kd_measurements: 43
This data as json
| id | source_pmid | aptamer_name | target_name_canonical | target_uniprot | kd_value | kd_unit | kd_log10_molar | binding_constant_type | aptamer_chemistry | aptamer_modifications | assay_method | assay_buffer | assay_ph | assay_temperature_k | assay_cations | verification_status | source_db | source_record_id | aptamer_seq | aptamer_seq_raw | measurement_class | verbatim_quote | seq_source | tier | sequence_status | pi_provenance_flag | include_in_gold | doi |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 43 | 23113766 | 9C7T | hOX40 | 29.0 | nM | -7.538 | Kd | 2'F-RNA | 5'-biotin | filter_binding | selection buffer F (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2, and 0.01% BSA) | 7.5 | 310.15 | verified | step2c_literal_v3 | r00232 | GGGGGAATTCTAATACGACTCACTATAGGGATGCGGAAAAAAGAACACT | intrinsic | observed Kd of * 29nM | backfill_text_verified | v4 | verified_in_text_or_SI | True | 10.1089/nat.2012.0388 |