kd_measurements: 47
This data as json
| id | source_pmid | aptamer_name | target_name_canonical | target_uniprot | kd_value | kd_unit | kd_log10_molar | binding_constant_type | aptamer_chemistry | aptamer_modifications | assay_method | assay_buffer | assay_ph | assay_temperature_k | assay_cations | verification_status | source_db | source_record_id | aptamer_seq | aptamer_seq_raw | measurement_class | verbatim_quote | seq_source | tier | sequence_status | pi_provenance_flag | include_in_gold | doi |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 47 | 24566984 | Gint4.T | PDGFR β | P09619 | 9.6 | nM | -8.018 | Kd | 2'F-RNA | 2'-fluoropyrimidine; nuclease-resistant | filter_binding | verified | step2c_literal_v3 | r00304 | UGUCGUGGGGCAUCGAGUAAAUGCAAUUCGACA | 5′ UGUCGUGGGGCAUCGAGUAAAUGCAAUU CGACA3′ | intrinsic | This aptamer is able to specifically bind to the human PDGFR β ectodomain (Kd: 9.6 nM) | original | v4 | verified_in_text_or_SI | True | 10.1038/mt.2013.300 |