of cot-pega for VEGF was 7.33 nM (Fig. 1b)
Carcinoembryonic antigen protein P-GTG 7.33 nM -8.135 intrinsic     35517255 The K d value for P-ATG, GAC-P, P-GTG, and P was determined to be 4.62 nM, 3.93 nM, 7.33 nM, and 6.95 nM, respectively.
sLe X -BSA glycan/conjugate Clone 4 7.4e-09 M -8.131 intrinsic SPR   11178986 Clone 4 | 4.1 3 10 5 | 3.1 3 10 2 3 | 1.3 3 10 8 | 7.4 3 10 2 9
human α-Thrombin protein B3 7.6 nM -8.119 intrinsic     31129134 for MST the B aptamers (B1: 3.4 nM, B2: 5 nM, B3: 7.6 nM)
Surface Antigen 1 protein SOK16 7.6 nM -8.119 intrinsic     40288708 SOK16 (7.6 nM, R 2 = 0.8704)
murine OX40 protein 9.8 8.0 nM -8.097 intrinsic filter_binding   18635004 Aptamer 9.8 was chosen for further study, since it had the highest affinity for the OX40 fusion protein.
Cu2+ protein Co-1 8e-09 M -8.097 intrinsic     40656531 The corresponding true K d values were ... 8 nM for Cu 2+
human α-Thrombin protein A3 8.0 nM -8.097 intrinsic     31129134 For BLI it was found that aptamer A3 (8 nM and 25.5 nM) is the best binder
EsxG protein G43 8.04 nM -8.095 intrinsic     24813997 The dissociation constants of the G43 and G78 aptamers were 8.04 ± 1.90 and 78.85 ± 9.40 nM, respectively.
NP protein NP-C04 8.1e-09 M -8.092 intrinsic fluorescence   30740973 the K d values of NP-D01, NP-C04, and NP-D02 were 76..1 ± 10.9, 8.1 ± 2.4, and 41.3 ± 9.5 nM, respectively.
digoxin protein D1 8.2e-09 M -8.086 intrinsic     23021809 Binding studies of fluorescein-labeled truncated (without primer binding region) D1 and D2 and full length D1 anti-digoxin aptamers were performed and their corresponding dissociation constants values were 8.2 × 10 -9 , 44.0 × 10 -9 and 17.8 × 10 -9 M, respectively.
EN2 protein EBA 8.26 nM -8.083 intrinsic     35798816 EBA had K d = 8.26 nM (R 2 = 0.971)
human thrombin protein Azo-1 8.3 nM -8.081 intrinsic     33039563 The K d values of Azo-1 binding to human thrombin were calculated to be around 3.1 and 8.3 nM before and after irradiation, respectively. However, the reproducibility of K d value measurements is poor (n = 3; S.D. = 2.2 and 5.1 nM, respectively).
human β-defensin 2 protein A ad1-3 8.4 nM -8.076 intrinsic     32067984 In contrast, a clone with a 5 ʹ terminal truncation (A ad1 -3 , 69mer, Fig. 4a) could bind to HBD-2 with roughly the same strength as the original sequence ( K d = 8.4 nM, Fig. 4c).
Okadaic Acid protein OA-LC2-TF 8.735 nM -8.059 intrinsic BLI   36322695 The terminal-fixed OA-LC2 (OA-LC2-TF) exhibited a K d of 8.735 ± 0.606 nM
MPO protein MPO-25 8778.0 pM -8.057 non_intrinsic flow_cytometry   37277648 MPO-25 ... K d : 8,778 pM
human α-thrombin protein 5'-TMR-T25-Apt15 8.8 nM -8.056 non_intrinsic CE-LIF 298.15 28763192 The apparent K d values of T25-Apt15-3 ′ -TMR and 5 ′ -TMR-T25-Apt15 were estimated as 228 nM and 8.8 nM, respectively
MPT64 protein aptamer sequence (17) 8.92 nM -8.05 intrinsic     28454652 KD (dissociation equilibrium constant) was 8.92 nM
Streptococcus pyogenes M-type mixture protein 20A24P 9.000000000000001e-09 M -8.046 apparent_cellular flow_cytometry   21504182 Two aptamers, 20A24P and 15A3P (with estimated binding dissociation constants of 9 and 10 nM, respectively)
TAR RNA protein TAR RNA aptamer (best binding) 9.000000000000001e-09 M -8.046 intrinsic     39167715 A Biolayer Interferometry (BLI) experiment revealed that TAR RNA aptamers with the best binding affinity exhibited the dissociation constant ( K D) at 9 nM
HBeAg protein EAg2 9.2e-09 M -8.036 intrinsic affinity_real_time_qPCR   32250595 A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1, 9.2 nM for EAg2
human α-Thrombin protein B1 9.2 nM -8.036 intrinsic     31129134 For SCORE (Anabel analysis) the best is B1 (9.2 nM)
CD19 protein WB15/15.CD19.1_2S 9.5 nM -8.022 non_intrinsic flow_cytometry 310.15 41079126 WB15/15.CD19.1_2S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 2.64 | 356 ± 534 | 9.5 ± 5.0
HBeAg protein EAg1 9.5e-09 M -8.022 intrinsic affinity_real_time_qPCR   32250595 A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0, 9.5 nM for EAg1
SP6 RNA polymerase protein S05 9.5 nM -8.022 intrinsic     22426482 The dissociation constant and 50% inhibitory concentration of the aptamer were estimated 9.5 nM and 24.8 nM, respectively.
PDGFR β protein Gint4.T 9.6 nM -8.018 intrinsic filter_binding   24566984 This aptamer is able to specifically bind to the human PDGFR β ectodomain (Kd: 9.6 nM)
thrombin protein 3G 9.8 nM -8.009 intrinsic MST   33614235 3G | 52.9 | 9.8 ± 0.6 | 3.34
α-thrombin protein TBA-iT7 9.9 nM -8.004 non_intrinsic SPR 298.15 30735210 TBA-iT7 | 9.9
sLe X -BSA glycan/conjugate Clone 9 1e-08 M -8.0 intrinsic SPR   11178986 Clone 9 | 3.5 3 10 5 | 3.1 3 10 2 3 | 9.5 3 10 7 | 1.0 3 10 2 8
prothrombin protein RNAR9D-14T 10.0 nM -8.0 intrinsic filter_binding 310.15 22385910 Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM)
hOX40 protein 11F11 10.0 nM -8.0 intrinsic filter_binding 310.15 23113766 11F11 | 8 | 10
Streptococcus pyogenes M-type mixture protein 15A3P 1e-08 M -8.0 apparent_cellular flow_cytometry   21504182 Two aptamers, 20A24P and 15A3P (with estimated binding dissociation constants of 9 and 10 nM, respectively)
streptavidin protein S8 1e-08 M -8.0 intrinsic     30520292 At pH 7.4, we determined that S8 has a K d of 10 nM
bevacizumab protein A14#1 10.0 nM -8.0 intrinsic     35114463 One of the three mutants, A14#1_GC2, showed higher affinity than A14#1 ( K D = 10 nM, Supplementary Fig. S3a).
MPO protein MPO-08 10050.0 pM -7.998 non_intrinsic flow_cytometry   37277648 MPO-08 ... 10,050
Neuron specific enolase protein P-4A29C 10.13 nM -7.994 intrinsic     38091739 The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively.
trastuzumab protein CH1S-3 1.0300000000000001e-08 M -7.987 intrinsic MST 298.15 32516525 a ffi nity with a K d value of aptamer CH1S-3 of 10.3 nM
Sc3+ protein Sc-1 1.0300000000000001e-08 M -7.987 intrinsic fluorescence   39743479 an apparent K d value of 10.3 nM was obtained
CD8 protein CD8AP17 10.59 nM -7.975 non_intrinsic flow_cytometry 277.15 23791505 Kd=10.59 nM
thrombin protein 3Leu 10.9 nM -7.963 intrinsic MST   33614235 3Leu | 54.3 | 10.9 ± 0.2 | 4.15
transferrin receptor 1 protein tJBA8.1 10.9 nM -7.963 non_intrinsic flow_cytometry   35875870 versus that of 10.9 ± 2.4 nM for tJBA8.1
CD19 protein WB15/15.CD19.1_1S 11.0 nM -7.959 non_intrinsic flow_cytometry 310.15 41079126 WB15/15.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 125 ± 68 | 11 ± 6.1
17 β -Estradiol protein 22-mer aptamer 1.1000000000000001e-08 M -7.959 intrinsic     25803717 new 35-mer and 22-mer aptamers were generated with K D ' s of 14 and 11 nM
PLN 1-32 protein RNA-Apt30 11.0 nM -7.959 intrinsic     25240642 Such binding was dependent on the concentration of aptamer, with a dissociation constant ( K d) of 11 nM (Fig. 2A).
25-HydroxyvitaminD3 protein VDBA14 11.0 nM -7.959 intrinsic     27520502 the dissociation constants (Kd) of the VDBA14 was estimated to be 11 nM based on a non-linear regression method.
β-conglutin protein unmodified β-CBA II aptamer 11.1 nM -7.955 intrinsic     36354481 with a similar KD of 11.1 nM and 18.5 nM obtained for the unmodified and modified aptamer, respectively.
CD8 protein CD8AP17 11.23 nM -7.95 non_intrinsic flow_cytometry 277.15 23791505 The binding affinity of CD8AP17 to Sup-T1 cells ( K d 5 11.23 nM)
MPO protein MPO-06 11223.0 pM -7.95 non_intrinsic flow_cytometry   37277648 MPO-06 ... 11,223
thrombin-HRP protein TBA 1.13e-08 M -7.947 intrinsic SPR   16053288 thrombin-HRP | 6.7 10 4 | 7.6 10 - 4 | 8.7 10 7 | 1.13 10 - 8
Immunoglobulin E protein IgE37-T10-FAM (4-bp truncated) 11.4 nM -7.943 intrinsic     32498825 When 4-base pairs and 5-base pairs were truncated from the stem, the K ds of the aptamers increased to 11.4 nM and 90.5 nM, respectively.
α-thrombin protein TBA-iT9 11.5 nM -7.939 non_intrinsic SPR 298.15 30735210 TBA-iT9 | 11.5
Thyroid-Stimulating Hormone Receptor (TSHR) 6X His tag protein ZMXLY-2a 11.5 nM -7.939 non_intrinsic flow_cytometry   40588369 As determined by flow cytometry, the K d of ZMXLY-2a was 11.5 ± 9.3 nM (Figure 2G)
thrombin protein 3L 11.6 nM -7.936 intrinsic MST   33614235 3L | 51.5 | 11.6 ± 0.5 | 5.28
CTLA-4 protein aptCTLA-4 11.84 nM -7.927 intrinsic     28918052 dissociation constant (Kd) being 11.84 nM
Salmonella typhimurium protein NTri-triApt 1.1890000000000001e-08 M -7.925 avidity_multivalent ELISA 310.15 37893744 the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively
LPS protein NH2-5'-CTT CTG CCC GCC TCC TTC CTAG CCG GAT CGC GCT GGC CAG ATG ATA TAA AGG GTC AGC CCC CCA -GGA GAC GAG ATA GGC GGA CAC T-3' 11.9 nM -7.924 intrinsic     22182428 Amine-terminated aptamer exhibiting high affinity ( K d = 11.9 nM) to LPS
streptavidin protein SA23 12.0 nM -7.921 intrinsic     23312325 The respective Kd values for streptavidin binding in the monofunctional aptamer ... were 12 nM
coat protein of grouper nervous necrosis virus protein A5 12.0 nM -7.921 intrinsic     26892075 calculated binding affinities ( Kd ) of 12 nM for A5
bevacizumab protein A14#1 12.0 nM -7.921 intrinsic     35114463 A14#1 showed binding capacity with K D = 12 nM.
thrombin protein Uyne A - AUyne 12.16 nM -7.915 intrinsic BLI   37531184 U yne A - AUyne | 12.16 ± 0.02
U87MG GBM with IDH1 htz mutation protein Gli-55 1.22e-08 M -7.914 apparent_cellular flow_cytometry 298.15 39682297 The apparent dissociation constant measured for U87MG GBM with the IDH1 htz mutation ( Kd ) of Gli-55 is 12.2 nM
α-thrombin protein TBA-G8-iT8 12.4 nM -7.907 non_intrinsic SPR 298.15 30735210 TBA-G8-iT8 | 12.4
RAGE protein RAGE-aptamer (clone #3) 12.44 nM -7.905 intrinsic QCM   28385802 #3RAGE-aptamer | tTccAcTgAgTgccgcggAcTgTTgTTgggAggTggTgTg | 12.44±1.52
CD64 protein lw-1 12.76 nM -7.894 non_intrinsic flow_cytometry 310.15 42152987 Kd values of aptamers lw-1, lw-9, lw-27 are 12.76 nM, 14.03 nM, and 6.676 nM respectively
CD8 protein CD8AP17s 12.86 nM -7.891 non_intrinsic flow_cytometry 277.15 23791505 Kd=12.86 nM
HIV-1 Rev protein Stem IIB 12.9 nM -7.889 intrinsic     30017564 The 35-nt hairpin with the Stem IIB sequence (Figure S2B) binds to Rev with a similar affinity (K d = 12.9 nM) (Table S1 and Figure 2B).
human α-thrombin protein 5'-TMR-Apt15-T18 13.0 nM -7.886 non_intrinsic CE-LIF 298.15 28763192 the apparent dissociation constants ( K d) of TMR-labeled Apt15 having polyT tail with length ranging from 18 to 35 T were estimated and are summarized in Figure 1C: 13 nM for 5 ′ -TMR-Apt15-T18
sST2 protein sS9_P 13.0 nM -7.886 intrinsic     37992929 The best performing aptamer candidate sS9_P (80mer) has shown affinity in low nanomolar range (~5.6 nM in ALISA and ~13 nM in ITC)
PlanarAu protein 1N truncated 1.304e-08 M -7.885 intrinsic QCM   30189130 1N truncated (Kd = 13.04 nM)
Bisphenol A protein 38-mer BPA aptamer 13.17 nM -7.88 intrinsic     32113141 The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM
Staphylococcal enterotoxin A protein Apt5 13.36 nM -7.874 intrinsic     38762575 The aptamer with the highest affinity showed an experimental dissociation constant (K D) of 13.36 ± 18.62 nM.
