scout: v_kd: 14 rows where assay_method = "SPR" and verification_level = "multi_agent_verified" sorted by kd_log10

742 distinct verbatim-verified aptamer–target Kd measurements (canonical Gold v1; 555 intrinsic-equilibrium; 300 unique targets; 287 publications; 435 carry a verbatim-verified sequence). ★HOW TO READ: 'kd_reported' is the value EXACTLY as written in the paper (units are MIXED — pM/nM/M — so it is NOT directly comparable). To compare, sort, or train an ML model, use ONLY 'kd_log10_molar' (lower = tighter) and filter measurement_class=intrinsic + target_type=protein. The same target appears in several rows because of different aptamers, assays, conditions (temperature/buffer) or papers — see those columns. For a clean ready-to-use subset use the 'kd_ready_to_use' query. Source: corpus literature-extraction pipeline (E. Dohi).

Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target

target_name_canonical: Target as named in the source paper.
target_type: protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
target_uniprot: UniProt accession when a human protein (sparse for now; links to apt-scout target).
aptamer_name: Aptamer identifier as reported.
kd_reported: Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
kd_log10_molar: log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
measurement_class: intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
binding_constant_type: Kd / apparent-Kd etc. as reported.
assay_method: SPR / filter binding / flow cytometry / ITC / BLI …
assay_temperature_k: Assay temperature (K) — a reason the same pair can have several rows.
source_pmid: PubMed ID of the source paper (links out).
verbatim_quote: The exact sentence the value was taken from.
verification_level: QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
sequence_status: Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
pi_provenance_flag: PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
seq_source: original (already in source DB) / backfill_text_verified (recovered from paper or SI text).

14 rows where assay_method = "SPR" and verification_level = "multi_agent_verified" sorted by kd_log10_molar

descending

✎ View and edit SQL

This data as json, CSV (advanced)

