Binding affinities (Kd) — source-verified (view)
Data license: CC BY 4.0 · Data source: apt-scout automated curation pipeline (E. Dohi, NCNP) — values harvested from public databases; raw source stored per target
- target_name_canonical
- Target as named in the source paper.
- target_type
- protein / cell-line+EV / glycan-conjugate. Filter to 'protein' for molecular targets.
- target_uniprot
- UniProt accession when a human protein (sparse for now; links to apt-scout target).
- aptamer_name
- Aptamer identifier as reported.
- kd_reported
- Kd value AS REPORTED in the paper (value + unit). Units are MIXED — do NOT compare this column directly.
- kd_log10_molar
- log10(Kd in molar). THE column to sort / compare / learn on (lower = tighter).
- measurement_class
- intrinsic = equilibrium vs purified target; non_intrinsic = apparent/cellular or avidity (NOT comparable to intrinsic).
- binding_constant_type
- Kd / apparent-Kd etc. as reported.
- assay_method
- SPR / filter binding / flow cytometry / ITC / BLI …
- assay_temperature_k
- Assay temperature (K) — a reason the same pair can have several rows.
- source_pmid
- PubMed ID of the source paper (links out).
- verbatim_quote
- The exact sentence the value was taken from.
- verification_level
- QC status (honest, growing): human_verified / human_corrected = a logged human verdict from the stratified-random sample; multi_agent_verified = passed independent multi-agent (L2) check; extraction_verified = extraction-pipeline verified; automated. Human verification is in progress: as of this release 0 records carry a logged human verdict — the published set is multi-agent-/extraction-verified, and human spot-checking is being added post-publication (version-tracked). No record is labelled human_verified without a logged human review.
- sequence_status
- Aptamer-sequence provenance: verified_in_text_or_SI = sequence verbatim-verified against the source text/SI (shown); pending_manual_supp / pending_supp_oa / pending_manual_figure = sequence reported only in a (often paywalled) SI or a figure, being curated post-submission; no_single_sequence_pool = a pool/library/primer, no single sequence exists.
- pi_provenance_flag
- PI manual-review flag: KEEP_seq_in_figure = valid record, sequence is in a 3D-structure figure; FLAG_cited_data = Kd may be a value cited from elsewhere, re-verify. (EXCLUDE rows are hidden from this view.)
- seq_source
- original (already in source DB) / backfill_text_verified (recovered from paper or SI text).
28 rows where assay_method = "filter_binding" and tier = "Gold" sorted by kd_log10_molar
This data as json, CSV (advanced)
Suggested facets: target_name_canonical, target_uniprot, aptamer_name, aptamer_seq, kd_reported, kd_log10_molar, seq_source, assay_temperature_k, assay_ph, assay_buffer, aptamer_chemistry, aptamer_modifications, source_pmid, doi
sequence_status 3
measurement_class 2
- intrinsic 25
- non_intrinsic 3
verification_level 1
tier 1
- Gold · 28 ✖
target_type 1
- protein 28
binding_constant_type 1
- Kd 28
assay_method 1
- filter_binding · 28 ✖
| id | target_name_canonical | target_type | target_uniprot | aptamer_name | aptamer_seq | kd_reported | kd_log10_molar ▼ | measurement_class | binding_constant_type | tier | source_origin | verification_level | sequence_status | seq_source | pi_provenance_flag | assay_method | assay_temperature_k | assay_ph | assay_buffer | assay_cations | aptamer_chemistry | aptamer_modifications | source_pmid | doi | verbatim_quote | source_db |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 269 | thrombin | protein | P00734 | HD1-12A-DAB | 13.1 pM | -10.883 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | filter_binding | selection buffer | DNA | 41053535 | 10.1002/advs.202509867 | HD1-12A-DAB EXACT inhibitor bound to thrombin and prothrombin with K D s of 13.1 pm | step2c_literal_v3 | |||||||