CD25 protein Apt51 13.4 nM -7.873 intrinsic     29055191 Using non-linear regression analysis, the Kd of Apt51 and Apt70 aptamers were found to be 13.4 nM and 138.6 nM, respectively
Staphylococcal enterotoxin D protein Aptamer 1 13.43 nM -7.872 intrinsic     39894103 The KD of the aptamer for SED was determined using SPR and ELASA. The KD values were calculated as 4.4 ± 2.26 nM and 13.43 nM, respectively.
SARS-CoV-2 RBD protein CoV2-RBD-4 1.3600000000000001e-08 M -7.866 intrinsic flow_cytometry   32551560 the dissociation constant values ( K d) of the ... CoV2-RBD-4 aptamer ... were ... 13.6 nM
U87MG GBM with IDH1 htz mutation protein Gli-35 1.3600000000000001e-08 M -7.866 apparent_cellular flow_cytometry 298.15 39682297 while for Gli-35, it is 13.6 nM.
thrombin protein Uyne A - Uyne Uyne 13.96 nM -7.855 intrinsic BLI   37531184 U yne A - U yne U yne | 13.96 ± 0.03
Le A protein Clone 5 1.4e-08 M -7.854 intrinsic SPR   11178986 Le A | 7.3 3 10 2 | 1.0 3 10 2 5 | 7.2 3 10 7 | 1.4 3 10 2 8
IL4Rα protein cl.42 14.0 nM -7.854 intrinsic FACS   22282665 The calculated K d (14 nM, Fig. 2D) was within the range of anti -IL4R a antibodies
CD20 protein WB1/1.CD20.1_3S 14.0 nM -7.854 non_intrinsic flow_cytometry 310.15 41079126 WB1/1.CD20.1_3S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 3.96 | 15 ± 7.4 | 14 ± 8.3
17 β -Estradiol protein 35-mer aptamer 1.4000000000000001e-08 M -7.854 intrinsic     25803717 new 35-mer and 22-mer aptamers were generated with K D ' s of 14 and 11 nM
Oxytetracycline protein OTC16 14.0 nM -7.854 intrinsic     24011458 The other 3 aptamers, that is, OTC6, OTC9, and OTC16, showed higher K d values, that is, 9.5, 8.0, and 14.0 nM, respectively
CD64 protein lw-9 14.03 nM -7.853 non_intrinsic flow_cytometry 310.15 42152987 Kd values of aptamers lw-1, lw-9, lw-27 are 12.76 nM, 14.03 nM, and 6.676 nM respectively
enrofloxacin protein Apt58 14.19 nM -7.848 intrinsic     29574118 The obtained Kd of Apt58 and Apt6, with non-linear regression analysis, were 14.19 nM and 50.77 nM, respectively.
Escherichia coli O157:H7 protein E. coli O157:H7-specific aptamer 1.4400000000000002e-08 M -7.842 apparent_cellular fluorescence 298.15 41850902 the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM).
thrombin protein 3Ser 14.6 nM -7.836 intrinsic MST   33614235 3Ser | 51.7 | 14.6 ± 0.3 | 2.51
CD8a protein A3 14.7 nM -7.833 intrinsic BLI 298.15 31209354 the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively
Neuron specific enolase protein P-4G10T 14.82 nM -7.829 intrinsic     38091739 The dissociation constant ( K d) of these candidates to NSE was determined to be 10.13 nM, 14.82 nM, and 2.76 nM, respectively.
human immunoglobulin E protein T40-AptIgE-3'-TMR 15.0 nM -7.824 non_intrinsic CE-LIF 298.15 28763192 The K d of T40-AptIgE-3 ′ -TMR was about 15 nM
CD20 protein WB1/1.CD20.1_3S 15.0 nM -7.824 non_intrinsic flow_cytometry 277.15 41079126 WB1/1.CD20.1_3S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 3.96 | 15 ± 7.4 | 14 ± 8.3
thrombin protein TBA15-AnBtz 1.5000000000000002e-08 M -7.824 intrinsic     37857354 apparent dissociation constant ( K d ) of 15 nM
XBP1 protein R6 pool 15.0 nM -7.824 intrinsic     26874109 dissociation equilibrium constant equal to 15 nM
hexahistidine peptide protein AptHis-1 15.0 nM -7.824 intrinsic     32739349 the Kd was as low as 15 nM (Table S1)
hexahistidine peptide protein AptHis-2 15.0 nM -7.824 intrinsic     32739349 the Kd was as low as 15 nM (Table S1)
hexahistidine peptide protein AptHis-3 15.0 nM -7.824 intrinsic     32739349 the Kd was as low as 15 nM (Table S1)
THY1 protein XA-A9 15.0 nM -7.824 intrinsic     33242496 The equilibrium dissociation constants, Kd, were derived from these curves and are determined as XA-A9=15 nM
Dinophysistoxin protein DTX-SL1-TF 15.45 nM -7.811 intrinsic BLI   36322695 DTX-SL1-TF showed a K d of 15.45 ± 1.92 nM
human α-Thrombin protein B1 15.7 nM -7.804 intrinsic     31129134 for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)
α-thrombin protein TBA-iT7 15.9 nM -7.799 non_intrinsic SPR 298.15 30735210 TBA-iT7 | 15.9
N-acetyl-5-hydroxytryptamine protein MLT-A-4F 0.016 μM -7.796 intrinsic     36925277 for NAT very low K d value was observed i.e., 0.016 μM
fibrin protein FA 16.6 nM -7.78 non_intrinsic microscale thermophoresis   33395250 Interestingly, it was determined that FA has a higher a ffi nity toward fi brin, with the K d of 16.6 nM
sLe A glycan/conjugate Clone 5 1.7e-08 M -7.77 intrinsic SPR   11178986 sLe A | 1.2 3 10 3 | 1.9 3 10 2 5 | 5.9 3 10 7 | 1.7 3 10 2 8
CD19 protein WB17/17.CD19.1_3S 17.0 nM -7.77 non_intrinsic flow_cytometry 310.15 41079126 WB17/17.CD19.1_3S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 3.96 | 18 ± 6.4 | 17 ± 5.5
Progesterone protein P4G13 1.7e-08 M -7.77 intrinsic     25486123 The dissociation constant of the best aptamer, designated as P4G13, was estimated to be 17 nM by electrochemical impedance spectroscopy (EIS) as well as fl uorometric assay.
VEGF-165 protein bivalent construct for VEGF-165 (no linker) 1.7e-08 M -7.77 avidity_multivalent     27043498 this bivalent construct had about 28-fold higher binding affinity ( K D = 17 nM)
human α-Thrombin protein A2 17.0 nM -7.77 intrinsic     31129134 for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)
hnRNP A1 protein AS1411 1.75e-08 M -7.757 intrinsic BLI   38784467 for AS1411, the K d value was 17.5 nM (Fig. 6B)
human α-Thrombin protein B3 17.6 nM -7.754 intrinsic     31129134 for SPR A2, B1 and B3 lay in the upper range (17 nM, 15.7 nM, 17.6 nM)
GTX1/4 protein GO18-T-d 17.7 nM -7.752 intrinsic     26802576 we truncated GTX1/4 aptamer and obtained the aptamer core sequence with a higher K d of 17.7 nM.
digoxin protein D1 1.78e-08 M -7.75 intrinsic     23021809 Truncated (without primer binding region) D1, truncated D2 and full length D1 were bound to digoxin-BSA with Kd value of 8.2 × 10 -9 , 44 × 10 -9 and 17.8 × 10 -9 M, respectively
CD19 protein WB17/17.CD19.1_3S 18.0 nM -7.745 non_intrinsic flow_cytometry 277.15 41079126 WB17/17.CD19.1_3S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 3.96 | 18 ± 6.4 | 17 ± 5.5
CD8a protein A1 18.3 nM -7.738 non_intrinsic flow_cytometry   31209354 the A1, A3 and A8 aptamers have apparent K D values of 18.3 ± 4.6, 1.9 ± 0.8 and 2.4 ± 0.9 nM, respectively
β-conglutin protein biotinylated dUTPs aptamer 18.5 nM -7.733 intrinsic     36354481 with a similar KD of 11.1 nM and 18.5 nM obtained for the unmodified and modified aptamer, respectively.
Escherichia coli O157:H7 protein E. coli O157:H7-specific aptamer 1.92e-08 M -7.717 apparent_cellular fluorescence 298.15 41850902 the aptamer exhibited enhanced binding affinity in the crowded microenvironment, with a 25% reduction in Kd (from 19.2 to 14.4 nM).
LDL-R protein RNV-L7 19.6 nM -7.708 intrinsic     31841991 RNV-L7 aptamer showed speci fi c binding to its LDL-R target with a binding af fi nity value of 19.6 nM.
CD19 protein WB17/17.CD19.1_4S 20.0 nM -7.699 non_intrinsic flow_cytometry 310.15 41079126 WB17/17.CD19.1_4S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 5.28 | 21 ± 13 | 20 ± 12
hMMP-9 protein F3Bomf 2e-08 M -7.699 intrinsic SPR 296.15 23043415 The K d was taken as the concentration leading to half saturation, i.e., about 20 nM.
hMMP-9 protein F3 2e-08 M -7.699 intrinsic     23043415 exhibits a strong a ffi nity for hMMP-9 ( K d = 20 nM)
xanthylacrylamide protein XAA-1 2e-08 M -7.699 intrinsic     40261307 The true K d of aptamer XAA-1 was calculated to be 20 nM after accounting for the competitive effect of the quencher-labeled strand
CD8a protein A1 20.1 nM -7.697 intrinsic BLI 298.15 31209354 the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively
thrombin protein TBA 20.2 nM -7.695 intrinsic MST   33614235 TBA | 50.7 | 20.2 ± 1.3 | 4.81
thrombin protein 12G 20.7 nM -7.684 intrinsic MST   33614235 12G | 53.4 | 20.7 ± 2.8 | 2.88
hexahistidine peptide protein AptHis-C 20.8 nM -7.682 intrinsic     32739349 its dissociation constant was as low as 20.8 nM
CD19 protein WB17/17.CD19.1_4S 21.0 nM -7.678 non_intrinsic flow_cytometry 277.15 41079126 WB17/17.CD19.1_4S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 5.28 | 21 ± 13 | 20 ± 12
hnRNP A1 protein TBA 2.1100000000000004e-08 M -7.676 intrinsic BLI   38784467 for TBA, the K d value was 21.1 nM (Fig. 6A)
saxitoxin protein 45e 21.2 nM -7.674 intrinsic     35324725 aptamer 45e with a K d value of 21.2 nM
thrombin protein 3Ala 21.4 nM -7.67 intrinsic MST   33614235 3Ala | 50.9 | 21.4 ± 2.8 | 3.67
SARS-CoV-2 spike RBD protein Aptx2-S 2.17e-08 M -7.664 avidity_multivalent flow_cytometry 298.15 41498844 compared to 21.7 nM for Aptx2-S
Dinophysistoxin protein DTX-SL1 21.75 nM -7.663 intrinsic BLI   36322695 DTX-SL1 showed the lowest K d at 21.75 ± 1.42 nM
CD117 protein Apta02 21.8 nM -7.662 intrinsic BLI 298.15 40487293 Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 µ m, respectively ( Figure 2 a,b).
SARS-CoV-2 spike trimer protein S14 21.8 nM -7.662 intrinsic     34188971 The aptamer S14 evinced 3-fold higher affinity (KD = 21.8 nM) then S1 (KD = 68.9 nM).
GTX1/4 protein GO18-T-d 21.9 nM -7.66 intrinsic     26802576 Therefore, we further removed inactive nucleotides from GO18-T-a and obtained the core aptamer sequence GO18-T-d with a K d of 21.9 nM
Mouse thrombin protein TBA29 22.0 nM -7.658 intrinsic SPR   37621412 TBA29 | 2.76 10^5 | 6.07 10^-3 | 22.0
thrombin protein 3Phe 22.6 nM -7.646 intrinsic MST   33614235 3Phe | 54.3 | 22.6 ± 4.8 | 3.39
M2-like macrophage protein A2 22.81 nM -7.642 non_intrinsic flow_cytometry 277.15 32589412 apparent dissociation constants ( K d ) of 44.12 ± 8.0 and 22.81 ± 5.6 nM to M0- and M2-like macrophages, respectively
HBeAg protein A-9 2.29e-08 M -7.64 intrinsic affinity_real_time_qPCR   32250595 The measured dissociation constant ( K d) is improved by 19 times  from a K d value of 22.9 nM with the 80-nt sequence to a K d of 1.2 nM with the new 61-nt aptamer.
prometryn protein P60-1 23.0 nM -7.638 intrinsic     37453395 The Kd value of P60-1 aptamer for prometryn was approximately 23 nM
beta-conglutin protein 11-mer 2.3300000000000003e-08 M -7.633 intrinsic BLI 303.15 33498970 A 2:1 heterogenous model was used to fit the data and calculate the binding affinities resulting in two different KD values of 6.95 and 23.30 nM.
Neuron specific enolase protein P 23.83 nM -7.623 intrinsic     38091739 Each of them exhibited higher affinity to NSE than the parent aptamer ( K d = 23.83 nM).
