Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

12 rows where assay_method = "ITC" and target_type = "protein" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: target_name_canonical, target_uniprot, seq_source, assay_temperature_k, assay_ph, assay_buffer, aptamer_chemistry, aptamer_modifications, source_pmid, doi, source_db

verification_level 2

tier 1

target_type 1

  • protein · 12 ✖

measurement_class 1

binding_constant_type 1

assay_method 1

  • ITC · 12 ✖
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
115 HFIXa protein   Seq 11 ATTGGCACTCCACGCATAGGCCGCCCACTTAAGCGCACGCGTCGACGATTTCGCACAGTCCCTATGCGTGCTACCGTGAA 4.93 nM -8.307 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   ITC 298.15 7.4 1 × HEPES (pH 7.4)   DNA FAM 38776649 10.1016/j.bioorg.2024.107463 Seq 11- | 7.4 | 0.983 | 203 ± | 4.93 | 130.6 | 279 | 47.42 step2c_literal_v3
416 Sterigmatocystin protein   H Seq02 GAATACGGATTACTGTTCGTACTGACCTATGCTGTGGAGT 2.53e-08 M -7.597 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI original   ITC         DNA amino-modified 38175632 10.1021/acs.analchem.3c03675 The final fitting curve showed a reduced chi-squared (kcal/mol) 2 of 0.871, and the K D value was 25.3 nM. step2c_acs_v1
114 HFIXa protein   Seq 5 ATTGGCACTCCACGCATAGGGCCACGTCCCTCTATGAGTCGGCACGATGCCAGGCACCTCCCTATGCGTGCTACCGTGAA 74.07 nM -7.13 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original   ITC 298.15 7.4 1 × HEPES (pH 7.4)   DNA FAM 38776649 10.1016/j.bioorg.2024.107463 Seq 5- | 7.4 | 0.921 | 13.5 | 74.07 | 209.1 | 565 | 40.43 step2c_literal_v3
97 N-acetylneuraminic acid protein Q8NFW8 Neu5Ac aptamer   91.0 nM -7.041 intrinsic Kd Gold v4 extraction_verified pending_supp_oa     ITC 310.15 7.4 1× aptamer binding buffer (50 mM Tris-HCl, 5 mM KCl, 100 mM NaCl and 1 mM MgCl2, pH 7.4) 1.0 DNA   37217750 10.1038/s41587-023-01801-z To validate ARPLA, we first determined the binding affinity ( K d ) of the Neu5Ac aptamer by isothermal titration calorimetry (ITC) as 91 nM (Extended Data Fig. 2a,b) step2c_literal_v3
117 CD20 protein P11836 Aptamer 2   1.2 μM -5.921 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ITC 298.15 7.4 TGK Buffer   DNA   39004051 10.1016/j.bmc.2024.117831 | 2 | 1.2 ± 0.2 | 1.49 ± 0.01 | > mM | N/D | step2c_literal_v3
396 amikacin protein   Aptamer A1 GGACUGGGCGAGAAGUUUAGUCC 1.5e-06 M -5.824 intrinsic Kd Gold v4 multi_agent_verified verified_in_text_or_SI backfill_text_verified   ITC 298.15   RNase free water   RNA 2'-5' linkage at G15-U16 36453647 10.1021/acschembio.2c00653 Aptamer A1 binds 7-fold stronger to amikacin with a K d value of 1.5 μM step2c_acs_v1
120 CD20 protein P11836 Aptamer 2-f1   5.5 μM -5.26 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ITC 298.15 7.4 TGK Buffer   DNA   39004051 10.1016/j.bmc.2024.117831 | 2-f1 | 5.5 ± 1.3 | 1.46 ± 0.03 | > mM | N/D | step2c_literal_v3
116 CD20 protein P11836 Aptamer 1   6.4 μM -5.194 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ITC 298.15 7.4 TGK Buffer   DNA   39004051 10.1016/j.bmc.2024.117831 | 1 | 6.4 ± 1.0 | 0.86 ± 0.01 | N/D | N/D | step2c_literal_v3
118 CD20 protein P11836 Aptamer 1-f1   9.0 μM -5.046 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ITC 298.15 7.4 TGK Buffer   DNA   39004051 10.1016/j.bmc.2024.117831 | 1-f1 | 9.0 ± 2.4 | 0.98 ± 0.02 | > mM | N/D | step2c_literal_v3
462 Patulin protein   PTL-1   1.2499999999999999e-05 M -4.903 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     ITC 298.15 6.0 selection buffer (10 mM MES, pH 6.0, 150 mM NaCl, 5 mM MgCl2)   DNA   41473783 10.1186/s44280-025-00101-2 The measured K d from ITC value was 12.5 μM step2c_acs_v1
119 CD20 protein P11836 Aptamer 1-f2   18.9 μM -4.724 intrinsic Kd Gold v4 extraction_verified pending_manual_supp     ITC 298.15 7.4 TGK Buffer   DNA   39004051 10.1016/j.bmc.2024.117831 | 1-f2 | 18.9 ± 3.3 | 1.07 ± 0.03 | > mM | N/D | step2c_literal_v3
470 L-lactate protein Q9BYZ2 Lac2059   0.00011 M -3.959 intrinsic Kd Gold v4 multi_agent_verified pending_manual_supp     ITC 298.15   SELEX buffer   DNA   41779931 10.1021/acs.analchem.5c07149 The K d from ITC was determined to be 0.11 mM step2c_acs_v1

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';