| 143 | P-selectin | protein | Q14242 | PF377 | 14.0 pM | -10.854 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 310.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF377 | 14 | step2c_literal_v3 | ||||
| 147 | P-selectin | protein | Q14242 | PF377sl | 14.0 pM | -10.854 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 296.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF377sl | 14 | step2c_literal_v3 | ||||
| 142 | P-selectin | protein | Q14242 | PF377 | 16.0 pM | -10.796 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 310.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF377 | 16 | step2c_literal_v3 | ||||
| 144 | P-selectin | protein | Q14242 | PF377 | 18.0 pM | -10.745 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 277.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF377 | 18 | step2c_literal_v3 | ||||
| 146 | P-selectin | protein | Q14242 | PF377sl | 29.0 pM | -10.538 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 310.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF377sl | 29 | step2c_literal_v3 | ||||
| 145 | P-selectin | protein | Q14242 | PF377sl | 46.0 pM | -10.337 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 310.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF377sl | 46 | step2c_literal_v3 | ||||
| 148 | P-selectin | protein | Q14242 | PF373sl | 56.0 pM | -10.252 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 310.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF373sl | 56 | step2c_literal_v3 | ||||
| 152 | PDGF-BB | protein | P01127 | PDGF-B aptamer | 0.1 nM | -10.0 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | DNA | 2'-fluoro; 2'-O-methyl; hexaethylene glycol spacer; inverted 3'-3' thymidine cap; 40-kd PEG conjugated | 9916931 | 10.1016/S0002-9440(10)65263-7 | the binding affinity of the aptamer used in the experiments described below ( K d ≈ 0.1 nM) | step2c_literal_v3 | |||||||
| 149 | P-selectin | protein | Q14242 | PF398sl | 178.0 pM | -9.75 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 310.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF398sl | 178 | step2c_literal_v3 | ||||
| 38 | alpha-thrombin | protein | P05154 | RNAR9D-14T | GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC | 1.0 nM | -9.0 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 310.15 | 7.4 | Hepes-saline buffer with 0.01% BSA | 2'F-RNA | 2' Fluorocytosine; 2' Fluorouracil | 22385910 | 10.1111/j.1538-7836.2012.04679.x | Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) and α-thrombin (apparent Kd =1 nM) | step2c_literal_v3 | ||
| 150 | P-selectin | protein | Q14242 | PF422sl | 1000.0 pM | -9.0 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 310.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | PF422sl | 1 X 103 | step2c_literal_v3 | ||||
| 41 | hOX40 | protein | 9C7 | GGGAGGACGATGCGGAAAAAAGAACACUUCCGAUUAGGGCCCACCCUAACGGCCGCAGACGACTCGCCCGA | 1.7 nM | -8.77 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 310.15 | 7.5 | selection buffer F (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2, and 0.01% BSA) | 2'F-RNA | 23113766 | 10.1089/nat.2012.0388 | 9C7 | 11 | 1.7 | step2c_literal_v3 | ||||