Le X protein Clone 5 2.4e-08 M -7.62 intrinsic SPR   11178986 Le X | 6.7 3 10 2 | 1.6 3 10 2 5 | 4.1 3 10 7 | 2.4 3 10 2 8
CD19 protein WB17.CD19 24.0 nM -7.62 non_intrinsic flow_cytometry 310.15 41079126 WB17.CD19 | 5'-AGAGACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGTGGCTTCTT-3' | - | N.P. | 24 ± 4.1
melamine protein Mel36-1 2.4000000000000003e-08 M -7.62 non_intrinsic   298.15 42261635 Mel36-1 has the most sensitive response with an apparent K d of 24 nM
Cry j 2 protein CJ2-06 24.0 nM -7.62 intrinsic     25083924 Scatchard analysis based on ELONA showed that BioCJ206 exhibited a high af fi nity for Cry j 2 with a dissociation constant of 24 nM
prostate-cancer-derived small extracellular vesicles cell/EV seq25 24.02 nM -7.619 non_intrinsic SPR   41646885 The affinity of seq25 for positive selection was significantly higher than that of the other aptamers, with a KD of 24.02 nM
NMP22 protein NT2a 2.4260000000000003e-08 M -7.615 intrinsic MST   42173503 The K d values were also determined using MicroScale Thermophoresis (MST), and the K d values of NT2a and NT4a were determined to be 24.26 ± 10.47 and 77.29 ± 25.78 nM (Figures 2d and S3).
MPO protein MPO-34 24910.0 pM -7.604 non_intrinsic flow_cytometry   37277648 MPO-34 ... K d : 24,910 pM
murine OX40 protein 11.2 25.0 nM -7.602 intrinsic filter_binding   18635004 11.2 | AUACCAGGAUCACAUCCUGAGGAACCCCGGCUCCCAACCU | 25 | 4
murine OX40 protein 11.4 25.0 nM -7.602 intrinsic filter_binding   18635004 11.4 | CUUUAAUCCUCGCACUCAGCGCGCAUCACCCUUGACAUCA | 25 | 5
murine OX40 protein 9.3 25.0 nM -7.602 intrinsic filter_binding   18635004 9.3 | CAAACCAGCUAUUUCCUGAGGUACCCCGGCUCUCCAUGG | 25 | 4
CD20 protein WB1/1.CD20.1_4S 25.0 nM -7.602 non_intrinsic flow_cytometry 277.15 41079126 WB1/1.CD20.1_4S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 5.28 | 25 ± 12 | 65 ± 38
CD19 protein WB15/17.CD19.1_3S 25.0 nM -7.602 non_intrinsic flow_cytometry 310.15 41079126 WB15/17.CD19.1_3S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 3.96 | N.P. | 25 ± 7.1
Salmonella typhimurium protein STYP-3 2.5000000000000002e-08 M -7.602 apparent_cellular     23075417 It was observed that the aptamer pool collected at the seventh round of selection had the highest binding a ffi nity to the bacteria ( K D = 25 nM).
S-adenosylmethionine protein Bs SAM-I riboswitch 2.5000000000000002e-08 M -7.602 intrinsic     23343213 Both μ MSA values agree well with results from the in-line probing assays performed using identical buffer conditions: 25 nM K d
16mer peptide from collagen XI alpha 1 chain protein D1 25.0 nM -7.602 intrinsic     34815029 The K d values were identical (about 25 nM)
16mer peptide from collagen XI alpha 1 chain protein C1 25.0 nM -7.602 intrinsic     34815029 The K d values were identical (about 25 nM)
transferrin receptor 1 protein tJBA8.1 25.11 nM -7.6 intrinsic BLI   35875870 tJBA8.1 bound the TfR1 protein with a K D value of 25.11 ± 0.19 nM
rmCD3 d ε protein CD3_Apt1 dimer 25.2 nM -7.599 non_intrinsic BLI 298.15 38745854 The affinity of the dimeric aptamer was determined by OCTET and was 25.2 nM for Apt1 dimer
Sterigmatocystin protein H Seq02 2.53e-08 M -7.597 intrinsic ITC   38175632 The final fitting curve showed a reduced chi-squared (kcal/mol) 2 of 0.871, and the K D value was 25.3 nM.
human α-Thrombin protein A3 25.5 nM -7.593 intrinsic     31129134 For BLI it was found that aptamer A3 (8 nM and 25.5 nM) is the best binder
transferrin receptor 1 protein tJBA8.1 25.6 nM -7.592 non_intrinsic flow_cytometry   35875870 compared to tJBA8.1's apparent K D of 25.6 ± 13.0 nM for these cells
Staphylococcal enterotoxin B protein A2 26.0 nM -7.585 intrinsic     25624325 A2 and A11 both bound with high affinity to SEB, with dissociation constants of 26 nM and 64 nM, respectively
adenosine monophosphate protein AMP aptamer 26.0 nM -7.585 intrinsic     35934372 BHQ-2-(NH2)2 binds DNA aptamer for AMP with KD = 26 nM.
human α-Thrombin protein A2 26.4 nM -7.578 intrinsic     31129134 for iRIf aptamer A2 is the best (26.4 nM)
Bisphenol A protein 12-mer BPA aptamer 27.05 nM -7.568 intrinsic     32113141 The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM
thrombin protein 3Nic 27.1 nM -7.567 intrinsic MST   33614235 3Nic | 52.1 | 27.1 ± 4.2 | 3.69
thrombin protein 12L 27.2 nM -7.565 intrinsic MST   33614235 12L | 51.0 | 27.2 ± 3.0 | 4.17
α-thrombin protein TBA 27.2 nM -7.565 non_intrinsic SPR 298.15 30735210 TBA | 27.2
MPO protein MPO-07 27751.0 pM -7.557 non_intrinsic flow_cytometry   37277648 MPO-07 ... 27,751
thrombin protein HD22 (TA-TT) 27.8 nM -7.556 intrinsic BLI   37531184 TA - TT | 27.80 ± 0.09
FGFR3 K650E protein SU-3 2.82e-08 M -7.55 intrinsic SPR   31265241 The predicted K D was 28.2 × 10 -9 ± 19.6 × 10 -9 M( n = 5) in 1 × PBS bu ff er, using 1:1 Langmuir binding model.
CD71 protein rvCD71apt 28.5 nM -7.545 non_intrinsic flow_cytometry 277.15 36149728 rvCD71apt binds at a high affinity to both activated CD4 + and CD8 + T cells, with apparent K D around 28.5 and 35 nM, respectively (Figure 4A,B).
hOX40 protein 9C7T 29.0 nM -7.538 intrinsic filter_binding 310.15 23113766 observed Kd of * 29nM
dT35 protein DCC-SSB 2.9e-08 M -7.538 intrinsic     34085169 The second stage was fitted to a hyperbola to give a K d value of 29 nM.
thrombin protein 3Amide 29.2 nM -7.535 intrinsic MST   33614235 3Amide | 52.6 | 29.2 ± 0.4 | 4.17
Thrombin protein aptamer 2S 2.9400000000000002e-08 M -7.532 intrinsic SPR   32268723 The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 μM and 29.4 nM, respectively
verrucarin A protein Ver1_JYP 2.9500000000000003e-08 M -7.53 intrinsic fluorescence   39404132 The novel ssDNA aptamer exhibited a binding affinity of 29.5 nM
thrombin protein 3Bz 30.0 nM -7.523 intrinsic MST   33614235 3Bz | 52.3 | 30.0 ± 6.6 | 4.54
L-TAR RNA protein D-6-4t 3.0000000000000004e-08 M -7.523 intrinsic     23977945 The Kd of in vitro transcribed D-6-4t for L-TAR is 30 nM
Nucleolin (NCL) protein rG4-C8 (short loop) 30.0 nM -7.523 intrinsic     31325486 The K D values for the binding interaction between the short loop (112) rG4 and its rG4-C8 complex with NCL were 309 ± 45 nM and 30 ± 22 nM, respectively.
thrombin protein 12Amide 30.6 nM -7.514 intrinsic MST   33614235 12Amide | 51.2 | 30.6 ± 6.1 | 3.97
Mycobacterium tuberculosis H37Rv protein NK2 31.0 nM -7.509 non_intrinsic flow_cytometry   21643749 | NK2 | 31 ± 4 |
Ciprofloxacin protein R10K6 3.1e-08 M -7.509 intrinsic     30609709 a dissociation constant (KD) for the RNA-ligand complex of 31 nM was determined.
Clenbuterol protein CLB-2 3.1e-08 M -7.509 intrinsic     42204903 The ITC of the CLB2 aptamer showed a complex pattern with a fitted K d of 31 nM (Figure S4)
tetrodotoxin protein A36 32.4 nM -7.489 intrinsic     40435760 Aptamer A36, which exhibited high binding affinity (32.4 nM) and stability ( Δ G = 2.58 kcal/mol), was identified as the optimal TTX aptamer.
PDGF-C protein α-PC 33.0 nM -7.481 intrinsic SPR   42138517 SPR analysis demonstrated that the α -PC aptamer bound tightly to mouse PDGF-C with a high affinity ( KD = 33 nM
Thrombin protein Antithrombin aptamer 3.3000000000000004e-08 M -7.481 intrinsic     31580650 Antithrombin aptamer with KD of 33 nM was successfully isolated by four rounds of MCP-SELEX.
Alpha-fetoprotein protein Group I aptamer 33.0 nM -7.481 intrinsic     22166203 The aptamer interacted with the AFP with a K D of 33 nM.
α-thrombin protein TBA-iT3 33.9 nM -7.47 non_intrinsic SPR 298.15 30735210 TBA-iT3 | 33.9
Alpha-fetoprotein protein Group I aptamer 33.9 nM -7.47 intrinsic     22166203 with a K D of 33.9 nM (group I RNA)
human α-Thrombin protein A3 34.6 nM -7.461 intrinsic     31129134 For SCORE (Anabel analysis) the best is B1 (9.2 nM) and the poorest A3 (34.6 nM)
paramylon protein Par-15 3.49e-08 M -7.457 intrinsic fluorescence   31809034 The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 ± 2.61, 34.90 ± 5.83, 64.06 ± 6.72, 123.81 ± 13.41, and 249.52 ± 46.39 nM, respectively.
HNP 1-3 protein 6J 35.0 nM -7.456 intrinsic ELISA   38591344 Regression analysis (Figure 4a) yielded a K d value of 35 nM
Mycobacterium tuberculosis H37Rv protein NK7 35.0 nM -7.456 non_intrinsic flow_cytometry   21643749 | NK7 | 35 ± 9 |
CD71 protein rvCD71apt 35.0 nM -7.456 non_intrinsic flow_cytometry 277.15 36149728 rvCD71apt binds at a high affinity to both activated CD4 + and CD8 + T cells, with apparent K D around 28.5 and 35 nM, respectively (Figure 4A,B).
Progesterone protein PG13 35.0 nM -7.456 intrinsic     28237255 The full length PG13 aptamer which showed the highest af fi nity (Kd 1⁄4 35 nM)
Enrofloxacin protein ENR-Apt 6 35.08 nM -7.455 intrinsic     38540931 Figure 4A shows the non-linear fitting curve of ENR-Apt 6, with a Kd value of 35.08 nM.
CD71 protein rvCD71apt 35.2 nM -7.453 non_intrinsic flow_cytometry 277.15 36149728 rvCD71apt binds to the same cell line with an apparent K D of around 35.2 nM (Figure 2B).
Zearalenone protein M1 35.83 nM -7.446 intrinsic     38608399 resulting in a slightly higher Kd value of 35.83 nM
Ciprofloxacin protein R10K6_V11 3.6000000000000005e-08 M -7.444 intrinsic     30609709 The determined dissociation constant of 36 nM for V11 is similar to the original full-length aptamer R10K6 (31 nM).
THY1 protein XA-B216 36.0 nM -7.444 intrinsic     33242496 The equilibrium dissociation constants, Kd, were derived from these curves and are determined as ... XA-B216=36 nM
Ara h1 protein CB-APT1 3.63e-08 M -7.44 avidity_multivalent MST 298.15 40083221 Among them, CBAPT1 exhibited the strongest binding to Ara h1 with a K d value of 36.3 nM in aqueous solutions.
Human thrombin protein TBA29 36.9 nM -7.433 intrinsic SPR   37621412 TBA29 | 1.34 10^5 | 4.94 10^-3 | 36.9
α-thrombin protein TBA-iT12 37.0 nM -7.432 non_intrinsic SPR 298.15 30735210 TBA-iT12 | 37.0
Ni2+ protein Co-1 3.7e-08 M -7.432 intrinsic     40656531 The corresponding true K d values were ... 37 nM for Ni 2+
human α-Thrombin protein B1 37.0 nM -7.432 intrinsic     31129134 and the poorest B1 (37 nM)
α-thrombin protein TBA-G8-iT8 37.1 nM -7.431 non_intrinsic SPR 298.15 30735210 TBA-G8-iT8 | 37.1
ceftiofur protein Apt-9 37.68 nM -7.424 intrinsic     40203705 Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were ... 37.68 nM
rmCD3 d ε -Fc protein CD3_Apt5 37.9 nM -7.421 intrinsic SPR 298.15 38745854 aptamer 5 was the strongest binder (37.9 nM)
Lipopolysaccharide protein B2 38.0 nM -7.42 intrinsic     22370280 The SPR-based K d between the immobilized B2 and the LPS was found to be approximately 38 nM.
thrombin protein TA-AT 38.7 nM -7.412 intrinsic BLI   37531184 TA - AT | 38.7 ± 0.5
methionyl-tRNA synthetase protein 70mer pool 38.8 nM -7.411 intrinsic     23399565 The dissociation constants of the selected 70 and 42mer pools to M. tuberculosis MRS were 38.8 and 51.3 nM, respectively.
thrombin protein LOOP 39.0 nM -7.409 intrinsic QCM   16725379 LOOP | 3.27±1.22 | 127±100 | 0.026±0.018 | 39±27
α-thrombin protein TBA-iT9 41.0 nM -7.387 non_intrinsic SPR 298.15 30735210 TBA-iT9 | 41.0
K562 protein aptamer-FAM 41.0 nM -7.387 non_intrinsic     32307868 the K d value (3.2 nM) of PAM in binding the K562 cell is one order of magnitude lower than that of the aptamer alone (41 nM).
