kd_measurements: 36
This data as json
| id | source_pmid | aptamer_name | target_name_canonical | target_uniprot | kd_value | kd_unit | kd_log10_molar | binding_constant_type | aptamer_chemistry | aptamer_modifications | assay_method | assay_buffer | assay_ph | assay_temperature_k | assay_cations | verification_status | source_db | source_record_id | aptamer_seq | aptamer_seq_raw | measurement_class | verbatim_quote | seq_source | tier | sequence_status | pi_provenance_flag | include_in_gold | doi |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 36 | 22282665 | cl.42 | IL4Rα | 14.0 | nM | -7.854 | Kd | RNA | 2'-fluoro-pyrimidines; biotin-conjugated tetranucleotide at 3' terminus | FACS | verified | step2c_literal_v3 | r00164 | TCCCCAACACATTGTCAGCCAAAACGCGAACGAAACCCCG | intrinsic | The calculated K d (14 nM, Fig. 2D) was within the range of anti -IL4R a antibodies | backfill_text_verified | v4 | verified_in_text_or_SI | True | 10.1158/0008-5472.CAN-11-2772 |