| 31 | VWF A1-domain | protein | P04275 | ARC1779 | 2.0 nM | -8.699 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 298.15 | Dulbecco's PBS containing 0.1 mg mL-1 BSA | DNA/RNA | 2'-O-methyl; phosphorothioate; inverted deoxythymidine; 20-kDa PEG conjugation | 19422452 | 10.1111/j.1538-7836.2009.03459.x | This resulted in a final aptamer (ARC1779) that is a 40-nucleotide modified DNA/RNA oligonucleotide with a K D of 2 nM for the A1-domain. | step2c_literal_v3 | |||||
| 165 | porcine thrombin | protein | RNAR9D-14T | GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC | 5.0 nM | -8.301 | non_intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 2'F-RNA | 2' Fluorocytosine; 2' Fluorouracil | 22385910 | 10.1111/j.1538-7836.2012.04679.x | RNAR9D-14T binds to porcine thrombin (apparent K d=5 nM) | step2c_literal_v3 | ||||||
| 22 | murine OX40 | protein | 9.8 | GGGAGGACGATGCGGCAGUCUGCAUCGUAGGAAUCGCCACCGUAUACUUUCCCACAGACGACTCGCTGAGGATCCGAGA | 8.0 nM | -8.097 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 7.4 | 20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2 | RNA | 2'F-pyrimidine | 18635004 | 10.1016/j.chembiol.2008.05.016 | Aptamer 9.8 was chosen for further study, since it had the highest affinity for the OX40 fusion protein. | step2c_literal_v3 | ||||
| 47 | PDGFR β | protein | P09619 | Gint4.T | UGUCGUGGGGCAUCGAGUAAAUGCAAUUCGACA | 9.6 nM | -8.018 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 2'F-RNA | 2'-fluoropyrimidine; nuclease-resistant | 24566984 | 10.1038/mt.2013.300 | This aptamer is able to specifically bind to the human PDGFR β ectodomain (Kd: 9.6 nM) | step2c_literal_v3 | |||||
| 37 | prothrombin | protein | P00734 | RNAR9D-14T | GGCGGUCGAUCACACAGUUCAAACGUAAUAAGCCAAUGUACGAGGCAGACGACUCGCC | 10.0 nM | -8.0 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 310.15 | 7.4 | Hepes-saline buffer with 0.01% BSA | 2'F-RNA | 2' Fluorocytosine; 2' Fluorouracil | 22385910 | 10.1111/j.1538-7836.2012.04679.x | Nitrocellulose filter binding indicates that RNAR9D-14T binds with high affinity to both human prothrombin (apparent K d =10 nM) | step2c_literal_v3 | ||
| 42 | hOX40 | protein | 11F11 | GGGAGGACGATGCGGAACGGGACCACCCAUGCCAGGGGACCACCUCAGGCAGCGCCAGACGAC | 10.0 nM | -8.0 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 310.15 | 7.5 | selection buffer F (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2, and 0.01% BSA) | 2'F-RNA | 23113766 | 10.1089/nat.2012.0388 | 11F11 | 8 | 10 | step2c_literal_v3 | ||||
| 23 | murine OX40 | protein | 11.2 | GGGAGGACGATGCGGGAUACCAGGAUCACAUCCUGAGGAACCCCGGCUCCCAACCUAGACGACTCGCTGAGGATCCGAGA | 25.0 nM | -7.602 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 7.4 | 20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2 | RNA | 2'F-pyrimidine | 18635004 | 10.1016/j.chembiol.2008.05.016 | 11.2 | AUACCAGGAUCACAUCCUGAGGAACCCCGGCUCCCAACCU | 25 | 4 | step2c_literal_v3 | ||||
| 24 | murine OX40 | protein | 11.4 | GGGAGGACGATGCGGACUUUAAUCCUCGCACUCAGCGCGCAUCACCCUUGACAUCAAGACGACTCGCTGAGGATCCGAGA | 25.0 nM | -7.602 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 7.4 | 20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2 | RNA | 2'F-pyrimidine | 18635004 | 10.1016/j.chembiol.2008.05.016 | 11.4 | CUUUAAUCCUCGCACUCAGCGCGCAUCACCCUUGACAUCA | 25 | 5 | step2c_literal_v3 | ||||
| 25 | murine OX40 | protein | 9.3 | GGGAGGACGATGCGGACAAACCAGCUAUUUCCUGAGGUACCCCGGCUCUCCAUGGAGACGACTCGCTGAGGATCCGAGA | 25.0 nM | -7.602 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 7.4 | 20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2 | RNA | 2'F-pyrimidine | 18635004 | 10.1016/j.chembiol.2008.05.016 | 9.3 | CAAACCAGCUAUUUCCUGAGGUACCCCGGCUCUCCAUGG | 25 | 4 | step2c_literal_v3 | ||||