BTX-2 protein BT10 42.0 nM -7.377 intrinsic     25725463 Under these optimum conditions, we have again estimated the binding af fi nity of the BT10 aptamer and a K d value of 42 nM was obtained.
tobramycin protein Ap 4 42.12 nM -7.376 intrinsic     30268963 The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively
CD71 protein XQ 2d 42.34 nM -7.373 non_intrinsic flow_cytometry   40156524 aptamers (HG1-9, K d = 43.23 ± 4.62 nM and XQ-2d, K d = 42.34 ± 5.15 nM))
saxitoxin protein STX-G4-45 42.6 nM -7.371 intrinsic     35324725 STX-G4-45 ( K d: 42.6 nM, Table S1)
α-thrombin protein TBA 42.7 nM -7.37 non_intrinsic SPR 298.15 30735210 TBA | 42.7
Salmonella typhimurium protein NTri-biApt 4.3090000000000004e-08 M -7.366 avidity_multivalent ELISA 310.15 37893744 the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively
CD71 protein HG1-9 43.23 nM -7.364 non_intrinsic flow_cytometry   40156524 aptamers (HG1-9, K d = 43.23 ± 4.62 nM and XQ-2d, K d = 42.34 ± 5.15 nM))
cefquinome protein Apt-9 43.3 nM -7.364 intrinsic     40203705 Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were ... 43.30 nM
cefapirin protein Apt-9 43.68 nM -7.36 intrinsic     40203705 Kd values for the binding of Apt-9 to cefapirin, cefquizime, and ceftiofur were 43.68 nM
digoxin protein D2 4.4e-08 M -7.357 intrinsic     23021809 Truncated (without primer binding region) D1, truncated D2 and full length D1 were bound to digoxin-BSA with Kd value of 8.2 × 10 -9 , 44 × 10 -9 and 17.8 × 10 -9 M, respectively
Total Phthalate Esters (TP) protein Truncated 24-mer aptamer 44.1 nM -7.356 intrinsic     33524734 that of the truncated 24-mer aptamer was 44.1 nM
M0-like macrophage protein A2 44.12 nM -7.355 non_intrinsic flow_cytometry 277.15 32589412 apparent dissociation constants ( K d ) of 44.12 ± 8.0 and 22.81 ± 5.6 nM to M0- and M2-like macrophages, respectively
HBeAg protein EAg0 4.4200000000000005e-08 M -7.355 intrinsic affinity_real_time_qPCR   32250595 A comparison of the binding of HBeAg with the four aptamers (Figure S3) shows K d values of 44.2 nM for EAg0
monocyte protein A2 45.0 nM -7.347 non_intrinsic flow_cytometry 277.15 32589412 aptamer A2 bound CD14 + cells (monocytes) with high speci fi city ( K d ∼ 45 ± 9.1 nM)
Oxytetracycline protein OTC5 4.5000000000000006e-08 M -7.347 intrinsic     35777074 the binding was slightly enhanced when NaCl was decreased (Figure 3B, K d reached 45 nM when no NaCl was present)
Ara h1 protein CB-APT1 4.5000000000000006e-08 M -7.347 avidity_multivalent MST 298.15 40083221 Notably, a similar binding affinity was observed even in a complex matrix that contained 80% w/w total peanut proteins ( K d = 45.0 nM, Figures 3 and S5).
α-thrombin protein TBA-iT12 46.8 nM -7.33 non_intrinsic SPR 298.15 30735210 TBA-iT12 | 46.8
Zearalenone protein A2 47.1 nM -7.327 intrinsic     38608399 The GO method showed that the Kd value for A2 was 47.1 nM
Human thrombin protein M08s 47.2 nM -7.326 intrinsic SPR   37621412 M08s | 7.04 10^5 | 3.33 10^-2 | 47.2
ASPH protein AP-Cell 1 4.751e-08 M -7.323 apparent_cellular flow_cytometry   36959438 three proper oligomers, AP-Cell 1, AP-Cell 2, and AP-Cell 3 with reasonable dissociation constants ( K d ) of 47.51, 39.38, and 65.23 nM, respectively, were achieved.
sCD80 protein CD80-16 47.69 nM -7.322 intrinsic     37816286 CD80-4 and CD80-16 aptamers showed the lowest K d values of 200.5 nM and 47.69 nM, respectively
ODAM protein OD64 4.771e-08 M -7.321 intrinsic SPR   33455205 the obtained OD64 and OD35 (aptamer cognate pair) presented high a ffi nity and excellent speci fi city, along with dissociation constants ( K d ) of 47.71 nM (OD64)
tobramycin protein Ap 3 47.79 nM -7.321 intrinsic     30268963 The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively
ODAM protein OD64 47.71 nM -7.321 intrinsic     30396019 From this dose-dependency curves, the Kd values of OD64 and OD35, estimated by adopting non-linear regression analysis, were 47.71 nM and 51.36 nM, for OD64 and OD35, respectively.
Mycobacterium tuberculosis H37Rv protein NK1 48.0 nM -7.319 non_intrinsic flow_cytometry   21643749 | NK1 | 48 ± 13 |
CD71 protein ATL 48.17 nM -7.317 non_intrinsic flow_cytometry 277.15 41412185 K(pH 6.5) = 48.17 ± 2.70 nM
Immunoglobulin E protein IgE37-T10-FAM (no MgCl2) 49.0 nM -7.31 intrinsic     32498825 Without MgCl2 in the binding buffer, the K d of IgE37-T10-FAM increased to 49 nM
SEC1 protein C36.2 49.43 nM -7.306 intrinsic     25053102 The Kd values are 49.43 ± 11.76, 65.14 ± 11.64 and 154.9 ± 45.67 nM, respectively.
lysozyme protein lysozyme-binding aptamer 49.5 nM -7.305 intrinsic     21616496 average ligand-site dissociation constant ( k d ) of 49.5 nM ± 8.3 nM
murine OX40 protein 11.8 50.0 nM -7.301 intrinsic filter_binding   18635004 11.8 | AUACCAGCGAAUAACUCGCUGAGGAACCCGACUCACAAA | 50 | 1
human immunoglobulin E protein AptIgE-3'-TMR 50.0 nM -7.301 non_intrinsic CE-LIF 298.15 28763192 The apparent K d of AptIgE-3 ′ -TMR was about 50 nM
CD20 protein WB1/1.CD20.1_2S 50.0 nM -7.301 non_intrinsic flow_cytometry 310.15 41079126 WB1/1.CD20.1_2S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 2.64 | 53 ± 40 | 50 ± 2.3
CD19 protein WB15.CD19 50.0 nM -7.301 non_intrinsic flow_cytometry 310.15 41079126 WB15.CD19 | 5'-AGAGACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGTGGCTTCTT-3' | - | N.P. | 50 ± 9.1
HAP 1b protein Aptamer 21 5.0000000000000004e-08 M -7.301 intrinsic     21899290 A high-affinity RNA aptamer (K d = 50 nM) was efficiently identified by SELEX against a heteroaryl dihydropyrimidine structure
Ochratoxin A protein OBA36 5.0000000000000004e-08 M -7.301 intrinsic     35442665 OBA36 binds OTA with a dissociation constant ( K d) down to ∼ 50 nM
human prothrombin protein thrombin aptamer 50.0 nM -7.301 intrinsic     21700444 the thrombin aptamer does bind prothrombin but with a lower KD (50 nM versus 2 nM for thrombin)
17 β -estradiol protein E2 aptamer 50.0 nM -7.301 intrinsic     24594593 Kd was determined to be 50 nM.
HSV-1 gD protein DApt 50.0 nM -7.301 intrinsic     29246315 Our 45-nt-long DNA aptamer showed high af fi nity for HSV-1 gD (binding af fi nity constant [Kd] = 50 nM)
enrofloxacin protein Apt6 50.77 nM -7.294 intrinsic     29574118 The obtained Kd of Apt58 and Apt6, with non-linear regression analysis, were 14.19 nM and 50.77 nM, respectively.
thrombin protein 12Ala 51.0 nM -7.292 intrinsic MST   33614235 12Ala | 51.7 | 51.0 ± 3.8 | 2.74
kanamycin protein KAN8-1 5.1e-08 M -7.292 intrinsic     41914599 Its top sequence, named KAN8 -1, shows a K d of 51 nM at pH 7.5 for kanamycin as measured by isothermal titration calorimetry
adenosine monophosphate protein AMP aptamer 51.0 nM -7.292 intrinsic     35934372 KD of BHQ-2-(NH2)2-AMP aptamer complex was 51 nM
methionyl-tRNA synthetase protein 42mer pool 51.3 nM -7.29 intrinsic     23399565 The dissociation constants of the selected 70 and 42mer pools to M. tuberculosis MRS were 38.8 and 51.3 nM, respectively.
Zearalenone protein M2 51.31 nM -7.29 intrinsic     38608399 However, the fluorescence-measured Kd value was 51.31 nM
ODAM protein OD35 5.1360000000000005e-08 M -7.289 intrinsic SPR   33455205 the obtained OD64 and OD35 (aptamer cognate pair) presented high a ffi nity and excellent speci fi city, along with dissociation constants ( K d ) of 47.71 nM (OD64) and 51.36 nM (OD35).
ODAM protein OD35 51.36 nM -7.289 intrinsic     30396019 From this dose-dependency curves, the Kd values of OD64 and OD35, estimated by adopting non-linear regression analysis, were 47.71 nM and 51.36 nM, for OD64 and OD35, respectively.
human α-Thrombin protein A1 52.0 nM -7.284 intrinsic     31129134 Also for aptamer A1 we measured with MST KD values in the pico- and nanomolar range (2 pM and 52 nM).
tobramycin protein Ap 1 52.37 nM -7.281 intrinsic     30268963 Compared with Ap 1 (Kd =52.37nM), the a ffi nity of the aptamer maintains and slightly increases with the removing of the redundant sequence.
CD20 protein WB1/1.CD20.1_2S 53.0 nM -7.276 non_intrinsic flow_cytometry 277.15 41079126 WB1/1.CD20.1_2S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 2.64 | 53 ± 40 | 50 ± 2.3
BHQ-2-(NH(NH)NH2)2 protein AMP aptamer 53.0 nM -7.276 intrinsic     35934372 Incubation of the aptamer with AMP decreased KD down to 53 nM
CD8 protein CD8AP17s-Stemloop2 53.04 nM -7.275 non_intrinsic flow_cytometry 277.15 23791505 Kd=53.04 nM
Aβ42 oligomer protein Aβ-Apt 5.33e-08 M -7.273 intrinsic SPR 298.15 35019631 suggesting that the binding a ffi nity of A β -Apt with A β 42 oligomer ( K d = 53.3 nM) was stronger than that of A β -Apt with A β 42 monomer.
Ochratoxin A protein OBA33 5.4e-08 M -7.268 intrinsic     35442665 The binding a ffi nity of OBA33 is 54 nM for OTA
HSV-1 gD protein DApt 53.92 nM -7.268 intrinsic     29246315 a nonlinear regression analysis of the determined values was plotted to give a speci fi c Kd of 53.92 nM (Figure 1C).
Thyroid-Stimulating Hormone Receptor (TSHR) protein TSHRly-1c 54.37 nM -7.265 non_intrinsic flow_cytometry   40588369 As shown in Figure 4E, the apparent equilibrium dissociation constant ( K d) of TSHRly-1c was determined to be 54.37 ± 8.22 nM.
tobramycin protein Ap 2 54.58 nM -7.263 intrinsic     30268963 The dissociation constants of Ap 2, Ap 3 and Ap 4 were determined by using the fl uorescent assay, which are 54.58 nM, 47.79 nM and 42.12 nM, respectively
Mycobacterium tuberculosis H37Rv protein NK20 55.0 nM -7.26 non_intrinsic flow_cytometry   21643749 | NK20 | 55 ± 16 |
CD19 protein WB17/17.CD19.1_1S 56.0 nM -7.252 non_intrinsic flow_cytometry 310.15 41079126 WB17/17.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 530 ± 1278 | 56 ± 49
Surface Antigen 1 protein SOK11 56.66 nM -7.247 intrinsic     40288708 SOK11 (56.66 nM, R 2 = 0.8128)
ofloxacin protein Q1 56.9 nM -7.245 intrinsic     26547431 Aptamer Q1 was found to have an af fi nity constant of K D 1⁄4 56.9 nM ( 7 11.3)
α-thrombin protein TBA-iT3 57.3 nM -7.242 non_intrinsic SPR 298.15 30735210 TBA-iT3 | 57.3
Salmonella typhimurium protein NTri-monoApt 5.7320000000000006e-08 M -7.242 apparent_cellular ELISA 310.15 37893744 the Kds of the NTri-monoApt, NTri-biApt, and NTri-triApt were measured to be 57.32 nM, 43.09 nM, and 11.89 nM, respectively
PTK7 protein Sgc8c-Si6 5.7230000000000004e-08 M -7.242 apparent_cellular flow_cytometry 277.15 40415219 Sgc8c-Si6 maintained strong binding affinity ( K d = 57.23 nM)
CD63 protein CD63 Aptamer 5.8e-08 M -7.237 intrinsic SPR   26500145 The equilibrium constant of the aptamer immobilized via 3 0 end was found to be KD = 5.8 -10 8 M.
