scout: v_kd: 27 rows where assay_method = "BLI" and target_type = "protein" sorted by kd_log10

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical: Target as named in the source paper.
target_type: protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot: UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name: Aptamer identifier as reported.
kd_reported: Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar: log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class: intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type: Kd / apparent-Kd etc. as reported.
assay_method: SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k: Assay temperature (K) — a reason the same pair can have several rows.
source_pmid: PubMed ID of the source paper (links out).
verbatim_quote: The exact sentence the value was taken from.
verification_level: QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status: Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag: PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source: original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

27 rows where assay_method = "BLI" and target_type = "protein" sorted by kd_log10_molar

descending

✎ View and edit SQL

This data as json, CSV (advanced)

id	target_name_canonical	target_type	target_uniprot	aptamer_name	aptamer_seq	kd_reported	kd_log10_molar ▼	measurement_class	binding_constant_type	tier	source_origin	verification_level	sequence_status	seq_source	assay_method	assay_temperature_k	assay_ph	assay_buffer	assay_cations	aptamer_chemistry	aptamer_modifications	source_pmid	doi	verbatim_quote	source_db
63	CD8a	protein	P01732	A8		5.59 nM	-8.253	intrinsic	Kd	Gold	v4	extraction_verified	pending_supp_oa		BLI	298.15		binding buffer with 0.01% Tween 20		DNA		31209354	10.1038/s41551-019-0411-6	the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively	step2c_literal_v3
87	transferrin receptor 1	protein	P02786	JBA8.26		6.87 nM	-8.163	intrinsic	Kd	Gold	v4	extraction_verified	pending_supp_oa		BLI					DNA		35875870	10.1021/jacs.2c05349	Using BLI, JBA8.26 was found to bind immobilized TfR1 with a K D of 6.87 ± 0.04 nM	step2c_literal_v3
92	Okadaic Acid	protein	O95232	OA-LC2-TF		8.735 nM	-8.059	intrinsic	Kd	Gold	v4	extraction_verified	pending_manual_supp		BLI		7.5	50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)	2.0	DNA	terminal fixation with GC-rich sequences	36322695	10.1021/acs.analchem.2c02653	The terminal-fixed OA-LC2 (OA-LC2-TF) exhibited a K d of 8.735 ± 0.606 nM	step2c_literal_v3
101	thrombin	protein	P00734	Uyne A - AUyne		12.16 nM	-7.915	intrinsic	Kd	Gold	v4	extraction_verified	pending_manual_supp		BLI			buffer used for the bead-based selection, which contains Tween-20		DNA	5-ethynyl-2′-deoxyuridine (Uyne); Biotin (5' end)	37531184	10.1021/acschembio.3c00183	U yne A - AUyne \| 12.16 ± 0.02	step2c_literal_v3
100	thrombin	protein	P00734	Uyne A - Uyne Uyne		13.96 nM	-7.855	intrinsic	Kd	Gold	v4	extraction_verified	pending_manual_supp		BLI			buffer used for the bead-based selection, which contains Tween-20		DNA	5-ethynyl-2′-deoxyuridine (Uyne); Biotin (5' end)	37531184	10.1021/acschembio.3c00183	U yne A - U yne U yne \| 13.96 ± 0.03	step2c_literal_v3
62	CD8a	protein	P01732	A3		14.7 nM	-7.833	intrinsic	Kd	Gold	v4	extraction_verified	pending_supp_oa		BLI	298.15		binding buffer with 0.01% Tween 20		DNA		31209354	10.1038/s41551-019-0411-6	the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively	step2c_literal_v3
