kd_measurements: 37
This data as json
| id | source_pmid | aptamer_name | target_name_canonical | target_uniprot | kd_value | kd_unit | kd_log10_molar | binding_constant_type | aptamer_chemistry | aptamer_modifications | assay_method | assay_buffer | assay_ph | assay_temperature_k | assay_cations | verification_status | source_db | source_record_id | aptamer_seq | aptamer_seq_raw | measurement_class | verbatim_quote | seq_source | tier | sequence_status | pi_provenance_flag | include_in_gold | doi |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 37 | 22385910 | RNAR9D-14T | prothrombin | P00734 | 10.0 | nM | -8.0 | Kd | 2'F-RNA | 2' Fluorocytosine; 2' Fluorouracil | filter_binding | Hepes-saline buffer with 0.01% BSA | 7.4 | 310.15 | verified | step2c_literal_v3 | r00210 | GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC | 5'-GG(2'F-C)GG(2'F-U)(2'F-C)GA(2'F-U)(2'F-C)A(2'F-C)A(2'F-C)AG(2'F-U)(2'F-U)(2'F-C)AAA(2'F-C)G(2'F-U)AA(2'F-U)AAG(2'F-C)(2'F-C)AA(2'F-U)G(2'F-U)A(2'F-C)GAGG(2'F-C)AGA(2'F-C)GA(2'F-C)(2'F-U)(2'F-C)G(2'F-C)(2'F-C)-3' | intrinsic | Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) | original | v4 | verified_in_text_or_SI | True | 10.1111/j.1538-7836.2012.04679.x |