| 43 | hOX40 | protein | 9C7T | GGGGGAATTCTAATACGACTCACTATAGGGATGCGGAAAAAAGAACACT | 29.0 nM | -7.538 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | backfill_text_verified | filter_binding | 310.15 | 7.5 | selection buffer F (20 mM HEPES, 150 mM NaCl, 2 mM CaCl2, and 0.01% BSA) | 2'F-RNA | 5'-biotin | 23113766 | 10.1089/nat.2012.0388 | observed Kd of * 29nM | step2c_literal_v3 | |||
| 26 | murine OX40 | protein | 11.8 | GGGAGGACGATGCGGAUACCAGCGAAUAACUCGCUGAGGAACCCGACUCACAAAAGACGACTCGCTGAGGATCCGAGA | 50.0 nM | -7.301 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | 7.4 | 20 mM HEPES (pH 7.4), 150 mM NaCl, 2 mM CaCl2 | RNA | 2'F-pyrimidine | 18635004 | 10.1016/j.chembiol.2008.05.016 | 11.8 | AUACCAGCGAAUAACUCGCUGAGGAACCCGACUCACAAA | 50 | 1 | step2c_literal_v3 | ||||
| 137 | thrombin | protein | P00734 | HD1 | GGTTGGTGTGGTTGG | 110.0 nM | -6.959 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | selection buffer | DNA | 41053535 | 10.1002/advs.202509867 | HD1 binds both thrombin (K D = 110 nm) | step2c_literal_v3 | |||||
| 270 | prothrombin | protein | P00734 | HD1-12A-DAB | 296.0 nM | -6.529 | non_intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_supp | filter_binding | selection buffer | DNA | 41053535 | 10.1002/advs.202509867 | and prothrombin with K D s of 13.1 pm and 296 nm | step2c_literal_v3 | |||||||
| 138 | prothrombin | protein | P00734 | HD1 | GGTTGGTGTGGTTGG | 992.0 nM | -6.003 | intrinsic | Kd | Gold | v4 | extraction_verified | verified_in_text_or_SI | original | filter_binding | selection buffer | DNA | 41053535 | 10.1002/advs.202509867 | and prothrombin (K D = 992 nm) | step2c_literal_v3 | |||||
| 151 | P-selectin | protein | Q14242 | NX244 | 9000000.0 pM | -5.046 | intrinsic | Kd | Gold | v4 | extraction_verified | pending_manual_figure | filter_binding | 310.15 | 7.4 | SHMCK buffer | 1.0 | 2'F-RNA | 9743465 | 10.1089/oli.1.1998.8.265 | NX244 | 9 X 106 | step2c_literal_v3 |
Advanced export
JSON shape: default, array, newline-delimited
CREATE VIEW v_kd AS
SELECT k.id,
target_name_canonical,
CASE
WHEN target_name_canonical LIKE '%cell%' OR target_name_canonical LIKE '%vesicle%' OR target_name_canonical LIKE '%exosome%' THEN 'cell/EV'
WHEN target_name_canonical LIKE '%BSA%' OR target_name_canonical LIKE '%sLe%' OR target_name_canonical LIKE '%glycan%' OR target_name_canonical LIKE '% Le %' THEN 'glycan/conjugate'
ELSE 'protein'
END AS target_type,
target_uniprot, aptamer_name, aptamer_seq,
(COALESCE(kd_value,'') || CASE WHEN COALESCE(kd_unit,'')!='' THEN ' '||kd_unit ELSE '' END) AS kd_reported,
CAST(NULLIF(kd_log10_molar,'') AS REAL) AS kd_log10_molar,
measurement_class, binding_constant_type, 'Gold' AS tier, k.tier AS source_origin,
CASE
WHEN vh.verdict='confirmed' THEN 'human_verified'
WHEN vh.verdict='corrected' THEN 'human_corrected'
WHEN vh.verdict='rejected' THEN 'human_rejected'
WHEN k.verification_status='agent_verified_L2' THEN 'multi_agent_verified'
WHEN k.verification_status IN ('verified','CONFIRM') THEN 'extraction_verified'
ELSE 'automated'
END AS verification_level,
sequence_status, seq_source, pi_provenance_flag,
assay_method,
CAST(NULLIF(assay_temperature_k,'') AS REAL) AS assay_temperature_k,
CAST(NULLIF(assay_ph,'') AS REAL) AS assay_ph,
assay_buffer, assay_cations, aptamer_chemistry, aptamer_modifications,
source_pmid, doi, verbatim_quote, source_db
FROM kd_measurements k LEFT JOIN verification_human vh ON vh.row_id=k.source_record_id
WHERE LOWER(COALESCE(k.include_in_gold,''))='true';