95	Dinophysistoxin	protein		DTX-SL1-TF		15.45 nM	-7.811	intrinsic	Kd	Gold	v4	extraction_verified	pending_manual_supp		BLI		7.5	50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)	2.0	DNA	terminal fixation	36322695	10.1021/acs.analchem.2c02653	DTX-SL1-TF showed a K d of 15.45 ± 1.92 nM	step2c_literal_v3
421	hnRNP A1	protein	P09651	AS1411	GGTGGTGGTGGTTGTGGTGGTGGTGG	1.75e-08 M	-7.757	intrinsic	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original	BLI		7.4	BLI buffer (20 mM phosphate buffer, 8 mM KCl, 137 mM NaCl, 0.05% surfactant P20)		DNA		38784467	10.1039/d3md00752a	for AS1411, the K d value was 17.5 nM (Fig. 6B)	step2c_acs_v1
61	CD8a	protein	P01732	A1		20.1 nM	-7.697	intrinsic	Kd	Gold	v4	extraction_verified	pending_supp_oa		BLI	298.15		binding buffer with 0.01% Tween 20		DNA		31209354	10.1038/s41551-019-0411-6	the A1, A3 and A8 aptamers bound the protein with binding affinities ( K D values) of 20.1 ± 0.2, 14.7 ± 0.1 and 5.59 ± 0.11 nM, respectively	step2c_literal_v3
422	hnRNP A1	protein	P09651	TBA	GGTTGGTGTGGTTGG	2.1100000000000004e-08 M	-7.676	intrinsic	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original	BLI		7.4	BLI buffer (20 mM phosphate buffer, 8 mM KCl, 137 mM NaCl, 0.05% surfactant P20)		DNA		38784467	10.1039/d3md00752a	for TBA, the K d value was 21.1 nM (Fig. 6A)	step2c_acs_v1
94	Dinophysistoxin	protein		DTX-SL1		21.75 nM	-7.663	intrinsic	Kd	Gold	v4	extraction_verified	pending_manual_supp		BLI		7.5	50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)	2.0	DNA		36322695	10.1021/acs.analchem.2c02653	DTX-SL1 showed the lowest K d at 21.75 ± 1.42 nM	step2c_literal_v3
128	CD117	protein	P10721	Apta02		21.8 nM	-7.662	intrinsic	Kd	Gold	v4	extraction_verified	pending_supp_oa		BLI	298.15				DNA		40487293	10.1002/adfm.202425394	Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 µ m, respectively ( Figure 2 a,b).	step2c_literal_v3
373	beta-conglutin	protein		11-mer	GGTGGGGGTGG	2.3300000000000003e-08 M	-7.633	intrinsic	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original	BLI	303.15	7.4	PBS, 1.5 mM MgCl2, pH 7.4, 0.1% Tween-20		DNA		33498970	10.3390/ijms22031150	A 2:1 heterogenous model was used to fit the data and calculate the binding affinities resulting in two different KD values of 6.95 and 23.30 nM.	step2c_acs_v1
86	transferrin receptor 1	protein	P02786	tJBA8.1		25.11 nM	-7.6	intrinsic	Kd	Gold	v4	extraction_verified	pending_supp_oa		BLI					DNA	biotinylated	35875870	10.1021/jacs.2c05349	tJBA8.1 bound the TfR1 protein with a K D value of 25.11 ± 0.19 nM	step2c_literal_v3
253	rmCD3 d ε	protein		CD3_Apt1 dimer	CCCGATTGATTCGCAATGTGCGTCCCCTCGTGCC	25.2 nM	-7.599	non_intrinsic	Kd	Gold	v4	extraction_verified	verified_in_text_or_SI	backfill_text_verified	BLI	298.15		PBS +/+ buffer		2'F-RNA	dimerized via ssDNA scaffold	38745854	10.1016/j.omtn.2024.102198	The affinity of the dimeric aptamer was determined by OCTET and was 25.2 nM for Apt1 dimer	step2c_literal_v3
98	thrombin	protein	P00734	HD22 (TA-TT)	AGTCCGTGGTAGGGCAGGTTGGGGTGACTGTAAACGCTCGCTTCGATCTAGTCCGTGGGGGCAGGGGGGTGACTAGCAGATATGCATCCGTAGC	27.8 nM	-7.556	intrinsic	Kd	Gold	v4	extraction_verified	verified_in_text_or_SI	original	BLI			buffer used for the bead-based selection, which contains Tween-20		DNA	Biotin (5' end)	37531184	10.1021/acschembio.3c00183	TA - TT \| 27.80 ± 0.09	step2c_literal_v3
99	thrombin	protein	P00734	TA-AT		38.7 nM	-7.412	intrinsic	Kd	Gold	v4	extraction_verified	pending_manual_supp		BLI			buffer used for the bead-based selection, which contains Tween-20		DNA	Biotin (5' end)	37531184	10.1021/acschembio.3c00183	TA - AT \| 38.7 ± 0.5	step2c_literal_v3