t-Bu Hoechst dye protein Aptamer II 58.2 nM -7.235 intrinsic     38613867 The Aptamer II sequence has a fluorescence-determined KD of 58.2 nM (Table 2)
CD20 protein WB1.CD20.1 59.0 nM -7.229 non_intrinsic flow_cytometry 310.15 41079126 WB1.CD20.1 | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | - | N.P. | 59 ± 19
Rat beta-crosslaps protein BC2 59.0 nM -7.229 intrinsic     33379043 The BC1 and BC2 aptamers show high affinity in the nanomolar range, 69 and 59 nM, respectively
Rat osteocalcin protein OC2 59.0 nM -7.229 intrinsic     33379043 The high-affinity aptamers of OC and BC showed the Kd values of 59 and 55 nM respectively.
melamine protein Mel36-1 6.000000000000001e-08 M -7.222 intrinsic     42261635 The highest affinity aptamers exhibited a dissociation constant ( K d) of ∼ 60 nM
adenosine monophosphate protein AMP aptamer 60.0 nM -7.222 intrinsic     35934372 KD in saturated AMP concentration (500 μ M) was 60 nM
prothrombin protein ARC-183 60.7 nM -7.217 intrinsic SPR 298.15 22385910 Compared with ARC-183, RNAR9D-14T has a >40-fold higher affinity for prothrombin ( K D RNAR9D-14T = 1.4 nM and ARC-183 = 60.7 nM)
prothrombin protein HD1-22 6.1e-08 M -7.215 intrinsic SPR   18826387 HD1-22 | Prothrombin | K D ( M) | 6.1 · 10 ) 8
Tau protein Apt 62.5 nM -7.204 intrinsic SPR 298.15 41034513 Surface plasmon resonance (SPR) assay revealed that Apt could specifically bind to Tau proteins with high affinity (dissociation constant = 62.5 ± 1.1 nM)
Pb2+ protein TBA-4PI[T3] 6.300000000000001e-08 M -7.201 intrinsic   298.15 34543022 a titration of Pb(NO3)2 to 1 μ M TBA-4PI[T3] provided an apparent dissociate constant ( K d) of 63 nM
Aβ42 monomer protein Aβ-Apt 6.34e-08 M -7.198 intrinsic SPR 298.15 35019631 It was evaluated that A β -Apt showed the ability to bind A β 42 with a K d of 63.4 nM.
SipA protein Apt17 63.4 nM -7.198 intrinsic     31953175 Apt17 displayed Kd values of 114.9 and 63.4 nM at 27 °C and 37 °C, respectively
Staphylococcal enterotoxin B protein A11 64.0 nM -7.194 intrinsic     25624325 A2 and A11 both bound with high affinity to SEB, with dissociation constants of 26 nM and 64 nM, respectively
paramylon protein Par-18 6.406e-08 M -7.193 intrinsic fluorescence   31809034 The estimated K d values of fi ve selected aptamers, Par-7, Par-15, Par-18, Par-20, and Par-22, are 17.45 ± 2.61, 34.90 ± 5.83, 64.06 ± 6.72, 123.81 ± 13.41, and 249.52 ± 46.39 nM, respectively.
CD20 protein WB1/1.CD20.1_4S 65.0 nM -7.187 non_intrinsic flow_cytometry 310.15 41079126 WB1/1.CD20.1_4S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//Sp9//Sp9//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 5.28 | 25 ± 12 | 65 ± 38
ASPH protein AP-Cell 3 6.523000000000001e-08 M -7.186 apparent_cellular flow_cytometry   36959438 three proper oligomers, AP-Cell 1, AP-Cell 2, and AP-Cell 3 with reasonable dissociation constants ( K d ) of 47.51, 39.38, and 65.23 nM, respectively, were achieved.
Total Phthalate Esters (TP) protein Parental 39-mer aptamer 65.7 nM -7.182 intrinsic     33524734 Compared with the Kd (TP) of 65.7 nM for the parental 39-mer aptamer
prothrombin protein HD1-22 6.7e-08 M -7.174 non_intrinsic SPR   18826387 HD1-22 | Prothrombin+ phospholipids | K D ( M) | 6.7 · 10 ) 8
thrombin protein 12Trp 67.3 nM -7.172 intrinsic MST   33614235 12Trp | 54.7 | 67.3 ± 12.1 | 3.12
SARS-CoV-2 spike trimer protein S1 68.9 nM -7.162 intrinsic     34188971 The aptamer S14 evinced 3-fold higher affinity (KD = 21.8 nM) then S1 (KD = 68.9 nM).
Rat beta-crosslaps protein BC1 69.0 nM -7.161 intrinsic     33379043 The BC1 and BC2 aptamers show high affinity in the nanomolar range, 69 and 59 nM, respectively
chlorpromazine protein CHL-3 69.8 nM -7.156 intrinsic     36049339 The Kd value of CHL-3 is 69.8 nM.
RA-FLSs protein SAPT8 71.2 nM -7.148 non_intrinsic flow_cytometry 310.15 39237134 The equilibrium dissociation constants (Kd) of SAPT4 and SAPT8 with RA-FLSs were 101.7 ± 29.6 and 71.2 ± 15.0 nM, respectively ( fi gure 1H).
thrombin protein 12Leu 72.2 nM -7.141 intrinsic MST   33614235 12Leu | 53.6 | 72.2 ± 0.9 | 4.14
Nampt protein no. 19 72.52 nM -7.14 intrinsic     22704839 dissociation constant ( Kd ) was calculated to be 72.52 nM for the no. 19 aptamer
SCAF4 protein PTf-SRiApt 0.073 µM -7.137 intrinsic fluorescence   40574704 0.073 ± 0.003 µ m for PTf -SRiApt
CD20 protein WB1-CD20 73.0 nM -7.137 non_intrinsic flow_cytometry 298.15 35829681 The apparent affinities of WB1-CD20 and WB2-CD20 were calculated as 73 nM and 163 nM at 25°C, respectively
Fok I protein F6#71 74.0 nM -7.131 intrinsic     27899266 dissociation constants of F6#8 and #71 were 82 nM and 74 nM, respectively
HFIXa protein Seq 5 74.07 nM -7.13 intrinsic ITC 298.15 38776649 Seq 5- | 7.4 | 0.921 | 13.5 | 74.07 | 209.1 | 565 | 40.43
alkaline phosphatase protein ALP binding aptamer 7.49e-08 M -7.126 intrinsic PISA   30827094 From the response -dose curve (Figure 3A), the dissociation constant ( K d ) for aptamermodi fi ed array was estimated by the logistic function fi tting to be 7.49 × 10 -8 M
neomycin-B protein NEO7A 75.0 nM -7.125 intrinsic     23535583 NEO7A bound neomycin-B with a Kd of 75 nM in buffer A
gonyautoxin 1/4 protein GO18-T-d 75.63 nM -7.121 intrinsic     33294137 Corresponding Kd values of GO18-T-d and tGO18-T-d, determined by the average of 8 independent measurements, were 75.63 nM and 3.60 nM, respectively.
Co2+ protein Co-1 7.6e-08 M -7.119 intrinsic     40656531 The corresponding true K d values were ... 76 nM for Co 2+
PAUF protein P12FR2 77.0 nM -7.114 intrinsic     21963224 the equilibrium dissociation constant calculated from the relation of KD = kd / ka was 77 nM
prothrombin protein HD1 7.8e-08 M -7.108 intrinsic SPR   18826387 HD1 | Prothrombin | K D ( M) | 7.8 · 10 ) 8
hemagglutinin (HA) protein of H1N1 influenza virus (A/Puerto Rico/8/1934) protein aptamer 1 78.0 nM -7.108 intrinsic fluorescence 310.15 26904922 As it showed a higher binding affinity for HA protein (Kd = 78 -1nM), aptamer 1 was tested
kanamycin protein Ky2 78.8 nM -7.103 intrinsic     21530479 The dissociation constants ( K d [kanamycin] = 78.8 nM
kanamycin protein Ky2 78.8 nM -7.103 intrinsic     28259207 The dissociation constants (Kd [kanamycin] = 78.8 nM
Plasmodium falciparum glutamate dehydrogenase protein NG3 79.0 nM -7.102 intrinsic     29909195 A thiolated ssDNA aptamer (NG3) that binds speci fi cally to Pf GDH antigen with high a ffi nity (K d= 79 nM) was used to develop the aptasensor.
BCMA protein apt69.T 79.4 nM -7.1 non_intrinsic qRT-PCR 310.15 31778956 with an apparent dissociation constant (KD = 79.4 nM) (Figure 2C)
lysozyme protein lysozyme-binding aptamer 80.0 nM -7.097 intrinsic     21616496 average dissociation constant ( k d ) was 80.0nM ± 14nM
MUP13 protein Apt-1.4 80.0 nM -7.097 intrinsic     35026634 The equilibrium dissociation constants ( KD ) were 180 ± 80 nM for Apt-2.5 and 80 ± 44 nM for Apt-1.4.
CD19 protein WB17.CD19.1 81.0 nM -7.092 non_intrinsic flow_cytometry 310.15 41079126 WB17.CD19.1 | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | - | N.P. | 81 ± 16
patulin protein PAT C3 8.2e-08 M -7.086 intrinsic SPR   35546052 PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 × 10 -8 and 1.9 × 10 -7 M, respectively
Oxytetracycline protein OTC5 8.2e-08 M -7.086 intrinsic     35777074 In a buffer containing 300 mM NaCl and 10 mM MgCl2, the fitted K d value was 82 nM (Figure 3B, black trace)
Fok I protein F6#8 82.0 nM -7.086 intrinsic     27899266 dissociation constants of F6#8 and #71 were 82 nM and 74 nM, respectively
CD20 protein WB1/1.CD20.1_1S 83.0 nM -7.081 non_intrinsic flow_cytometry 277.15 41079126 WB1/1.CD20.1_1S | 5'-TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC//Sp9//TGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | 1.32 | 83 ± 58 | inconclusive
Neuron specific enolase protein NSE-Apt5-5BioTEG 83.0 nM -7.081 intrinsic     35495513 Through kinetic analysis, the binding rate constant and dissociation rate constant were determined to be 1.21 -10 4 Ms 1 and 1.004 -10 3 s 1 , respectively... Though this SPR analysis, the dissociation constant ( K d) was determined to be about 83 nM
Staphylococcal enterotoxin B protein PEGA11 83.5 nM -7.078 intrinsic     25624325 PEGA11 had a dissociation constant of 83.5 nM in selection buffer
kanamycin B protein Ky2 84.5 nM -7.073 intrinsic     21530479 K d [kanamycin B] = 84.5 nM
kanamycin B protein Ky2 84.5 nM -7.073 intrinsic     28259207 Kd [kanamycin B] = 84.5 nM
kanamycin protein Kana2 85.6 nM -7.068 intrinsic     21530479 The K d values of Kana2 and Ky2 as determined by fluorescence measurement were 85.6 and 78.8 nM, respectively
thrombin protein 12Ser 86.6 nM -7.062 intrinsic MST   33614235 12Ser | 52.0 | 86.6 ± 4.5 | 2.34
CD20 protein WB1.CD20 87.0 nM -7.06 non_intrinsic flow_cytometry 310.15 41079126 WB1.CD20 | 5'-AGAGACCCTGACTGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTTGCTTCTTGGACACGGTGGCTTCTT-3' | - | N.P. | 87 ± 24
Zearalenone protein Z100 87.22 nM -7.059 intrinsic     38608399 Moreover, the Kd value of Z100 measured by the GO method was found to be 87.22 nM
thrombin protein APTA 88.0 nM -7.056 intrinsic QCM   16725379 APTA | 0.97±0.45 | 86±73 | 0.011±0.006 | 88±52
fibrinogen protein FA 89.6 nM -7.048 intrinsic microscale thermophoresis   33395250 The K d calculated for the fi brinogen target was 89.6 nM
HspX protein H63 SL-2 M6 9e-08 M -7.046 intrinsic     30205966 H63 SL-2 M6 displayed a speci fi c and high a ffi nity interaction with HspX (Kd ∼ 9.0 × 10 -8 M).
Zearalenone protein A1 90.25 nM -7.045 intrinsic     38608399 The Kd value was 90.25 nM as determined by the GO method
Immunoglobulin E protein IgE37-T10-FAM (5-bp truncated) 90.5 nM -7.043 intrinsic     32498825 When 4-base pairs and 5-base pairs were truncated from the stem, the K ds of the aptamers increased to 11.4 nM and 90.5 nM, respectively.
N-acetylneuraminic acid protein Neu5Ac aptamer 91.0 nM -7.041 intrinsic ITC 310.15 37217750 To validate ARPLA, we first determined the binding affinity ( K d ) of the Neu5Ac aptamer by isothermal titration calorimetry (ITC) as 91 nM (Extended Data Fig. 2a,b)
mouse IL-2 protein M20 91.0 nM -7.041 intrinsic     35756119 The results indicated that the af fi nity of the M20 aptamer was greater than the M15, and its predicted Kd was 91 nM
Okadaic Acid protein OA-LC2 91.13 nM -7.04 intrinsic BLI   36322695 OA-LC2 exhibited K d of 91.13 ± 4.64 nM
rmCD3 d ε -Fc protein CD3_Apt1 91.3 nM -7.04 intrinsic SPR 298.15 38745854 aptamer 1 (91.3 nM)
6'-sialyllactose protein Apt9-1 9.175000000000001e-08 M -7.037 intrinsic fluorescence 298.15 36700646 A 35 nt truncated aptamer Apt9-1 ( K d = 91.75 nM) with higher affinity than Apt9 was finally obtained.
BHQ-2-(NH(NH)NH2)2 protein AMP aptamer 92.0 nM -7.036 intrinsic     35934372 BHQ-2-(NH(NH)NH2)2 had lower affinity to the aptamer in the low salt buffer. KD was 92 nM
17 β -estradiol protein HEV1 9.276e-08 M -7.033 intrinsic MST   38276613 the dissociation constant (KD value) is 92.76 ± 66.02 nM as calculated by the calculation function that comes with the system.
