kd_measurements: 22
This data as json
| id | source_pmid | aptamer_name | target_name_canonical | target_uniprot | kd_value | kd_unit | kd_log10_molar | binding_constant_type | aptamer_chemistry | aptamer_modifications | assay_method | assay_buffer | assay_ph | assay_temperature_k | assay_cations | verification_status | source_db | source_record_id | aptamer_seq | aptamer_seq_raw | measurement_class | verbatim_quote | seq_source | tier | sequence_status | pi_provenance_flag | include_in_gold | doi |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 22 | 18635004 | 9.8 | murine OX40 | 8.0 | nM | -8.097 | Kd | RNA | 2'F-pyrimidine | filter_binding | 20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2 | 7.4 | verified | step2c_literal_v3 | r00068 | GGGAGGACGATGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCACAGACGACTCGCTGAGGATCCGAGA | GGGAGGACGATGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCACAGA CGACTCGCTGAGGATCCGAGA | intrinsic | Aptamer 9.8 was chosen for further study, since it had the highest affinity for the OX40 fusion protein. | original | v4 | verified_in_text_or_SI | True | 10.1016/j.chembiol.2008.05.016 |