91	Okadaic Acid	protein	O95232	OA-LC2		91.13 nM	-7.04	intrinsic	Kd	Gold	v4	extraction_verified	pending_manual_supp		BLI		7.5	50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)	2.0	DNA		36322695	10.1021/acs.analchem.2c02653	OA-LC2 exhibited K d of 91.13 ± 4.64 nM	step2c_literal_v3
89	Okadaic Acid	protein	O95232	OA-SL2		103.4 nM	-6.985	intrinsic	Kd	Gold	v4	extraction_verified	pending_manual_supp		BLI		7.5	50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)	2.0	DNA		36322695	10.1021/acs.analchem.2c02653	from OA-SL1 to OASL2, K d was lowered from 340.5 ± 14.5 to 103.4 ± 7.0 nM	step2c_literal_v3
96	Phosphatidylserine	protein	Q9UG56	PS-LC3-TF		166.2 nM	-6.779	intrinsic	Kd	Gold	v4	extraction_verified	pending_manual_supp		BLI		7.6	150 mM NaCl and 50 mM K2HPO4 (pH 7.6)		DNA	terminal fixation	36322695	10.1021/acs.analchem.2c02653	The terminal-fixed PS-LC3-TF exhibited an even lower K d at 166.2 ± 10.7 nM	step2c_literal_v3
254	rmCD3 d ε	protein		CD3_Apt12 dimer	TCCCCTGTCGATATCCACCGTCTGGCCCGCATTGA	218.0 nM	-6.662	non_intrinsic	Kd	Gold	v4	extraction_verified	verified_in_text_or_SI	backfill_text_verified	BLI	298.15		PBS +/+ buffer		2'F-RNA	dimerized via ssDNA scaffold	38745854	10.1016/j.omtn.2024.102198	218 nM for Apt12 dimer	step2c_literal_v3
90	Okadaic Acid	protein	O95232	OA-SL3		234.4 nM	-6.63	intrinsic	Kd	Gold	v4	extraction_verified	pending_manual_supp		BLI		7.5	50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)	2.0	DNA		36322695	10.1021/acs.analchem.2c02653	When OA-SL1 was tripled to get the chimera OA-SL3, K d rose to 234.4 ± 15.6 nM	step2c_literal_v3
93	Dinophysistoxin	protein		anti-DTX parent aptamer		778.1 nM	-6.109	intrinsic	Kd	Gold	v4	extraction_verified	pending_manual_supp		BLI		7.5	50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)	2.0	DNA		36322695	10.1021/acs.analchem.2c02653	antiDTX parent aptamer ( K d = 778.1 ± 73.5 nM)	step2c_literal_v3
129	CD117	protein	P10721	Apta04		1100.0 nM	-5.959	intrinsic	Kd	Gold	v4	extraction_verified	pending_supp_oa		BLI	298.15				DNA		40487293	10.1002/adfm.202425394	Apta02 and Apta04 exhibited K D 's of 21.8 nm and 1.10 µ m, respectively ( Figure 2 a,b).	step2c_literal_v3
131	CD123	protein	O75794	Apta25		1.16 µM	-5.936	intrinsic	Kd	Gold	v4	extraction_verified	pending_supp_oa		BLI	298.15				DNA		40487293	10.1002/adfm.202425394	BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 µ m for ZW25 and 15.6 µ m for CY30 (Figure S2, Supporting Information).	step2c_literal_v3
88	Okadaic Acid	protein	O95232	anti-OA parent aptamer		1402.0 nM	-5.853	intrinsic	Kd	Gold	v4	extraction_verified	pending_manual_supp		BLI		7.5	50 mM Tris, 150 mM NaCl, 2 mM MgCl2, and 0.02% Tween-20 (pH 7.5)	2.0	DNA		36322695	10.1021/acs.analchem.2c02653	anti-OA aptamer with high affinity from its parent aptamer ( K d = 1402 ± 58 nM, Figure 1a)	step2c_literal_v3
130	CD123	protein	O75794	Apta30		15.6 µM	-4.807	intrinsic	Kd	Gold	v4	extraction_verified	pending_supp_oa		BLI	298.15				DNA		40487293	10.1002/adfm.202425394	BLI binding assays of both aptamers demonstrated binding to human recombinant CD123 with K D s of 1.16 µ m for ZW25 and 15.6 µ m for CY30 (Figure S2, Supporting Information).	step2c_literal_v3

Advanced export

JSON shape: default, array, newline-delimited

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';

Binding affinities (Kd) — source-verified (view)

27 rows where assay_method = "BLI" and target_type = "protein" sorted by kd_log10_molar

Advanced export