Mycobacterium tuberculosis H37Rv protein NK10 95.0 nM -7.022 non_intrinsic flow_cytometry   21643749 | NK10 | 95 ± 28 |
Gymnodimine-A protein G48nop 95.3 nM -7.021 intrinsic     35324692 The resulting K D value of G48nop (95.30 nM) was about one third of that of G48 (288 nM)
EpCAM protein SYL3C 9.700000000000001e-08 M -7.013 apparent_cellular     36856721 SYL3C can bind to SW480 cells (EpCAM+) with a K d of 97 nM
thrombin protein TBA15 97.0 nM -7.013 intrinsic     23850569 A K D value of 97 nM 1 nM was determined for the TBA/Thr complex in the MST assay
Oxytetracycline protein OTC5 9.8e-08 M -7.009 intrinsic     35777074 we fitted the peak fluorescence to obtain a K d of 98 nM (Figure 4B)
neomycin protein NAN-NEO 98.101 nM -7.008 intrinsic     22321384 Using the LineweaverBurk equation (Equation 1), we calculated the dissociation constant (Kd) to be 98.101 nM (Figure 5, B ).
thrombin protein 12Phe 99.1 nM -7.004 intrinsic MST   33614235 12Phe | 54.3 | 99.1 ± 6.3 | 4.07
BSA glycan/conjugate Clone 5 1e-07 M -7.0 intrinsic SPR   11178986 BSA | 2.2 3 10 4 | 2.3 3 10 2 3 | 9.9 3 10 6 | 1.0 3 10 2 7
human α-thrombin protein Apt15 100.0 nM -7.0 non_intrinsic     28763192 One 15-mer DNA aptamer (5 ′ -GGT TGG TGT GGT TGG-3 ′ , denoted as Apt15 here) binds to the fi brinogen-binding site of human α -thrombin with a K d around 100 nM.
D-TAR RNA protein L-6-4t 1.0000000000000001e-07 M -7.0 intrinsic     23977945 the K d of the L-aptamer for D-TAR RNA is 100 nM
Bisphenol A protein BPA-specific aptamer 1.0000000000000001e-07 M -7.0 intrinsic     25329684 the K d value for free BPA binding to the BPA aptamer was determined experimentally using MST to be ∼ 100 nM
Thrombin protein TBA15 1e-07 M -7.0 intrinsic     26643617 K d of free TBA15 (~1 × 10 -7 M)
human β-defensin 2 protein U gu1 100.0 nM -7.0 intrinsic     32067984 Besides, clone U gu1 bound somewhat poorly to HBD-2 ( K d = 100 nM, Fig. S2).
RA-FLSs protein SAPT4 101.7 nM -6.993 non_intrinsic flow_cytometry 310.15 39237134 The equilibrium dissociation constants (Kd) of SAPT4 and SAPT8 with RA-FLSs were 101.7 ± 29.6 and 71.2 ± 15.0 nM, respectively ( fi gure 1H).
CD9 protein CD9-26 101.96 nM -6.992 intrinsic fluorescence 277.15 37585601 CD9-26 | 5 ′ -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG TGC GCA CTA GAG CAG GTA CGG TGT CA-3 ′ | - 8.92
human α-Thrombin protein A3 101.9 nM -6.992 intrinsic     31129134 and as poorest binder aptamer A3 (101.9 nM).
tobramycin protein Ky2 103.0 nM -6.987 intrinsic     21530479 and K d [tobramycin] = 103 nM)
tobramycin protein Ky2 103.0 nM -6.987 intrinsic     28259207 and Kd [tobramycin] = 103nM
Okadaic Acid protein OA-SL2 103.4 nM -6.985 intrinsic BLI   36322695 from OA-SL1 to OASL2, K d was lowered from 340.5 ± 14.5 to 103.4 ± 7.0 nM
aflatoxin B2 protein A50-T26-TMR 105.0 nM -6.979 intrinsic     30086944 the K d for AFB2 was determined to be 105 nM in our study.
Mycobacterium tuberculosis H37Rv protein NK8 107.0 nM -6.971 non_intrinsic flow_cytometry   21643749 | NK8 | 107 ± 44 |
luteolin protein LUT#28 107.0 nM -6.971 intrinsic     29524380 The value of Kd for LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively.
luteolin protein LUT#3 109.0 nM -6.963 intrinsic     29524380 The value of Kd for LUT#28, LUT#20 and LUT#3 was discerned to be 107, 214 and 109 nM, respectively.
domoic acid protein C1-d 1.09e-07 M -6.963 intrinsic     36421085 Biolayer interferometry assay illustrated that C1-d possessed a K on (1/Ms) value of 2.94 × 10 5 , a K dis (1/s) value of 5.13 × 10 -2 , and a K D (M) value of 1.09 × 10 -7 M in the interaction with DA.
thrombin protein HD1 110.0 nM -6.959 intrinsic filter_binding   41053535 HD1 binds both thrombin (K D = 110 nm)
BHQ-2-(NH2)2 protein off-target DNA hairpin 110.0 nM -6.959 intrinsic     35934372 KD of the complex between BHQ-2-(NH2)2 and off-target DNA hairpin ... was twice higher, 110 nM
PA toxin protein Apt11 1.1200000000000001e-07 M -6.951 intrinsic     20136122 The aptamer was developed in-house by capillary electrophoresis systematic evolution of ligands by exponential enrichment (CE-SELEX) and had a dissociation constant (K d ) of 112 nM.
polysialic acid protein Apt3 114.0 nM -6.943 intrinsic     35151974 The K d value of candidate Apt3 is the lowest among all the tested candidate aptamer sequences, which is 114.0 nM
trisialic acid protein Apt3 114.0 nM -6.943 intrinsic     40545079 aptamer Apt3 ( K d = 114.0 nM)
CD19 protein WB15.CD19.1 117.0 nM -6.932 non_intrinsic flow_cytometry 310.15 41079126 WB15.CD19.1 | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | - | N.P. | 117 ± 28
human α-Thrombin protein A3 117.8 nM -6.929 intrinsic     31129134 and the poorest binder is A3 (117.8 nM).
Moraxella osloensis protein MO9 1.1890000000000001e-07 M -6.925 apparent_cellular fluorescence   41784024 high-a ffi nity aptamer (K d = 118.9 nM)
SCAF4 protein PT1/2-SRiApt 0.121 µM -6.917 intrinsic fluorescence   40574704 0.121 ± 0.054 µ m for PT1/2 -SRiApt
SIRT2 protein Apt 45 1.233e-07 M -6.909 intrinsic fluorescence 310.15 40200675 selected Apt 45 ( K d = 123.3 nM) to fabricate the 'turn-on' fluorescent biosensor
CD19 protein WB15/15.CD19.1_1S 125.0 nM -6.903 non_intrinsic flow_cytometry 277.15 41079126 WB15/15.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 125 ± 68 | 11 ± 6.1
Netilmicin protein APT-21 126.0 nM -6.9 intrinsic     35752088 Intriguingly, the Kd value in the experiment (Fig. 4B) is 126.0 nM
thrombin protein A4 127.0 nM -6.896 intrinsic     23850569 The K D value determined for A4 (127 nM 1.4 nM) was very close to that of TBA15
human α-Thrombin protein A1 129.8 nM -6.887 intrinsic     31129134 for iRIf aptamer A2 is the best (26.4 nM) and aptamer A1 the poorest (129.8 nM)
sLe X -BSA glycan/conjugate Original pool 1.3e-07 M -6.886 intrinsic SPR   11178986 Original pool | 2.6 3 10 4 | 3.3 3 10 2 3 | 7.6 3 10 6 | 1.3 3 10 2 7
H-Thr protein Seq-1 136.0 nM -6.866 intrinsic     31103164 The good af fi nity of Seq-1 (Fig. S2) with 136 nM and Apt-29 with 199 nM were obtained
saxitoxin protein 75a 136.0 nM -6.866 intrinsic     35324725 aptamer 75a with a K d value of 136 nM
CD25 protein Apt70 138.6 nM -6.858 intrinsic     29055191 Using non-linear regression analysis, the Kd of Apt51 and Apt70 aptamers were found to be 13.4 nM and 138.6 nM, respectively
guanine protein R10G2 1.4e-07 M -6.854 intrinsic     38194356 In our R10G2 aptamer, a K d of 140 nM guanine was achieved
SW480 cells cell/EV SYL3C 142.5 nM -6.846 non_intrinsic     32049531 monovalent SYL3C aptamer ( K d = 142.50 ± 20.55 nM, Figure 2A)
Oxytetracycline protein OTC5 1.47e-07 M -6.833 intrinsic   298.15 35777074 a representative sequence named OTC5 had a dissociation constant of 147 nM measured by isothermal titration calorimetry.
AP65 protein AP65_A1 1.48e-07 M -6.83 intrinsic     29972299 The resulting K D was 148 nM
6'-sialyllactose protein Apt9 1.5230000000000003e-07 M -6.817 intrinsic fluorescence 298.15 36700646 The ssDNA aptamer Apt9 ( K d = 152.3 nM) with a length of 79 nucleotides (nt) was demonstrated as the optimal aptamer candidate
Surface Antigen 1 protein SOK10 152.9 nM -6.816 intrinsic     40288708 SOK10 (152.9 nM, R 2 = 0.7217)
CD19 protein WB15-CD19 153.0 nM -6.815 non_intrinsic flow_cytometry 298.15 35829681 At 25 °C, WB15-CD19 showed an apparent affinity of 153 nM
progastrin-releasing peptide (31-98) protein ProGRP-48-5BioTEG 153.0 nM -6.815 intrinsic     35495513 The dissociation constant ( K d) of ProGRP31-98 to aptamer was calculated to be 153 nM
D-TAR RNA protein L-6-4t 1.6e-07 M -6.796 intrinsic     23977945 The L-6-4t aptamer has somewhat reduced affinity for D-TAR RNA under the low-salt conditions (K d = 160 nM)
Hen egg white lysozyme protein DNA analog a2 161.0 nM -6.793 intrinsic     21167858 The aptamerlysozyme equilibrium dissociation constant of 161 ± 16nM agrees reasonably well with the Kd from fluorescence anisotropy (467 ± 140nM). The overall free energy and enthalpy changes are -9.32 ± 0.06kcal/mol and 2.2 ± 1.0 kcal/mol, respectively.
CD20 protein WB2-CD20 163.0 nM -6.788 non_intrinsic flow_cytometry 298.15 35829681 The apparent affinities of WB1-CD20 and WB2-CD20 were calculated as 73 nM and 163 nM at 25°C, respectively
thrombin protein 3NB 163.5 nM -6.786 intrinsic MST   33614235 3NB | 51.7 | 163.5 ± 3.5 | 3.82
Phosphatidylserine protein PS-LC3-TF 166.2 nM -6.779 intrinsic BLI   36322695 The terminal-fixed PS-LC3-TF exhibited an even lower K d at 166.2 ± 10.7 nM
xanthylacrylamide protein XAA-1 1.6800000000000002e-07 M -6.775 intrinsic     40261307 an apparent K d value of 168 nM was obtained
CD19 protein WB15/17.CD19.1_2S 173.0 nM -6.762 non_intrinsic flow_cytometry 277.15 41079126 WB15/17.CD19.1_2S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 2.64 | 173 ± 82 | inconclusive
Tramadol hydrochloride protein Apt39 178.4 nM -6.749 intrinsic     33965888 the Kd of Apt39 was measured to be 178.4 nM
CD19 protein WB15/17.CD19.1_1S 183.0 nM -6.738 non_intrinsic flow_cytometry 277.15 41079126 WB15/17.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 183 ± 140 | inconclusive
CD19 protein WB17-CD19 187.0 nM -6.728 non_intrinsic flow_cytometry 298.15 35829681 and WB17-CD19 showed an apparent affinity of 187 nM (Figure S12A-B).
patulin protein PAT C4 1.9e-07 M -6.721 intrinsic SPR   35546052 PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 × 10 -8 and 1.9 × 10 -7 M, respectively
Sc3+ protein Sc-1 1.9200000000000003e-07 M -6.717 intrinsic     39743479 obtained an apparent K d value of 192 nM
Netilmicin protein APT-21 194.1 nM -6.712 intrinsic     35752088 APT-21 bound to NET with high affinity (Kd = 194.1 nM)
CD20 protein WB1.CD20.2 196.0 nM -6.708 non_intrinsic flow_cytometry 310.15 41079126 WB1.CD20.2 | 5'-TGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACAC-3' | - | N.P. | 196 ± 117
streptomycin protein STR1 199.1 nM -6.701 intrinsic     23601877 the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively.
H-Thr protein Apt-29 199.0 nM -6.701 intrinsic     31103164 The good af fi nity of Seq-1 (Fig. S2) with 136 nM and Apt-29 with 199 nM were obtained
malachite green protein MGA 200.0 nM -6.699 intrinsic     27591602 Based on the fl uorescence enhancement of MG, the initial dissociation constant ( K d) is determined to be 200 nM as seen in Figs. 2A and B
sCD80 protein CD80-4 200.5 nM -6.698 intrinsic     37816286 CD80-4 and CD80-16 aptamers showed the lowest K d values of 200.5 nM and 47.69 nM, respectively
bilirubin protein Brb7 2.03e-07 M -6.693 intrinsic     40669049 The tightest binding bilirubin aptamer has a K d value of 203 nM based on ITC
rmCD3 d ε -Fc protein CD3_Apt12 206.0 nM -6.686 intrinsic SPR 298.15 38745854 aptamer 12 (206 nM)
AP65 protein AP65_A1 2.09e-07 M -6.68 intrinsic     29972299 K D of 209 nM was obtained
saxitoxin protein STX-R-75 209.4 nM -6.679 intrinsic     35324725 STX-R-75 ( K d: 209.4 nM, Table S1)
di-2-ethylhexyl phthalate protein PT01 aptamer 213.0 nM -6.672 intrinsic     30189334 The dissociation constant, Kd, of the PT01 aptamer was calculated as 213.0 nM using Eq. (1).
