Binding affinities (Kd) — source-verified (view)

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical
Target as named in the source paper.
target_type
protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot
UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name
Aptamer identifier as reported.
kd_reported
Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar
log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class
intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type
Kd / apparent-Kd etc. as reported.
assay_method
SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k
Assay temperature (K) — a reason the same pair can have several rows.
source_pmid
PubMed ID of the source paper (links out).
verbatim_quote
The exact sentence the value was taken from.
verification_level
QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status
Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag
PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source
original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

12 rows where assay_method = "SPR" and target_type = "glycan/conjugate" sorted by kd_log10_molar

✎ View and edit SQL

This data as json, CSV (advanced)

Suggested facets: target_name_canonical, target_uniprot, aptamer_name

verification_level 1

tier 1

target_type 1

  • glycan/conjugate · 12 ✖

measurement_class 1

binding_constant_type 1

assay_method 1

  • SPR · 12 ✖
id target_name_canonical target_type target_uniprot aptamer_name aptamer_seq kd_reported kd_log10_molar ▼ measurement_class binding_constant_type tier source_origin verification_level sequence_status seq_source pi_provenance_flag assay_method assay_temperature_k assay_ph assay_buffer assay_cations aptamer_chemistry aptamer_modifications source_pmid doi verbatim_quote source_db
9 sLe X -BSA glycan/conjugate Q9NSU2 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 5.7e-11 M -10.244 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR 298.15 7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 sLe X -BSA | 6.4 3 10 7 | 3.7 3 10 2 3 | 1.7 3 10 10 | 5.7 3 10 2 11 step2c_literal_v3
3 sLe X -BSA glycan/conjugate Q9NSU2 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 8.5e-11 M -10.071 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR 298.15 7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 5 | 1.3 3 10 5 | 1.1 3 10 2 5 | 1.1 3 10 10 | 8.5 3 10 2 11 step2c_literal_v3
2 sLe X -BSA glycan/conjugate Q9NSU2 Selected pool   5.8e-10 M -9.237 intrinsic Kd Gold v4 extraction_verified no_single_sequence_pool   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Selected pool | 2.4 3 10 5 | 1.4 3 10 2 3 | 1.7 3 10 9 | 5.8 3 10 2 10 step2c_literal_v3
4 sLe X -BSA glycan/conjugate Q9NSU2 Clone 2   8e-10 M -9.097 intrinsic Kd Gold v4 extraction_verified pending_manual_figure   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 2 | 9.8 3 10 5 | 7.3 3 10 2 5 | 1.2 3 10 9 | 8.0 3 10 2 10 step2c_literal_v3
5 sLe X -BSA glycan/conjugate Q9NSU2 Clone 15   2.3e-09 M -8.638 intrinsic Kd Gold v4 extraction_verified pending_manual_figure   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 15 | 3.5 3 10 5 | 8.1 3 10 2 4 | 4.3 3 10 8 | 2.3 3 10 2 9 step2c_literal_v3
11 sLe X glycan/conjugate Q9NSU2 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 3.3e-09 M -8.481 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 sLe X | 1.7 3 10 5 | 5.5 3 10 2 4 | 3.0 3 10 8 | 3.3 3 10 2 9 step2c_literal_v3
6 sLe X -BSA glycan/conjugate Q9NSU2 Clone 18   3.9e-09 M -8.409 intrinsic Kd Gold v4 extraction_verified pending_manual_figure   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 18 | 5.1 3 10 5 | 2.0 3 10 2 3 | 2.5 3 10 8 | 3.9 3 10 2 9 step2c_literal_v3
7 sLe X -BSA glycan/conjugate Q9NSU2 Clone 4   7.4e-09 M -8.131 intrinsic Kd Gold v4 extraction_verified pending_manual_figure   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 4 | 4.1 3 10 5 | 3.1 3 10 2 3 | 1.3 3 10 8 | 7.4 3 10 2 9 step2c_literal_v3
8 sLe X -BSA glycan/conjugate Q9NSU2 Clone 9   1e-08 M -8.0 intrinsic Kd Gold v4 extraction_verified pending_manual_figure   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Clone 9 | 3.5 3 10 5 | 3.1 3 10 2 3 | 9.5 3 10 7 | 1.0 3 10 2 8 step2c_literal_v3
12 sLe A glycan/conjugate P0C0L4 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 1.7e-08 M -7.77 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 sLe A | 1.2 3 10 3 | 1.9 3 10 2 5 | 5.9 3 10 7 | 1.7 3 10 2 8 step2c_literal_v3
10 BSA glycan/conjugate O95870 Clone 5 GGUGCAGGUCACUUCGAUGAGUGUAAAGCACAGGUAAGUGUCUUGGUAGAAUCGGAGUCGGUGACCGUU 1e-07 M -7.0 intrinsic Kd Gold v4 extraction_verified verified_in_text_or_SI original KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 BSA | 2.2 3 10 4 | 2.3 3 10 2 3 | 9.9 3 10 6 | 1.0 3 10 2 7 step2c_literal_v3
1 sLe X -BSA glycan/conjugate Q9NSU2 Original pool   1.3e-07 M -6.886 intrinsic Kd Gold v4 extraction_verified no_single_sequence_pool   KEEP_seq_in_figure SPR   7.4 RNA binding buffer [150 mM NaCl, 20 mM Hepes (pH 7.4), 1 mM CaCl2, 1 mM MgCl2] 1.0 RNA   11178986 10.1006/bbrc.2001.4327 Original pool | 2.6 3 10 4 | 3.3 3 10 2 3 | 7.6 3 10 6 | 1.3 3 10 2 7 step2c_literal_v3

Advanced export

JSON shape: default, array, newline-delimited

CSV options: 

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';