id	target_name_canonical	target_type	target_uniprot	aptamer_name	aptamer_seq	kd_reported	kd_log10_molar ▼	measurement_class	binding_constant_type	tier	source_origin	verification_level	sequence_status	seq_source	assay_method	assay_temperature_k	assay_ph	assay_buffer	aptamer_chemistry	aptamer_modifications	source_pmid	doi	verbatim_quote	source_db
478	FLRPp (O serotype)	protein		FMD_1		3.46e-10 M	-9.461	intrinsic	Kd	Gold	v4	multi_agent_verified	pending_manual_supp		SPR				DNA		42010751	10.1021/acs.analchem.5c04748	dissociation constants ( KD ) of 3.46 × 10 -10 M	step2c_acs_v1
337	human α-thrombin	protein	P00734	LOOPER modified thrombin aptamer		1.6000000000000003e-09 M	-8.796	intrinsic	Kd	Gold	v4	multi_agent_verified	pending_manual_supp		SPR				DNA	diversely functionalized; heteromultivalent	28938065	10.1021/jacs.7b07241	Using single-cycle kinetics surface plasmon resonance (SPR), the LOOPER aptamer exhibited a Kd of 1.6 nM	step2c_acs_v1
320	VEGF165	protein	P15692	VEap121	TGTGGGGGTGGACGGGCCGGGTAGA	4.700000000000001e-09 M	-8.328	intrinsic	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original	SPR	293.15	7.4	Tris-buffered saline (TBS: 10 mM Tris-HCl, 100 mM NaCl, 5 mM KCl, pH 7.4)	DNA		23237717	10.1021/ac303023d	As the calculated K d value of VEap121 was 4.7 nM	step2c_acs_v1
314	hMMP-9	protein		F3Bomf		2e-08 M	-7.699	intrinsic	Kd	Gold	v4	multi_agent_verified	pending_manual_supp		SPR	296.15		PBS buffer	2'-OMe-RNA	2'-O-methyl purine; 2'-fluoro pyrimidine; 5'-hexylamino linker; 5'-MAG3 conjugate	23043415	10.1021/bc300146c	The K d was taken as the concentration leading to half saturation, i.e., about 20 nM.	step2c_acs_v1
352	FGFR3 K650E	protein		SU-3	CAGAGGCTGACGTAAACAGACATTGATGGGACCCACCCTTCCGCTGGCAA	2.82e-08 M	-7.55	intrinsic	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original	SPR			1 × PBS	DNA		31265241	10.1021/acscombsci.9b00059	The predicted K D was 28.2 × 10 -9 ± 19.6 × 10 -9 M( n = 5) in 1 × PBS bu ff er, using 1:1 Langmuir binding model.	step2c_acs_v1
365	Thrombin	protein	P00734	aptamer 2S	TATGGTTGGTGTGGTTGGATA	2.9400000000000002e-08 M	-7.532	intrinsic	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original	SPR		7.6	PBS buffer (pH 7.6) containing 138 mM NaCl and 2.7 mM KCl	DNA		32268723	10.1021/acs.analchem.0c00380	The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 μM and 29.4 nM, respectively	step2c_acs_v1
370	ODAM	protein	A1E959	OD64		4.771e-08 M	-7.321	intrinsic	Kd	Gold	v4	multi_agent_verified	pending_manual_figure		SPR				DNA		33455205	10.1021/acsbiomaterials.0c01203	the obtained OD64 and OD35 (aptamer cognate pair) presented high a ffi nity and excellent speci fi city, along with dissociation constants ( K d ) of 47.71 nM (OD64)	step2c_acs_v1
371	ODAM	protein	A1E959	OD35		5.1360000000000005e-08 M	-7.289	intrinsic	Kd	Gold	v4	multi_agent_verified	pending_manual_figure		SPR				DNA		33455205	10.1021/acsbiomaterials.0c01203	the obtained OD64 and OD35 (aptamer cognate pair) presented high a ffi nity and excellent speci fi city, along with dissociation constants ( K d ) of 47.71 nM (OD64) and 51.36 nM (OD35).	step2c_acs_v1
383	Aβ42 oligomer	protein		Aβ-Apt	CGGTGGGGGACCAGTACAAAAGTGGGTAGGGCGGGTTGGAAAA	5.33e-08 M	-7.273	intrinsic	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original	SPR	298.15	7.4	1 × BB: 150 mM NaCl, 10 mM Tris -HCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, pH 7.4	DNA		35019631	10.1021/acsabm.0c00996	suggesting that the binding a ffi nity of A β -Apt with A β 42 oligomer ( K d = 53.3 nM) was stronger than that of A β -Apt with A β 42 monomer.	step2c_acs_v1
382	Aβ42 monomer	protein	P12821	Aβ-Apt	CGGTGGGGGACCAGTACAAAAGTGGGTAGGGCGGGTTGGAAAA	6.34e-08 M	-7.198	intrinsic	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original	SPR	298.15	7.4	1 × BB: 150 mM NaCl, 10 mM Tris -HCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, pH 7.4	DNA		35019631	10.1021/acsabm.0c00996	It was evaluated that A β -Apt showed the ability to bind A β 42 with a K d of 63.4 nM.	step2c_acs_v1
386	patulin	protein		PAT C3	CGAAATCGCGTCCAGTGTTGGGGCGTGCTTATCCTTACACGATTTACCTGAAACGCACCGTACTGAACTACGGCGAGGTC	8.2e-08 M	-7.086	intrinsic	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original	SPR			PBS	DNA	5' biotin	35546052	10.1021/acs.jafc.2c01591	PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 × 10 -8 and 1.9 × 10 -7 M, respectively	step2c_acs_v1
387	patulin	protein		PAT C4	CGAAATCGCGTCCAGTGTTGCCGATCTCCGTATCTTTCCTGTTGTTGGTTAGAGATTAGGTACTGAACTACGGCGAGGTC	1.9e-07 M	-6.721	intrinsic	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original	SPR			PBS	DNA	5' biotin	35546052	10.1021/acs.jafc.2c01591	PAT C3 and C4 showed a ffi nity to patulin with a K D value of 8.2 × 10 -8 and 1.9 × 10 -7 M, respectively	step2c_acs_v1
364	Thrombin	protein	P00734	aptamer 1S	TATGGTTGGTGTGGTTGGATA	1.08e-06 M	-5.967	intrinsic	Kd	Gold	v4	multi_agent_verified	verified_in_text_or_SI	original	SPR		7.6	PBS buffer (pH 7.6) containing 138 mM NaCl and 2.7 mM KCl	DNA	azobenzene (X)	32268723	10.1021/acs.analchem.0c00380	The K d values of thrombin with aptamers 1S and 2S were calculated to be 1.08 μM and 29.4 nM, respectively	step2c_acs_v1
388	patulin	protein		PAT Rep		4e-05 M	-4.398	intrinsic	Kd	Gold	v4	multi_agent_verified	pending_manual_supp		SPR			PBS	DNA	5' biotin	35546052	10.1021/acs.jafc.2c01591	PAT Rep showed a K D value of 4.0 × 10 -5 M	step2c_acs_v1

Advanced export

JSON shape: default, array, newline-delimited

CREATE VIEW v_kd AS
SELECT k.id,
 target_name_canonical,
 CASE
   WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
   WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
   ELSE 'protein'
 END AS target_type,
 target_uniprot, aptamer_name, aptamer_seq,
 (COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
 CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
 measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
 CASE
   WHEN vh.verdict='confirmed' THEN 'human_verified'
   WHEN vh.verdict='corrected' THEN 'human_corrected'
   WHEN vh.verdict='rejected'  THEN 'human_rejected'
   WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
   WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
   ELSE 'automated'
 END AS verification_level,
 sequence_status, seq_source, pi_provenance_flag,
 assay_method,
 CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
 CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
 assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
 source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';

Binding affinities (Kd) — source-verified (view)

14 rows where assay_method = "SPR" and verification_level = "multi_agent_verified" sorted by kd_log10_molar

Advanced export