CD8 protein CD8AP17s-Stemloop1 217.0 nM -6.664 non_intrinsic flow_cytometry 277.15 23791505 Kd=217.0 nM
rmCD3 d ε protein CD3_Apt12 dimer 218.0 nM -6.662 non_intrinsic BLI 298.15 38745854 218 nM for Apt12 dimer
rhGH protein rhGH-specific aptamer 218.0 nM -6.662 intrinsic     19500672 the affinity constant was K D = 218 nM rhGH
Cd2+ protein probe 2.2e-07 M -6.658 intrinsic     32618180 the disassociation constant ( K D) between Cd 2+ and its aptamer were calculated to be 96 M -1 S -1 , 2.11 × 10 -5 S -1 , and 220 nM, respectively
streptomycin protein STR3 221.3 nM -6.655 intrinsic     23601877 the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively.
SCAF4 protein PT1/3-SRiApt 0.223 µM -6.652 intrinsic fluorescence   40574704 0.223 ± 0.030 µ m for PT 1/3 -SRiApt
xanthylacrylamide protein XAA-1 2.2400000000000002e-07 M -6.65 intrinsic     40261307 Using the ThT assay, an apparent K d of 224 nM was obtained for XAA-1
benzovindiflupyr protein Apt.BZF01 2.2650000000000002e-07 M -6.645 intrinsic fluorescence   41614999 corrected KDs of 226.5 nM (Apt.BZF01)
human α-thrombin protein T25-Apt15-3'-TMR 228.0 nM -6.642 non_intrinsic CE-LIF 298.15 28763192 The apparent K d values of T25-Apt15-3 ′ -TMR and 5 ′ -TMR-T25-Apt15 were estimated as 228 nM and 8.8 nM, respectively
Adenosine protein Ade1301b 2.3000000000000002e-07 M -6.638 intrinsic     36947745 Ade1301b showed an even lower K d of 230 nM
aflatoxin M1 protein A50-T26-TMR 230.0 nM -6.638 intrinsic     30086944 The aptamer showed almost the same FA responses to AFM1 and AFM2, with K ds to be 230 nM and 302 nM, respectively.
urea protein U38 232.0 nM -6.635 intrinsic     26002019 isolate a urea speci fi c DNA aptamer with a dissociation constant ( K d) of 232 nM
Okadaic Acid protein OA-SL3 234.4 nM -6.63 intrinsic BLI   36322695 When OA-SL1 was tripled to get the chimera OA-SL3, K d rose to 234.4 ± 15.6 nM
urea protein U38 238.0 nM -6.623 intrinsic     26002019 The K d of aptamer was calculated to be 238 nM
Sr2+ protein Thrombin Binding Aptamer 240.0 nM -6.62 intrinsic mass_spectrometry 298.15 18318508 the Kd determined from the best-fit curve is 240 ( 50 nM for the interaction of TBA and Sr 2 +
Zika NS1 protein 10 (truncated) 2.4000000000000003e-07 M -6.62 intrinsic     29120623 comparable binding affinities (24 and 45 pM for 100-nt and 41-nt 2 , and 134 and 240 nM for 100-nt and 54-nt 10 , respectively)
dT20 protein DCC-SSB 2.4000000000000003e-07 M -6.62 intrinsic   293.15 34085169 Titrations of dT 27 and dT20 at low concentrations of DCCSSB gave smaller fluorescence changes, and the data were fit to give single K d values of 43 and 240 nM, respectively
cortisol protein CSS.3 2.4000000000000003e-07 M -6.62 intrinsic     38270529 Our own internal work confirmed that CSS.3 had the best binding affinity in binding buffer with a K D of 240 nM
kanamycin protein Apt 1/Apt 2 (split aptamers) 247.0 nM -6.607 intrinsic     35316405 With the (GlcN)5 added in the binding buffer, the Kd was measured to be 247 nM
Ni2+ protein Ni-4 2.5700000000000004e-07 M -6.59 intrinsic     40656531 and 257 nM for Ni 2+ in the same titration
rHuEPOa protein 813 260.0 nM -6.585 intrinsic     20971648 The K d values of sequences of 807, 813, and 850 were 82 ± 32 nM, 260 ± 117 nM, and 590 ± 354 nM, respectively
Tetracycline protein OTC5 2.6400000000000003e-07 M -6.578 intrinsic     35777074 they also showed a similar fluorescence enhancement with a K d of 264 nM TC
streptomycin protein STR6 272.0 nM -6.565 intrinsic     23601877 the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively.
5-Methoxytryptamine protein MLT-C-1F 0.274 μM -6.562 intrinsic     36925277 For L-TRP and 5-MT very low K d were observed i.e., 0.324 μM and 0.274 μM respectively
human α-Thrombin protein A1 279.0 nM -6.554 intrinsic     31129134 Whereas the highest value was determined with iRIf for aptamer A1, which is 279 nM.
trisialic acid protein Apt3-1 282.7 nM -6.549 intrinsic     40545079 Apt3 -1 ( K d = 282.7 nM)
VEGF165 protein no. 529 2.8800000000000004e-07 M -6.541 intrinsic     36215718 The K D values of 524, 64, and 529, were 36.3, 79.3, and 288 nM, respectively.
Lactose protein Clone 5 2.9e-07 M -6.538 intrinsic SPR   11178986 Lactose | 6.3 3 10 2 | 1.8 3 10 2 4 | 3.4 3 10 6 | 2.9 3 10 2 7
CD9 protein CD9-28 289.67 nM -6.538 intrinsic fluorescence 277.15 37585601 CD9-28 | 5 ′ -ATA GTC CCT TGG CGT GCT TCA CAA CCT TGA ACT TGA CGC AGG ATC GTT CAG GGC GCA CTA GAG CAG GTA CGG TGT CA-3 ′ | - 8.80
prothrombin protein HD1-12A-DAB 296.0 nM -6.529 non_intrinsic filter_binding   41053535 and prothrombin with K D s of 13.1 pm and 296 nm
Sc3+ protein Sc-1b 3.0200000000000003e-07 M -6.52 intrinsic     39743479 its K d (302 nM) was comparable to that of Sc-1
aflatoxin M2 protein A50-T26-TMR 302.0 nM -6.52 intrinsic     30086944 The aptamer showed almost the same FA responses to AFM1 and AFM2, with K ds to be 230 nM and 302 nM, respectively.
kanamycin protein Apt 1/Apt 2 (split aptamers) 304.0 nM -6.517 intrinsic     35316405 The split aptamers exhibited high affinity towards the kanamycin, with an Kd of 304 nM.
CD20 protein WB1.CD20.3 309.0 nM -6.51 non_intrinsic flow_cytometry 310.15 41079126 WB1.CD20.3 | 5'-TGCGAATTCGCCCTCTGTTTCTGCCTTATTATTTTTTGTTTGCTTCTTGGACACGGTGGC-3' | - | N.P. | 309 ± 100
SW620 protein XL-33-1 3.22e-07 M -6.492 apparent_cellular     25867099 Binding affinity of XL-33-1 against SW620 at 37 ° C was found to be 322 nM.
streptomycin protein STR12 340.64 nM -6.468 intrinsic     23601877 the K d values of STR1, STR3, STR6 and STR12 were determined, which are of 199.1 nM, 221.3 nM, 272.0 nM and 340.64 nM, respectively.
CD19 protein WB15/15.CD19.1_2S 356.0 nM -6.449 non_intrinsic flow_cytometry 277.15 41079126 WB15/15.CD19.1_2S | 5'-ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//Sp9//ACCCTGACTGCGAATTCGCTCGCCCTTACGGCCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 2.64 | 356 ± 534 | 9.5 ± 5.0
serotonin protein Serotonin Aptamer 3.6000000000000005e-07 M -6.444 intrinsic     36704862 The steady-state binding responses were fitted to the affinity model in eq 1, as shown in Figure 3B, which yielded a K d of 360 nM.
Hen egg white lysozyme protein DNA analog a1 378.0 nM -6.423 intrinsic     21167858 The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 ◦ C are 378nM, 467nM and 573nM, respectively.
benzylpenicillin protein BBA1 383.4 nM -6.416 intrinsic     28522308 a Kd of 383.4 nM (dissociation constant) was determined.
benzylpenicillin protein BBA1 383.4 nM -6.416 intrinsic     33184760 a Kd of 383.4 nM (dissociation constant) was determined.
bilirubin protein Bvd4 3.9e-07 M -6.409 intrinsic     40669049 We then performed a careful bilirubin titration (Figure S3A), and a clear binding was observed with an apparent K d of 390 nM bilirubin (Figure S3B).
dT20 protein DCC-SSB 3.96e-07 M -6.402 intrinsic   293.15 34085169 With dT20, the intercept suggests a dissociation rate constant of 49 s -1 , producing a value of 396 nM for the equilibrium dissociation constant
biliverdin protein Bvd4 4.0999999999999994e-07 M -6.387 intrinsic fluorescence   40669049 Titration of biliverdin into 1 μM Bvd4 aptamer led to an approximate 90% fluorescence drop (Figure 3A), and the fitted dissociation constant ( K d ) was 0.41 μM
H-6 cells cell/EV Apta25 0.42 µM -6.377 non_intrinsic flow_cytometry 310.15 40487293 H-6 cells showed binding with Apta25 ( K D value-0.42 ± 0.093 µ m)
theophylline protein ΔTCT8-4 theophylline-binding aptamer 4.2e-07 M -6.377 intrinsic     41248478 Analysis of the SPR dose -response data gave a binding affinity of 420 nM.
rmCD3 d ε -Fc protein CD3_Apt3 430.0 nM -6.367 intrinsic SPR 298.15 38745854 aptamer 3 (430 nM)
Kringle 5 protein KG-4 432.0 nM -6.365 intrinsic     37149949 The preferred aptamer KG-4, which demonstrated a low dissociation constant ( K d) of ~ 432 nM
mannose-capped lipoarabinomannan protein ZXL1 436.3 nM -6.36 intrinsic ELONA 310.15 24572295 The K d of 436.3 ± 37.84 nM was established as described in the Methods section.
Uric Acid protein Apt2 4.61e-07 M -6.336 intrinsic     42095518 Microscale thermophoresis (MST) analysis yielded a Kd value of 461 nM for Apt2
Hen egg white lysozyme protein DNA analog a2 467.0 nM -6.331 intrinsic     21167858 The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 ◦ C are 378nM, 467nM and 573nM, respectively.
Muscovy duck parvovirus protein Apt-10 467.0 nM -6.331 intrinsic     28917743 the ssDNA aptamer Apt-10, which specifically bound to MDPV with high affinity ( Kd = 467 nM) was successfully screened
Fe2+ protein Co-1 4.68e-07 M -6.33 intrinsic     40656531 The corresponding true K d values were ... 468 nM for Fe 2+
SCAF4 protein SRiApt 0.469 µM -6.329 intrinsic fluorescence   40574704 The binding affinities (K D ) were determined to be 0.469 ± 0.010 µ m for unmodified SRiApt
Bisphenol A protein 63-mer BPA aptamer 491.69 nM -6.308 intrinsic     32113141 The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM
CD9 protein CD9-08 494.37 nM -6.306 non_intrinsic fluorescence 277.15 37585601 CD9-08 | 5 ′ -TGA CAC CGT ACC TGC TCT AGT GCG CAC TGA ACG ATC CTG CGT CAA GTT CAA GGT TGT GAA GCA CGC CAA GGG ACT AT-3 ′ | - 11.71
Mouse thrombin protein M08s 495.0 nM -6.305 intrinsic SPR   37621412 M08s | 3.56 10^5 | 1.76 10^-1 | 495
thrombospondin-1 protein M55 0.5 μM -6.301 intrinsic ELISA   24434496 The K D value of the aptamer M55 binding to thrombospondin-1 was determined as 0.5 7 0.2 μ M
adenine protein R10A4 5.000000000000001e-07 M -6.301 intrinsic     38194356 our R10A4 aptamer has a comparable K d of 500 nM
CD19 protein WB17/17.CD19.1_1S 530.0 nM -6.276 non_intrinsic flow_cytometry 277.15 41079126 WB17/17.CD19.1_1S | 5'-ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT//Sp9//ACCCTGACTGCGAATTCGCTCTCCCTTACGGGCTTACATGTTCGCATCCCCCCTTTGGACACGGT-3' | 1.32 | 530 ± 1278 | 56 ± 49
mannose-capped lipoarabinomannan protein 12th-round ssDNA pool 537.5 nM -6.27 non_intrinsic ELONA 310.15 24572295 The dissociation constant ( K d values) of the 12th-round pool was determined to be 537.5 ± 69.98 nM
Clenbuterol protein CLB-1 5.61e-07 M -6.251 intrinsic     42204903 the apparent K d was 561 nM (Figure 3B)
Hen egg white lysozyme protein DNA analog a3 573.0 nM -6.242 intrinsic     21167858 The equilibrium dissociation constants for a1, a2 and a3 in 20 mM Tris, pH 7.6 ('buffer A') + 20 mM NaCl at 25 ◦ C are 378nM, 467nM and 573nM, respectively.
mouse IL-2 protein M15 600.0 nM -6.222 intrinsic     35756119 The calculation of the dissociation constant predicted 91 and 600 nM Kd for M20 and M15, respectively
K-1 cells cell/EV Apta30 0.66 µM -6.18 non_intrinsic flow_cytometry 310.15 40487293 Apta30 ( K D -0.66 ± 0.12 µ m)
human β-defensin 2 protein A ad1-2 676.0 nM -6.17 intrinsic     32067984 a clone with a truncation at the 3 ʹ terminal (A ad1 -2 , 58mer, Fig. 4a) was found to bind more weakly to HBD-2 ( K d = 676 nM, Fig. 4b).
CD71 protein ATL 696.7 nM -6.157 non_intrinsic flow_cytometry 277.15 41412185 K(pH 7.5)= 696.7 ± 68.03 nM
HER3 protein HBR 700.0 nM -6.155 intrinsic     33770580 The dissociation constant ( K D) of HBR was calculated from the resulting BLI sensorgrams was 700 nM.
Alternariol protein AOH 6C 701.0 nM -6.154 intrinsic     34655971 The apparent KD of AOH 6C, B-2-3 and T-23 were 701 nM, 445 nM and 274 nM, respectively
Co2+ protein Co-1 7.310000000000001e-07 M -6.136 intrinsic     40656531 the Co-1 aptamer has a K d of 731 nM for Co 2+
Dinophysistoxin protein anti-DTX parent aptamer 778.1 nM -6.109 intrinsic BLI   36322695 antiDTX parent aptamer ( K d = 778.1 ± 73.5 nM)
IL4Rα protein cl.42 788.0 nM -6.103 non_intrinsic FACS 310.15 22282665 with an apparent K d of 788 nM (Supplementary Fig. S3B)
EpCAM protein TD05 7.92e-07 M -6.101 apparent_cellular     36856721 TD05's K d value is 792 nM
Clenbuterol protein CLB-1 7.98e-07 M -6.098 intrinsic     42204903 CLB binding was preserved in the absence of Mg 2+ ( K d 798 nM)
Clenbuterol protein CLB-1 8.850000000000001e-07 M -6.053 intrinsic     42204903 ITC showed that the CLB-1 aptamer has a K d of 885 nM (Figure 3D)... The enthalpy ( Δ H = -24.9 kcal mol -1 ) and entropy ( Δ S = -55.9 cal K -1 mol -1 )
Co2+ protein Ni-4 9.01e-07 M -6.045 intrinsic     40656531 Ni-4 exhibited a K d of 901 nM for Co 2+
prothrombin protein HD1 992.0 nM -6.003 intrinsic filter_binding   41053535 and prothrombin (K D = 992 nm)
Thrombin protein aptamer 1S 1.08e-06 M -5.967 intrinsic SPR   32268723 The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 μM and 29.4 nM, respectively
CD117 protein Apta04 1100.0 nM -5.959 intrinsic BLI 298.15 40487293 Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 µ m, respectively ( Figure 2 a,b).
H-6 cells cell/EV Apta30 1.107 µM -5.956 non_intrinsic flow_cytometry 310.15 40487293 H-6 cells showed binding with ... Apta30 ( K D -1.107 ± 0.208 µ m)
CD123 protein Apta25 1.16 µM -5.936 intrinsic BLI 298.15 40487293 BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 µ m for ZW25 and 15.6 µ m for CY30 (Figure S2, Supporting Information).
Bisphenol A protein 23-mer BPA aptamer 1190.61 nM -5.924 intrinsic     32113141 The K d values of the 63-mer, 38-mer, 12-mer and 23-mer aptamers were determined by using MST experiments, which were 491.69 nM, 13.17 nM, 27.05 nM and 1190.61 nM
CD20 protein Aptamer 2 1.2 μM -5.921 intrinsic ITC 298.15 39004051 | 2 | 1.2 ± 0.2 | 1.49 ± 0.01 | > mM | N/D |
IL-8 protein 8A-30 1.22e-06 M -5.914 intrinsic SPR 298.0 24129312 | 8A-30 | 1.32 x 10 6 | 1.62 | 1.22 x 10 -6 | 4.62 x 10 -5 | 1.06 x 10 -3 |
K-1 cells cell/EV Apta25 1.358 µM -5.867 non_intrinsic flow_cytometry 310.15 40487293 Apta25 ( K D value-1.358 ± 0.201 µ m)
bilirubin protein Brb7 1.4e-06 M -5.854 intrinsic fluorescence   40669049 After titrating bilirubin into 1.0 μM Brb7 aptamer, the saturation fluorescence decrease reached 99% (Figure 6A) and its K d was fitted to be 1.4 μM
Okadaic Acid protein anti-OA parent aptamer 1402.0 nM -5.853 intrinsic BLI   36322695 anti-OA aptamer with high affinity from its parent aptamer ( K d = 1402 ± 58 nM, Figure 1a)
amikacin protein Aptamer A1 1.5e-06 M -5.824 intrinsic ITC 298.15 36453647 Aptamer A1 binds 7-fold stronger to amikacin with a K d value of 1.5 μM
domoic acid protein C1-s 1.5e-06 M -5.824 intrinsic     36421085 BLI results showed that the affinity of C1-s ( K D value, 1.50 × 10 -6 M) and C1 for DAwas at an equivalent level.
thrombin protein TBA15 1690.0 nM -5.772 intrinsic     23850569 The addition of 10% blood plasma to the working buffer changed the K D values significantly ( K D TBA 1⁄4 1690 nM 15 nM
ESAT6/CFP10 fusion protein protein Aptamer 3 (core 21-nt) 1.81e-06 M -5.742 intrinsic     40359808 retaining only the core 21-nucleotide sequence at the 5 ′ end results in a dramatic reduction of the K d value to 1.81E-6
K-1 cells cell/EV Apta02 1.821 µM -5.74 non_intrinsic flow_cytometry 310.15 40487293 Apta02 ( K D value-1.821 ± 0.117 µ m)
K-1 cells cell/EV Apta04 1.867 µM -5.729 non_intrinsic flow_cytometry 310.15 40487293 Apta04 ( K D value-1.867 ± 0.19 µ m)
cRNA protein CRP-specific RNA aptamer 1.98 μM -5.703 intrinsic     22365749 Binding kinetics as determined by incubating different target concentrations against constant number of aptamers immobilized on sensor surface showed the K d values of 1.98 and 2.4 μM for cRNA and CRP, respectively.
biliverdin protein Bvd1 2e-06 M -5.699 intrinsic fluorescence   40669049 The same trend was also observed for the Bvd1 aptamer (Figure S1), and the fitted K d was 2.0 μM.
CTNNA1 protein EA2 2.07 µM -5.684 intrinsic MST   40265971 The K d values (2.07 ± 0.60 µ M) obtained from MST assay (Figure 2l) further corroborated the specific binding between CTNNA1 and EA2.
verrucarin A protein 14_Ver1 2.2e-06 M -5.658 intrinsic fluorescence   39404132 The binding test demonstrated that the decrease in fluorescence was correlated with increasing verrucarin A concentration with K D = 2.2 μM.
verrucarin A protein Ver1_JYP (C32G mutant) 2.2999999999999996e-06 M -5.638 intrinsic fluorescence   39404132 guanine with both functional groups exhibited partially recovered binding activity ( K D = 2.3 μM).
C-reactive protein protein CRP-specific RNA aptamer 2.4 μM -5.62 intrinsic     22365749 Binding kinetics as determined by incubating different target concentrations against constant number of aptamers immobilized on sensor surface showed the K d values of 1.98 and 2.4 μM for cRNA and CRP, respectively.
hemin protein Sequence D 2.9 μM -5.538 intrinsic fluorescence   40368877 Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 μ M for sequences C and D, respectively.
thrombin protein A4 3040.0 nM -5.517 intrinsic     23850569 K D A4 1⁄4 3040 nM 65 nM
swine C5a protein S1 4.0 μM -5.398 intrinsic     30336124 Aptamer S1 bound specifically to swine C5a with a dissociation constant of 4 μM as measured by surface plasmon resonance (SPR).
Brevetoxin-2 protein Bap5 4.83 uM -5.316 intrinsic     28058132 The Kd value for the binding between the Bap5 aptamer and BTX-2 was 4.83 uM
H-9 cells cell/EV Apta02 4.93 µM -5.307 non_intrinsic flow_cytometry 310.15 40487293 H-9 cells showed binding with Apta02 ( K D value-4.93 ± 0.367 µ m)
K+ protein Thrombin Binding Aptamer 5000.0 nM -5.301 intrinsic mass_spectrometry 298.15 18318508 the Kd determined from the bestfit curve is 5000 ( 1000 nM for the interaction of TBA and K +
H-9 cells cell/EV Apta04 5.402 µM -5.267 non_intrinsic flow_cytometry 310.15 40487293 H-9 cells showed binding with ... Apta04 ( K D value-5.402 ± 0.795 µ m)
CD20 protein Aptamer 2-f1 5.5 μM -5.26 intrinsic ITC 298.15 39004051 | 2-f1 | 5.5 ± 1.3 | 1.46 ± 0.03 | > mM | N/D |
CD20 protein Aptamer 1 6.4 μM -5.194 intrinsic ITC 298.15 39004051 | 1 | 6.4 ± 1.0 | 0.86 ± 0.01 | N/D | N/D |
hemin protein Sequence C 8.3 μM -5.081 intrinsic fluorescence   40368877 Fitting to a one-site specific binding model using GraphPad Prism software yields the dissociation constant of 8.3 and 2.9 μ M for sequences C and D, respectively.
CD20 protein Aptamer 1-f1 9.0 μM -5.046 intrinsic ITC 298.15 39004051 | 1-f1 | 9.0 ± 2.4 | 0.98 ± 0.02 | > mM | N/D |
P-selectin protein NX244 9000000.0 pM -5.046 intrinsic filter_binding 310.15 9743465 NX244 | 9 X 106
bilirubin protein Brb9 9e-06 M -5.046 intrinsic fluorescence   40669049 The same trend was also observed in the Brb9 aptamer (Figure S4), which showed a K d of 9.0 μM.
amikacin protein Aptamer A 9.999999999999999e-06 M -5.0 intrinsic     36453647 native Aptamer A, which has a K d value of 10 μM
Patulin protein PTL-1 1.2499999999999999e-05 M -4.903 intrinsic ITC 298.15 41473783 The measured K d from ITC value was 12.5 μM
CD123 protein Apta30 15.6 µM -4.807 intrinsic BLI 298.15 40487293 BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 µ m for ZW25 and 15.6 µ m for CY30 (Figure S2, Supporting Information).
Patulin protein PTL-1 1.8399999999999997e-05 M -4.735 intrinsic fluorescence   41473783 yielding an apparent K d of 18.4 μM
CD20 protein Aptamer 1-f2 18.9 μM -4.724 intrinsic ITC 298.15 39004051 | 1-f2 | 18.9 ± 3.3 | 1.07 ± 0.03 | > mM | N/D |
dehydroepiandrosterone sulfate protein DHEAS aptamer (stem, Rp) 32.03 μM -4.494 intrinsic fluorescence   40368877 Values calculated are 32.03 μ M for stem Rp
dehydroepiandrosterone sulfate protein DHEAS aptamer (loop, Rp) 33.28 μM -4.478 intrinsic fluorescence   40368877 33.28 μ M for loop Rp
dehydroepiandrosterone sulfate protein DHEAS aptamer (stem, Sp) 36.57 μM -4.437 intrinsic fluorescence   40368877 36.57 μ M for stem Sp
patulin protein PAT Rep 4e-05 M -4.398 intrinsic SPR   35546052 PAT Rep showed a K D value of 4.0 × 10 -5 M
Patulin protein PAT-6 4.8e-05 M -4.319 intrinsic fluorescence   41473783 PAT-6 has weaker binding affinities ( Kd = 48 μM by ThT, Fig. 4S)
thiamethoxam protein Thi-5R-18 4.935e-05 M -4.307 intrinsic     36831921 According to the ITC results (Figure 5), the Kd value was 4.935 × 10 -5 Mfor Thi-5R-18 combined with the target to release heat
dehydroepiandrosterone sulfate protein DHEAS aptamer (loop, Sp) 59.62 μM -4.225 intrinsic fluorescence   40368877 59.62 μ M for loop Sp
YRLFRK protein BC 007 86.7 μM -4.062 intrinsic     33163683 followed by YRLFRK with Kd = 86.7 μM
L-lactate protein D-Lac1103 8.999999999999999e-05 M -4.046 intrinsic fluorescence   41779931 The true K d for D-Lac1103 was calculated to be 0.09 mM for L-lactate
L-lactate protein Lac2059 0.00011 M -3.959 intrinsic ITC 298.15 41779931 The K d from ITC was determined to be 0.11 mM
L-lactate protein Lac201 0.0009000000000000001 M -3.046 intrinsic fluorescence 296.15 41779931 the fitted K d was 0.9 mM (Figure 5C, black line)
D-lactate protein D-Lac1103 0.0025 M -2.602 intrinsic fluorescence 295.15 41779931 In addition, the apparent K d values for D-Lac1103 are 0.46 mMfor L-lactate and 2.5 mM for D-lactate
Tris(hydroxymethyl)aminomethane protein Tris aptamer 0.0026000000000000003 M -2.585 intrinsic fluorescence   40905906 ThT yielded K d values changed modestly from 1.6 to 2.6 mM
L-lactate protein Lac2059 0.0033 M -2.481 intrinsic fluorescence 296.15 41779931 The fitted K d was 3.3 mM for this 2AP-labeled aptamer
L-lactate protein Lac201 0.0043 M -2.367 intrinsic fluorescence 296.15 41779931 although the obtained K d (4.3 mM) was about 5-fold higher than that obtained using Mg 2+ .
acrylamide protein AA-1 0.0047 M -2.328 intrinsic fluorescence   40261307 Similarly, the AA-1 aptamer exhibited a true K d value of 4.7 mM via the strand-displacement assay
acrylamide protein AA-1 0.0105 M -1.979 intrinsic fluorescence   40261307 the fitted K d value was 10.5 mM
Powered by Datasette · Queries took 27.739ms